Application of Paenibacillus provencensis PP-2 in Preservation of Sea Bass
By using Bacillus Provence PP-2 fermented extract solution, the spoiled bacteria in sea bass was suppressed, and the problem of unsuppressed cold-philic bacteria in ice-temperature preservation was solved, and the effective preservation and quality maintenance of sea bass was achieved.
Patent Information
- Application Number
- CN202311178053.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-13
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2043-09-13
AI Technical Summary
Under the existing ice-temperature preservation method, the cold-bearing bacteria in sea bass are not completely inhibited during transportation, resulting in rapid deterioration of aquatic products, shortening the shelf life, and traditional methods are difficult to effectively inhibit the growth of spoiled bacteria.
Bacillus Provence PP-2 or its fermented extract is used to form a solution by soaking sea bass sea bass to inhibit the growth of Syvazazi and Pseudomonas raspberry to prepare preparations for preserving sea bass.
It significantly inhibits the dominant spoilage bacteria in sea bass, extends the shelf life, maintains the quality of fish, and has high economic value and application potential.
Smart Images

Figure CN117158474B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the application of Paenibacillus provencensis PP-2 in the preservation of sea bass, belonging to the technical field of biological preservation. Background Art
[0002] Sea bass (Lateolabrax japonicas), also known as flower bass, seven-star bass, Japanese sea bass, etc., is widely distributed in waters such as the Atlantic Ocean and the Pacific Ocean. The main production areas are the Sea of Japan, the Bohai Sea, the Yellow Sea, etc. in Asia, and it is one of the important economic fish in China. At present, the ice-temperature preservation transportation method is often used in the actual transportation of sea bass. However, during the ice-temperature preservation (0-2°C) process, psychrophilic bacteria are not completely inhibited, and the aquatic products will still deteriorate, seriously shortening their preservation period, usually 3-5 days, generally not exceeding one week. According to statistics, about 30% of the fish globally lose their use value due to spoilage every year. Therefore, the development of new green preservation technologies has become the research focus of the preservation of deep-sea cultured fish.
[0003] The genus Paenibacillus originally belonged to the genus Bacillus. In 1993, Ash et al. created this genus of bacteria through 16S rDNA gene sequence analysis from the genus Bacillus. The metabolic antibacterial substances produced by Paenibacillus include peptides, enzymes, and volatile organic compounds, etc. There are two types of antibacterial peptides: bacteriocins synthesized by ribosomes, and low-molecular-weight lipopeptides with a molecular weight of 300-3000 Da synthesized non-ribosomally. Lipopeptide antibiotics have unique physical and chemical properties such as high temperature resistance, acid and alkali resistance, low toxicity and environmental protection, and good antibacterial effects, and are currently hot compounds for research. The lipopeptide antibiotics produced by Paenibacillus, so far, the main ones that have been well understood and studied are mainly three categories: fusaricidin, polymyxin, and tridecaptin. Compared with the broad-spectrum antibacterial or antibiotics with good antagonistic effects against fungi such as iturin, surfactin, and fengycin produced by Bacillus subtilis, polymyxin, tridecaptin, etc. have specific resistance to Gram-negative bacteria. For example, Ma Guizhen et al. found a strain of Paenibacillus polymyxa L1-9 through research, and carried out fermentation research on it. The metabolite has a very good disease control effect on tomato early blight. Wu Xuechang et al. isolated a variety of antibiotic compounds such as polypeptin and polyketides from Paenibacillus ehimensis B69 strain. Among them, polypeptin has inhibitory effects on bacteria such as Escherichia coli, Staphylococcus aureus, Bacillus subtilis, etc. and fungi such as Candida albicans, Fusarium oxysporum, and Rhizoctonia solani, while polyketides mainly inhibit Staphylococcus aureus.
[0004] Paenibacillus provencensis PP-2 belongs to the genus Paenibacillus, and its taxonomic name is Paenibacillus provencensis PP-2. It was isolated from the sturgeon caviar prepared by Xinglong Technology Co., Ltd. in Quzhou City, Zhejiang Province, and is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 20211109. The preservation information and specific details of this bacterium are recorded in the Chinese invention patent CN 114134085 A. CN 114134085 A discloses the application of this bacterium in inhibiting the formation of nitrosamines in food. Currently, there are no relevant reports on the inhibition of the spoilage of sea bass by this bacterium. Summary of the Invention
[0005] In view of the above-mentioned prior art, the present invention provides a new use of Paenibacillus provencensis.
