An InDel site and KASP marker primer set for identifying tomato seed color and its application

Abstract

The invention belongs to the field of biotechnology, and specifically discloses an InDel site for identifying tomato seed color, a KASP marker primer set and an application thereof. The InDel site is located at 501-502 bp of SEQ ID NO: 1, and the polymorphism is TC / T. When the base is TC, the tomato seed color is normal gray-yellow; when the base is T, the tomato seed color is dark brown; using the InDel site, the tomato seed color can be well distinguished; the invention also discloses a KASP molecular marker primer set of the InDel site of the tomato seed color involved, and the KASP molecular marker primer set is used to identify or assist in identification of a tomato breeding population, and a tomato strain with dark brown seeds is obtained, indicating that the molecular marker primer set is effective for molecular marker-assisted selection of tomato seed color. The invention can improve selection efficiency and accelerate breeding process; effectively screen the purity of hybrid seeds, remove seeds that fail to hybridize, and obtain high-purity hybrid seeds.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically discloses an InDel site for identifying tomato seed color, a KASP marker primer set and applications thereof. Background Art

[0002] Tomato is an important vegetable crop in the world, with a global annual total output of 170 million tons, ranking first among vegetable crops. my country is a major producer of fresh and processed tomatoes, and also the world's largest tomato seed market, with a seed market size of more than 1.5 billion yuan. The tomato seed industry is an important factor in the tomato industry. Hybrids have many hybrid advantages such as high yield, high quality and disease resistance. While quickly aggregating excellent genes and traits, they can also effectively protect the intellectual property rights of breeders. Therefore, the current production of tomatoes is mainly based on first-generation hybrids.

[0003] Tomato hybrid seed production: seeds of ordinary tomatoes and seeds produced by hybrid seed production are mostly gray-yellow. Tomato hybrid seed production is mainly carried out through artificial emasculation and artificial pollination. The production of tomato hybrids is a labor-intensive industry with a long production cycle and high production costs. If the purity of the produced seeds does not meet the standards or requirements, they can only be scrapped or destroyed, causing great losses to seed producers and seriously dampening the enthusiasm for hybrid seed production. In the current situation of labor shortage, especially the serious shortage of skilled workers in tomato hybrid seed production, it is not conducive to the sustainable development of tomato hybrid seed production; at the same time, due to the annual increase in the cost of tomato hybrid seed production, the situation of insufficient seed purity has also brought great adverse effects on the promotion of varieties in seed breeding units, and even affected the promotion and improvement of new tomato seed sources.

[0004] Methods for identifying the purity of tomato hybrid seeds: The main methods for identifying the purity of tomato hybrids after production include phenotypic marker identification and molecular marker identification. Among them, the phenotypic identification method mainly uses iconic phenotypes such as green stems of seedlings, plant growth characteristics, and fruit color and shape for identification. Molecular marker identification mainly identifies hybrid seeds by screening molecular markers that differ between parents. If the amount of markers is insufficient, the screening of the genetic background of the seeds cannot be guaranteed, and the purity of the hybrid cannot be guaranteed; if the number of markers is large enough, the detection cost and time are increased. The above methods can only identify the purity of the produced seeds, but none of them can select out false hybrids. Seeds that do not meet the purity standards and requirements can only be scrapped, resulting in large economic losses.

[0005] Methods for hybrid seed production and purity identification using pollen xenia effect: There is a phenomenon called xenia in crop hybrid breeding. The so-called xenia phenomenon refers to the phenomenon that after cross pollination, the pollen of the male parent causes the tissues other than the embryo of the hybrid seeds of the female parent to directly express the male parent's traits, or contemporary dominance, the English name is xenia, which can be divided into seed xenia and fruit xenia. Among them, seed xenia is also called endosperm xenia, which refers to the phenomenon that the endosperm (or cotyledon) tissue of the hybrid seed directly expresses the dominant traits of the same tissue of the male parent. Although the hybrid seed grows on the female plant, its embryo and endosperm are the products of the fertilization of the two male nuclei with the egg nucleus and two polar nuclei of the female gamete, and both belong to the tissues of the offspring (F1). Therefore, the dominant endosperm traits of the male parent must be expressed in the hybrid seeds; while the dominant plant traits must be expressed in sequence in the development process from seedlings to mature plants after the hybrid seeds are sown. The phenomenon of intuitive sense is of certain significance in identifying the authenticity of hybrid seeds and utilizing the economic traits that manifest intuitive sense in production.