[0006] The present invention is achieved through the following technical solutions:
[0007] Application of Paenibacillus provencensis PP-2 or its fermentation extract in the preservation of sea bass.
[0008] Application of Paenibacillus provencensis PP-2 or its fermentation extract in the preparation of a preparation for the preservation of sea bass.
[0009] Further, in specific applications, the fermentation extract of Paenibacillus provencensis PP-2 is dissolved in water to form a solution, and the sea bass is soaked in this solution.
[0010] Further, the concentration of the fermentation extract of Paenibacillus provencensis PP-2 in the solution is 25 - 200 mg / ml, preferably 150 - 200 mg / ml.
[0011] Application of Paenibacillus provencensis PP-2 or its fermentation extract in inhibiting Shewanella putrefaciens and / or Pseudomonas fragi.
[0012] Application of Paenibacillus provencensis PP-2 or its fermentation extract in the preparation of a preparation with the efficacy of inhibiting Shewanella putrefaciens and / or Pseudomonas fragi.
[0013] Further, the fermentation extract of Paenibacillus provencensis PP-2 is prepared by the following method: cultivate Paenibacillus provencensis PP-2 to obtain a fermentation broth; centrifuge, collect the supernatant, and freeze-dry to obtain it.
[0014] Even further, the fermentation extract of Paenibacillus provencensis PP-2 is prepared by the following method:
[0015] (1) Activation: Inoculate Bacillus paralicheniformis PP-2 on LB solid medium, invert it and place it in an oven at 27°C for 48 h; pick a single colony from the solid plate and inoculate it into 5 mL of LB liquid medium for activation. Incubate it in a shaker at 27°C (150 rpm) for 12 - 24 h to obtain a seed solution.
[0016] (2) Amplification culture: Inoculate 1 mL of the seed solution into 100 mL of LB liquid medium and perform fermentation culture in a shaker at 27°C (150 rpm, for 7 days) to obtain a fermentation broth.
[0017] (3) Centrifugation: Centrifuge the fermentation broth (5000 g, 10 min) and collect the supernatant.
[0018] (4) Filtration: Filter and sterilize the supernatant with a 0.22 μm aqueous filter membrane.
[0019] (5) Freeze-drying: Perform freeze-drying to obtain the fermentation extract of Bacillus paralicheniformis PP-2.
[0020] A preparation with the efficacy of inhibiting Shewanella putrefaciens and / or Pseudomonas fragi, whose active ingredient is the above-mentioned fermentation extract of Bacillus paralicheniformis PP-2, may also include common excipients such as water. This preparation can be used as a fresh-keeping agent for sea bass.
[0021] In vitro antibacterial experiments were carried out in the present invention. The experiments showed that the fermentation extract of Bacillus paralicheniformis PP-2 had significant inhibitory effects on the dominant spoilage bacteria Shewanella putrefaciens and Pseudomonas fragi of sea bass, and also had inhibitory effects on the Gram-negative bacterium Escherichia coli, the fungus Candida albicans, and the Gram-positive bacteria Bacillus subtilis and Listeria monocytogenes, with a broad antibacterial spectrum. The stability experiments showed that the inhibitory effects of the fermentation supernatant of Bacillus paralicheniformis PP-2 on Shewanella putrefaciens and Pseudomonas fragi were not significantly affected by temperature, ultraviolet light, and protease, but were significantly reduced under the action of acid or alkali.
[0022] Research in the present invention shows that Bacillus paralicheniformis PP-2 can effectively inhibit the dominant bacteria Shewanella putrefaciens and Pseudomonas fragi screened from Japanese sea bass, can be used for the fresh-keeping of sea bass, has high economic value, and is of great significance for the fresh-keeping of aquatic products. The present invention expands the uses of Bacillus paralicheniformis PP-2 and is of great significance for the industrial application of Bacillus paralicheniformis PP-2.
[0023] All the terms and phrases used in the present invention have the general meanings well-known to those skilled in the art. Description of the Drawings
[0024] Figure 1 : Diagram of the change in the microbial community structure of sea bass meat.
[0025] Figure 2 : Schematic diagram of the inhibitory effect of different strains and days on Shewanella putrefaciens.