[0006] Molecular marker-assisted selection technology: With the continuous advancement of molecular marker-assisted selection technology, it has been applied to more and more traits, realizing molecular marker-assisted selection. InDel (insertion-deletion), translated into Chinese as insertion-deletion marker, refers to the insertion or deletion of nucleotide fragments of different sizes in the sequence of the same site in the genome. The length is generally between 1-100bp, and the maximum is usually around 50bp. InDel is widely distributed in the genome. Although InDel variation is generally less than SNP variation, it also reflects the differences between genomes. InDel in the coding region, in particular, can cause a frameshift mutation, leading to changes in the amino acid or even function of the gene. InDel polymorphism molecular markers are markers designed based on the sequences on both sides of the insertion / deletion site for PCR amplification using specific primers. InDel markers have the advantages of high accuracy and good stability, and have been widely used.

[0007] KASP is the abbreviation of competitive allele-specific PCR (Kompetitive Allele Specific PCR), which can accurately determine the biallelicity of SNPs and InDels at specific sites in a wide range of genomic DNA samples. KASP markers are molecular markers developed based on SNP and InDel sites that can be automatically and high-throughput detected. By designing appropriate KASP marker primers and using specific fluorescent primers, the target SNP and InDel sites can be accurately amplified, and genotyping can be performed by scanning fluorescent signals. It does not require time-consuming and labor-intensive electrophoresis, photography, and band reading analysis, and can quickly and efficiently analyze site variations between different individuals.

[0008] In summary: seed purity in the process of tomato hybrid seed production is a key issue to ensure the breeding and promotion of new tomato varieties. There are many methods for testing the purity of tomato hybrid seeds, but none of them can improve the purity of seeds with unqualified purity. Therefore, it is urgent to develop a method that can select false hybrids without damaging the seeds, thereby improving seed purity, and to achieve the purpose of mechanized sorting of true hybrids and false hybrids when producing tomato hybrids. The inventor used the located mutation site of dark brown tomato seeds to develop a KASP molecular marker linked to dark brown seeds. Summary of the invention

[0009] In view of the above problems, the present invention discloses an InDel site for identifying tomato seed color, a KASP marker primer set and applications thereof, aiming to solve some of the problems in the prior art or at least alleviate some of the problems in the prior art.

[0010] In order to achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0011] An InDel site for identifying tomato seed color, characterized in that the InDel site is located at 501-502 bp of SEQ ID NO: 1, and the polymorphism is TC / T.

[0012] Furthermore, for the above-mentioned InDel site for identifying the color of tomato seeds, when the base of the InDel site is TC, the color of the tomato seeds is grayish yellow; when the base is T, the color of the tomato seeds is dark brown.

[0013] The present invention also discloses a set of KASP molecular marker primers targeting the above InDel site; including an F1 primer as shown in SEQ ID NO: 2, an F2 primer as shown in SEQ ID NO: 3, and a C primer as shown in SEQ ID NO: 4.

[0014] Furthermore, in the above KASP molecular marker primer set, the 5' end of the F1 primer carries a fluorescent modification group FAM, and the 5' end of the F2 primer carries a fluorescent modification group HEX.

[0015] The present invention also discloses the above-mentioned InDel site or KASP molecular marker primer set, which is used in any one of the following (1) to (5):

[0016] (1) Rapid identification or auxiliary identification of tomato seed color;

[0017] (2) Tomato breeding;

[0018] (3) preparing and identifying or assisting in identifying a single plant whose tomato seeds are dark brown in color;

[0019] (4) Tomato hybrid seed production;

[0020] (5) Identification and improvement of seed purity in tomato hybrid seed production.

[0021] Furthermore, in the above application, the seeds of the tomato dark brown seed strain are dark brown after self-pollination, while the seeds of the dark brown seed strain as the female parent after hybridization with the normal wild-type gray-yellow seed strain are gray-yellow, which is a contemporary dominant characteristic.