[0026] Figure 3 : Schematic diagram of the inhibitory effect of different strains and days on Pseudomonas fragi.
[0027] Figure 4 : Schematic diagram of the growth curves of three strains. Among them, A: Growth curve varying with hours; B: Growth curve varying with days.
[0028] Figure 5 : Schematic diagram of the inhibitory effect of supernatant at different temperatures on specific spoilage bacteria. Among them, A: Effect on Shewanella putrefaciens; B: Effect on Pseudomonas fragi.
[0029] Figure 6 : Schematic diagram of the inhibitory effect of supernatant under ultraviolet irradiation on specific spoilage bacteria. Among them, A: Effect on Shewanella putrefaciens; B: Effect on Pseudomonas fragi.
[0030] Figure 7 : Schematic diagram of the inhibitory effect of supernatant at different pH values on specific spoilage bacteria. Among them, A: Effect on Shewanella putrefaciens; B: Effect on Pseudomonas fragi.
[0031] Figure 8 : Schematic diagram of the inhibitory effect of supernatant under the action of different proteases on specific spoilage bacteria. Among them, A: Effect on Shewanella putrefaciens; B: Effect on Pseudomonas fragi.
[0032] Figure 9 : Schematic diagram of the antibacterial rates of the fermentation supernatant of Paenibacillus provencensis PP-2 against Shewanella putrefaciens and Pseudomonas fragi. Among them, A: Effect on Shewanella putrefaciens; B: Effect on Pseudomonas fragi.
[0033] Figure 10 : Schematic diagram of the antibacterial rates of the fermentation supernatant of Paenibacillus provencensis PP-2 against Escherichia coli, Candida albicans, Bacillus subtilis and Listeria monocytogenes. Among them, A: Effect on Listeria monocytogenes; B: Effect on Bacillus subtilis; C: Effect on Candida albicans; D: Effect on Escherichia coli.
[0034] Figure 11 : Schematic diagram of the effect of the fermentation supernatant of Paenibacillus provencensis PP-2 on the total number of colonies of refrigerated perch meat.
[0035] Figure 12 : Schematic diagram of the effect of the fermentation supernatant of Paenibacillus provencensis PP-2 on TBA of refrigerated perch meat.
[0036] Figure 13 : Schematic diagram of the effect of the fermentation supernatant of Paenibacillus provencensis PP-2 on TVB-N in refrigerated perch meat. Detailed implementation manners
[0037] The present invention will be further described below in conjunction with embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.
[0038] The instruments, reagents, and materials involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, and materials existing in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods and detection methods existing in the prior art.
[0039] Example 1 Screening of dominant spoilage bacteria in perch during refrigeration
[0040] Take 5 g of perch meat and place it in a sterile homogenization bag containing 45 ml of normal saline. Beat it with a beating homogenizer for 2 minutes to make a 1:10 homogenate. After diluting to the optimal gradient, pour plates and analyze the total viable bacteria, Shewanella, Pseudomonas, Lactobacillus, Aeromonas, psychrophilic bacteria, and Escherichia coli numbers in perch meat samples on days 0, 3, 6, and 9. Pour plates of PCA medium and culture at 30 °C for 72 h, pour plates of CFC medium, LA medium, and RYAN medium and culture at 30 °C for 48 h, pour plates of VRBGA medium and MRS medium and culture at 37 °C for 48 h, and pour plates of CVT and culture at 20 °C for 24 h. Select plates with colony counts between 30 and 300 CFU for counting analysis.
[0041] Select 0.5 g of perch meat samples on days 0, 3, 6, and 9 and use Spin Kit for Soil DNA extraction kit (MP Biomedicals) instructions to extract the total genomic DNA of the microbial community. Use 1% agarose gel electrophoresis to detect the quality of the extracted genomic DNA, and use NanoDrop2000 (Thermo Scientific, USA) to measure the DNA concentration and purity.
[0042] Perform PCR amplification of the 338F_806R region of the 16S rRNA gene on the extracted DNA. Take 3 μL of the PCR amplification product and detect the PCR product by 2% agarose gel electrophoresis. Referring to the preliminary quantitative results of electrophoresis, use QuantiFluor for the PCR product TMThe -ST blue fluorescence quantitative system (Promega) was used for detection and quantification. Then, according to the sequencing volume requirements of each sample, corresponding proportions were mixed. Subsequently, Illumina library construction and on-machine sequencing were carried out.