[0022] Furthermore, in the above application, tomatoes with dark brown seeds can be used for identification of hybrid purity, screening out false hybrids and improving the purity of hybrids after seed hybridization.

[0023] Furthermore, in the above application, the application includes the following steps:

[0024] a. Extraction of tomato genomic DNA samples;

[0025] b. PCR amplification of tomato genomic DNA using primers shown in SEQ ID No: 2-4 to obtain an amplified product:

[0026] c. Use an ELISA reader to read the fluorescence signal, and then use software to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype results based on the different colors to predict the tomato seed color.

[0027] Furthermore, in the above application, in step c, brown seeds show green fluorescence signals, homozygous gray-yellow seeds show blue fluorescence signals, and heterozygous gray-yellow seeds show red fluorescence signals.

[0028] The present invention has the following beneficial effects:

[0029] 1. The present invention reveals the pollen xenia effect and contemporary dominant characteristics of dark brown tomato seeds, providing a material basis for purity identification, purity screening and improvement of tomato hybrid seeds.

[0030] 2. The present invention screens out an InDel site linked to dark brown tomato seeds, and discloses a KASP marker primer set. The tomato breeding population is subjected to auxiliary selection to obtain a tomato line with dark brown seeds, which indicates that the molecular markers of the present invention are effective in molecular marker-assisted selection of tomato seed color traits. The use of the present invention for molecular marker-assisted selection can improve selection efficiency and accelerate the breeding process.

[0031] 3. This method can be used to identify whether tomato seeds have dark brown color traits. There is no need to wait for the fruit to mature. The sample can be identified through simple DNA extraction, PCR specific amplification, and KASP genotyping detection. This method does not require restriction endonuclease digestion, and the marker has strong specificity and high stability. The marker screening method is simple and fast to operate, has the advantages of small amount of test reagents, fast speed, low cost, suitable for large batches, high throughput, and automation, and is very suitable for the realization of modern agricultural molecular breeding.

[0032] 4. The dark brown seed tomato strain identified by this method can be used for the identification and improvement of seed purity in tomato hybrid seed production. The dark brown seed tomato strain is used as the female parent and is hybridized with the ordinary gray-yellow seed tomato strain. The hybrid produced after pollination is gray-yellow, while the tomato seeds that cannot be pollinated are dark brown. The dark brown seeds that cannot be pollinated can be selected by manual selection or seed color sorter, thereby improving the purity of the produced seeds. In particular, for the seeds produced that do not meet the purity standards, the use of the present invention can greatly reduce the losses of seed producers and can effectively ensure the seed production yield and seed purity of tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 .The color of wild-type and mutant tomato seeds: A is wild-type (gray-yellow) seeds; B is mutant (dark brown) seeds;

[0034] Figure 2 .Seed coats of wild-type and mutant tomato seeds: A is the seed coat of wild-type (grayish yellow); B is the seed coat of mutant (dark brown);

[0035] Figure 3 .BSA analysis and linkage analysis of dark brown seeds in F2 population: ΔInDel index between dark brown seeds and grayish yellow seeds in F2 population of bs-1×H1706, the purple curve line indicates the confidence level of 95%;

[0036] Figure 4 . Schematic diagram of fluorescent labeling: A is connected to FAM; C is connected to HEX; #1 is connected to the blue fluorescent group; #2 is connected to the green fluorescent group; #3#4#5 primers are 3 sequences (F1 primer, F2 primer and C primer) respectively;

[0037] Figure 5 .KASP typing diagram: The scatter plots on the X-axis and Y-axis represent the marker identification of dark brown seeds and gray-yellow seeds; the blue dots, green dots and red dots represent wild-type homozygotes, mutant homozygotes and heterozygotes, respectively. DETAILED DESCRIPTION

[0038] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] The reagents or instruments used in the examples of the present invention without indicating the manufacturer are all conventional reagent products that can be obtained through commercial purchase.

[0040] Examples 1 and 2 of the present invention share data with another application (a SNP site for identifying tomato seed color, a KASP marker primer set and its application) filed on the same day, and are studies conducted using the same batch of original materials, which is hereby explained.