[0043] The primers used for amplification were as follows: Forward primer 338F (direction 5'-3'): ACTCCTACGGGAGGCAGCAG; Reverse primer 806R (direction 5'-3'): GGACTACHVGGGTWTCTAAT. The PCR amplification system was (a total of 20 μL): 5×FastPfu Buffer, 4 μL; 2.5 mM dNTPs, 2 μL; Forward Primer (5 μM), 0.8 μL; Reverse Primer (5 μM), 0.8 μL; FastPfu DNA Polymerase, 0.4 μL; BSA 0.2 μL; genomic DNA, 10 ng; the balance was sterile ultrapure water. The PCR amplification conditions were: pre-denaturation at 95°C for 3 min, followed by 29 cycles, each cycle including denaturation at 95°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 45 s, and finally stable extension at 72°C for 10 min, and stored at 10°C until the reaction ended.
[0044] Experimental results: The changes in the bacterial community structure of sea bass meat during refrigeration were as Figure 1 shown. As Figure 1 can be seen, at the initial stage of storage, Acinetobacter, Staphylococcus, and Macrococcus accounted for relatively large proportions in the bacterial community structure, 28.84%, 23.25%, and 22.39% respectively; as the storage time extended, the proportions of Acinetobacter, Staphylococcus, and Macrococcus gradually decreased, while the proportions of Shewanella and Pseudomonas gradually increased; at the end of storage, the proportions of Shewanella and Pseudomonas reached 71.11% and 13.54% respectively, so they were the dominant spoilage bacteria during the refrigeration period of sea bass.
[0045] Example 2 Isolation and purification of the dominant spoilage bacteria of sea bass during refrigeration
[0046] The sea bass meat was refrigerated according to the method of Example 1. Select the plate with better separation, pick different colonies and inoculate them on LB agar medium, culture at 30°C, pick the colonies with better growth, purify for 2 - 3 generations, add 50% glycerol, and store at -80°C for standby.
[0047] The purified bacteria were lysed with the DNA by the Tsingke direct amplification kit [T5 Direct PCR Kit (Plant)] to release DNA, followed by PCR amplification of the 16S rRNA gene. The target fragment was recovered by cutting the gel using the TSINGKE DNA Gel Extraction Kit (codeNo.GE0101), and the first-generation sequencing was performed using a 3730 sequencer. The sequencing results were compared and analyzed on the NCBI website.
[0048] The primers used for amplification were as follows: Forward primer 27F (direction 5'-3'): AGAGTTTGATCCTGGCTCAG; Reverse primer (direction 5'-3') 1492R: TACGGCTACCTTGTTACGACTT. The PCR amplification system was (a total of 25 μL): Forward Primer 2 μL; Reverse Primer, 2 μL; Template, 2 μL; the balance was ddH2O. The PCR amplification conditions were: pre-denaturation at 98 °C for 3 min, followed by 35 cycles, each cycle including denaturation at 98 °C for 10 s, annealing at 55 °C for 16 s, extension at 72 °C for 20 s, and finally stable extension at 72 °C for 5 min.
[0049] The isolated and purified single colonies were inoculated onto sterile perch fish meat, and the changes in the total number of colonies, TBA, and TVB-N content in the fish meat under refrigeration were measured. The spoilage ability of the spoilage bacteria was analyzed based on the size of the spoilage factors.
[0050] Experimental results: Seven pure strains of bacteria were isolated from refrigerated perch, namely Shewanella putrefaciens, Shewanella hafniensis, Pantoea agglomerans, Rahnella aquatilis, Aeromonas salmonicida, and two strains of Pseudomonas fragi. The results of the spoilage ability experiment showed that the spoilage factors Y (TVB-N / CFU) and Y (TBA / CFU) of Shewanella putrefaciens reached 1.756×10 -7 and 6.268×10 -10 respectively at the end of storage, and the spoilage factors Y (TVB-N / CFU) and Y (TBA / CFU) of Pseudomonas fragi reached 1.708×10 -7 and 65.989×10 -10 respectively at the end of storage, which were higher than those of other spoilage bacteria. Therefore, Shewanella putrefaciens and Pseudomonas fragi were identified as the dominant spoilage bacteria of sea perch during refrigeration.
[0051] Example 3 Preparation of antibacterial fermentate
[0052] Three biocontrol bacteria previously isolated from sturgeon caviar by the research group were selected, namely: Stenotrophomonas rhizophila SR-1, Paenibacillus provencensis PP-2, and Bacillus subtilis CF-3. After activating the three bacteria, liquid fermentation was carried out in LB medium at 27 °C. The coating method was used to explore the effects of days and strains on Shewanella putrefaciens and Pseudomonas fragi.
[0053] The fermented SR-1, PP-2, and CF-3 bacterial solutions were centrifuged (5000g, 10 min), the precipitate was discarded, the supernatant was filtered through a 0.22 μm microporous filter membrane, then filled into a sterile bottle and stored in a 4 °C refrigerator.
[0054] Shewanella putrefaciens and Pseudomonas fragi were activated to the second generation. 10 μL of the bacterial solution was taken and added to 990 μL of PBS buffer for dilution. Then 50 μL of the diluted bacterial solution was taken and mixed with the sterile supernatant in a volume ratio of 1:1 and reacted for one hour; afterwards, 20 μL of the mixed solution was taken and added to 980 μL of PBS buffer for dilution. Then 20 μL was taken and spread on the solidified Shewanella putrefaciens and Pseudomonas fragi agar respectively, and inverted in a 30 °C incubator for 48 h to observe the number of colonies.
[0055] The experimental results are as Figure 2 、 Figure 3 shown. As can be seen from the figure, Paenibacillus provencensis PP-2 has the best inhibitory effect on Shewanella putrefaciens and Pseudomonas fragi, significantly better than Stenotrophomonas rhizophila SR-1 and Bacillus subtilis CF-3. And when liquid fermentation lasts for 7 d, the antibacterial property of the metabolites of Paenibacillus provencensis PP-2 reaches the highest. The growth curves of the three bacteria are as Figure 4 shown.
[0056] Example 4 Stability analysis of the fermentation supernatant of Paenibacillus provencensis PP-2
[0057] The sterile supernatant of PP-2 was cultured at 40 °C, 60 °C, 80 °C, and 100 °C for 30 min. After cooling to room temperature, it was filtered, and the coating method was used to explore the change of antibacterial property. The results are as Figure 5 shown.
[0058] The sterile supernatant of PP-2 was irradiated with ultraviolet light for 2, 4, 6, 8, 10, and 12 h respectively, then filtered, and the coating method was used to explore the change of antibacterial property. The results are as Figure 6 shown.
[0059] The pH of the sterile supernatant of PP-2 was adjusted to 2, 4, 6, 8, and 10 respectively. After reacting for 30 min, it was adjusted to 7, then filtered, and the coating method was used to explore the change of antibacterial property. The results are as Figure 7 shown.
[0060] Pepsin, trypsin, and compound protease were respectively added to the PP-2 sterile supernatant. After reacting for 30 min, the enzymes were inactivated at 80 °C for 10 min. After cooling to room temperature, the solution was filtered through a membrane. The film coating method was used to explore the change in antibacterial properties, and the results are as Figure 8 shown.
[0061] Example 5 Analysis of the Antibacterial Activity of the Fermentation Supernatant of Paenibacillus provencensis PP-2
[0062] The PP-2 sterile supernatant was freeze-dried, and solutions with concentrations of 12.5, 25, 50, 100, 150, and 200 mg / ml were prepared. 100 μL of bacterial solution and 100 μL of gradient metabolite solution were respectively added to a 96-well plate. The change in absorbance was observed after 24 h.
[0063] Shewanella putrefaciens, Pseudomonas fragi, the Gram-negative bacterium Escherichia coli, the fungus Candida albicans, and the Gram-positive bacteria Bacillus subtilis and Listeria monocytogenes were selected as target bacteria. The 96-well plate method was used to explore the change in antibacterial properties, and the results are as Figure 9 、 Figure 10 shown.
[0064] Example 6 Preservation Effect of the Fermentation Supernatant of Paenibacillus provencensis PP-2 on Japanese Sea Bass
[0065] Live Japanese sea bass purchased from Guoxin Group were transported to the laboratory, and then slaughtered, scaled, eviscerated, skinned, and rinsed with distilled water. The sea bass meat was cut into 5×5×2 cm fish slices and randomly divided into 3 groups: the experimental group (treated with the fermentation supernatant of Paenibacillus provencensis PP-2, concentration 150 mg / ml), the negative control group (treated with distilled water), and the positive control group (treated with Nisin, concentration 50 mg / ml). All samples were soaked in the corresponding solution for 20 min and then air-dried, and then placed into sterile homogenization bags and stored in a 4 °C refrigerator. The total number of colonies, TBA, TVB-N, and texture were measured on days 0, 2, 4, 6, and 8 respectively to analyze whether the fermentation supernatant of Paenibacillus provencensis PP-2 has a preservation effect on sea bass meat.
[0066] The method for measuring the total number of colonies refers to GB 4789.2-2016 of the national standard and was slightly modified. Take 5 g of sea bass meat, cut it into pieces and place it in a sterile homogenization bag containing 45 ml of normal saline, and beat and homogenize to form a bacterial suspension. The bacterial suspension was serially diluted 10-fold with sterile ultrapure water. After diluting to the optimal gradient, pour the plate, and count after culturing at 27 °C for 72 h.
[0067] The determination method of TBA refers to the national standard GB5009.181-2016 with slight modifications. Take 4g of perch meat and place it in a 50ml centrifuge tube. Add 40ml of trichloroacetic acid mixture (accurately weigh 37.50g of trichloroacetic acid and 0.50g of disodium ethylenediaminetetraacetate, dissolve with water, and dilute to 500mL). Cover and shake well. Place it in a shaker at 50°C and shake for 30min, then take it out and cool to room temperature. Filter with double-layer quantitative filter paper. Mix the filtrate and each gradient standard solution with the aqueous solution of thiobarbituric acid in a ratio of 1:1. After adding the stopper and shaking well, place it in a water bath at 90°C and react for 30min. Take it out and cool to room temperature, using the trichloroacetic acid mixture solution as the sample blank. Use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance values of the sample solution and the standard solution at 532nm, and calculate the TBA content.
[0068] The determination method of TVB-N refers to the national standard GB5009.228-2016 with slight modifications. Take 5g of perch meat and place it in a 50ml centrifuge tube. Add 25ml of water and shake at room temperature for 30min, then filter. Apply the water-soluble glue to the edge of the diffusion dish. Add 1ml of boric acid solution and 2 drops of indicator (1 part of methyl red ethanol solution and 5 parts of bromocresol green ethanol mixture) to the inner chamber in the center of the dish. Add 1ml of the filtrate to the outer chamber of the dish, cover it with a glass cover, and quickly add 1ml of saturated potassium carbonate solution through the notch gap of the glass cover. Immediately push the frosted glass cover flat to seal the diffusion dish tightly, and gently rotate it in a circular motion. Place it at 37°C for 2h, take it out and cool to room temperature, then titrate with 0.01mol / L hydrochloric acid standard titrant until the end point of the titration, and the color is purplish red. Calculate the TVB-N content through the titration volume.
[0069] The results are as Figure 11 、 Figure 12 、 Figure 13 shown. According to the meat quality and hygiene standard recommendations, a total bacterial count of 10 6 CFU / g or more is regarded as spoiled meat. It can be seen from Figure 11 that on the 4th day, the log content of the total bacterial count in the PP-2 group and the Nisin group was less than 4, while that in the negative control group was greater than 4, indicating a spoiled state. On the 6th day, the log content of the total bacterial count in the PP-2 group and the Nisin group was greater than 4, indicating that after adding the metabolites of PP-2 and Nisin to perch meat, the growth rate of bacteria in the fish meat can be slowed down. It can be seen from Figure 12 、 Figure 13 that with the extension of the storage time, the contents of TBA and TVB-N in the PP-2 group and the Nisin group were significantly lower than those in the negative control group, indicating that after adding the metabolites of PP-2 and Nisin to perch meat, the oxidation rate of proteins and lipids in the fish meat can be delayed, the generation of TBA and TVB-N can be slowed down, and thus the spoilage can be slowed down.
[0070] Example 7 Preparation of the fermentation extract of Paenibacillus pabuli PP-2
[0071] The steps are as follows:
[0072] (1) Activation: Inoculate Bacillus paralicheniformis PP-2 on an LB solid medium, invert it and place it in an oven at 27 °C for 48 h; pick a single colony from the solid plate and inoculate it into 5 mL of LB liquid medium for activation, and culture it in a shaker at 27 °C (150 rpm) for 12 - 24 h to obtain a seed solution;
[0073] (2) Amplification culture: Inoculate 1 mL of the seed solution into 100 mL of LB liquid medium, and place it in a shaker at 27 °C for fermentation culture (150 rpm, 7 days) to obtain a fermentation broth;
[0074] (3) Centrifugation: Centrifuge the fermentation broth (5000 g, 10 min), and collect the supernatant;
[0075] (4) Filtration through a membrane: Filter the supernatant through a 0.22 μm aqueous filter membrane to remove bacteria;
[0076] (5) Freeze-drying: Perform freeze-drying to obtain the fermentation extract of Bacillus paralicheniformis PP-2.
[0077] The above embodiments are provided to those skilled in the art to fully disclose and describe how to implement and use the claimed embodiments, rather than to limit the scope disclosed herein. Modifications that are obvious to those skilled in the art will be within the scope of the appended claims.
Claims
1. Use of Bacillus thuringiensis subsp. kurstaki PP-2 fermentation extract in inhibiting Shewanella putrefaciens and / or Pseudomonas fragi, characterized in that: The concentration of the Paenibacillus provencensis PP-2 fermentation extract is 50-200 mg / ml; The Paenibacillus provencensis PP-2 fermentation extract is prepared by the following method: cultivating Paenibacillus provencensis PP-2 with LB liquid medium to obtain a fermentation broth; centrifuging, collecting the supernatant, and freeze-drying to obtain it; The Paenibacillus provencensis PP-2 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 20211109.
2. Use of the Paenibacillus provencensis PP-2 fermentation extract according to claim 1 in inhibiting Shewanella putrefaciens and / or Pseudomonas fragi, characterized in that, The Paenibacillus provencensis PP-2 fermentation extract is prepared by the following method: (1) Activation: inoculating Paenibacillus provencensis PP-2 on an LB solid medium, placing it upside down in an oven, and culturing for 48 h; picking a single colony from the solid plate, inoculating it into an LB liquid medium for activation, and culturing it in a shaker for 12-24 h to obtain a seed solution; (2) Subculture: inoculating the seed solution into an LB liquid medium, and performing fermentation culture in a shaker to obtain a fermentation broth; (3) Centrifugation: centrifuging the fermentation broth and collecting the supernatant; (4) Filtration: filtering and sterilizing the supernatant with a 0.22 μm aqueous filter membrane; (5) Freeze-drying: performing freeze-drying to obtain the Paenibacillus provencensis PP-2 fermentation extract.
3. Use of the fermentation extract of Paenibacillus provencensis PP-2 in the preparation of a preparation having the efficacy of inhibiting Shewanella putrefaciens and / or Pseudomonas fragi, characterized in that: The concentration of the Paenibacillus provencensis PP-2 fermentation extract is 50-200 mg / ml; The Paenibacillus provencensis PP-2 fermentation extract is prepared by the following method: cultivating Paenibacillus provencensis PP-2 with LB liquid medium to obtain a fermentation broth; centrifuging, collecting the supernatant, and freeze-drying to obtain it; The Paenibacillus provencensis PP-2 is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC NO: M 20211109.
4. Use of the Paenibacillus provencensis PP-2 fermentation extract according to claim 3 in the preparation of a preparation having the efficacy of inhibiting Shewanella putrefaciens and / or Pseudomonas fragi, characterized in that, The Paenibacillus provencensis PP-2 fermentation extract is prepared by the following method: (1) Activation: inoculating Paenibacillus provencensis PP-2 on an LB solid medium, placing it upside down in an oven, and culturing for 48 h; picking a single colony from the solid plate, inoculating it into an LB liquid medium for activation, and culturing it in a shaker for 12-24 h to obtain a seed solution; (2) Subculture: inoculating the seed solution into an LB liquid medium, and performing fermentation culture in a shaker to obtain a fermentation broth; (3) Centrifugation: centrifuging the fermentation broth and collecting the supernatant; (4) Filtration: filtering and sterilizing the supernatant with a 0.22 μm aqueous filter membrane; (5) Freeze-drying: performing freeze-drying to obtain the Paenibacillus provencensis PP-2 fermentation extract.
Citation Information
Patent Citations
Paenibacillus provenensis capable of inhibiting generation of nitrosamine and application of paenibacillus provenensis
CN114134085A