[0041] The sequence used in the present invention is as follows:

[0042] Specific nucleotide sequences of dark brown seed trait in tomato

[0043]

[0044]

[0045] Note: The corresponding site of SEQ ID No: 1 in the sequence table of the present invention is selected as TC.

[0046] Molecular marker F1 primers for dark brown seed color trait in tomato

[0047] SEQ ID NO: 2=

[0048] GAAGGTGACCAAGTTCATGCTTGTCAAAACCATTCTTATTTTCCC

[0049] Molecular marker F2 primers for dark brown seed color trait in tomato

[0050] SEQ ID NO:3=

[0051] GAAGGTCGGAGTCAACGGATTTGTCAAAACCATTCTTATTTTCCG

[0052] Molecular marker C primers for the dark brown seed color trait of tomato

[0053] SEQ ID NO:4=

[0054] TGTAATAGGGCTGAGGTTGCAC.

[0055] Example 1

[0056] Obtaining tomato gray-brown seeds and their strains.

[0057] Ordinary tomato seeds are generally grayish yellow, while the colors of wild tomato seeds can be divided into different colors such as yellow, brown and dark brown depending on the species. The present invention uses the hybridization of cultivated tomatoes and wild tomatoes (dark brown seeds) to separate the offspring and obtain a strain with dark brown seeds. During the genetic breeding process, it was found that the seeds obtained after self-pollination of this strain were dark brown; after pollinating the dark brown strain with the pollen of ordinary cultivated tomatoes, the obtained seeds showed the same grayish yellow color as ordinary tomatoes, showing the pollen xenia effect of tomato seed color. Based on this, we have invented a method for quickly identifying the purity of tomato seeds and screening pure hybrid seeds using the pollen xenia effect of dark brown tomato seeds. Figure 1 The color of wild-type and mutant tomato seeds. Figure 2 These are the seed coats of wild-type and mutant tomato seeds.

[0058] In the present application, the inventors used the common cultivated tomato S. lycopersicum 07-1060 as the female parent and the wild Pennell tomato S. habrochaites PI134417 as the male parent for hybridization, and then backcrossed and selfed for multiple generations (which is a conventional method) to obtain the strain bs-1 (Brown seeds) with dark brown seeds.

[0059] Example 2

[0060] Genetic analysis of tomato gray-brown seed lines.

[0061] In order to clarify the genetic characteristics of dark brown seed tomato strains and better apply them in genetic improvement, the inventors constructed a six-generation genetic population using bs-1 and common cultivated tomato S. lycopersicum H1706. The results are shown in Table 1.

[0062] Table 1 Six-generation genetic analysis of dark brown tomato seeds

[0063]

[0064] From the above results, it can be found that the seeds of P1 (bs-1) are dark brown, the seeds of P2 (H1706) are grayish yellow, and the seeds of F1 (bs-1×H1706) are all grayish yellow, indicating that the dark brown seeds are controlled by a recessive gene; after self-pollination of F1, a total of 650 seeds of the F2 segregation population were obtained, of which 502 were grayish yellow seeds and 148 were dark brown seeds, with a segregation ratio of 3.392:1, which is close to the segregation ratio of 3:1, indicating that the dark brown seeds are inherited by a recessive single gene; after hybridization of the F1 generation with P1 (bs-1), a total of 436 seeds were obtained, of which 229 were grayish yellow seeds and 207 were dark brown seeds, with a segregation ratio close to 1:1; after hybridization of the F1 generation with P2 (H1706), a total of 520 seeds were obtained, all of which were grayish yellow, further indicating that the dark brown seeds are inherited by a recessive single gene controlled by the cell nucleus.

[0065] The results of genetic analysis confirmed that the dark brown seeds are a recessive single gene inheritance controlled by the cell nucleus. This trait can be used for genetic transformation and then applied to breeding and hybrid production.

[0066] Example 3

[0067] Positioning of gray-brown tomato seeds.

[0068] In the present application, the inventors used the gray-brown seed strain bs-1 as the female parent and H1706 as the male parent for hybridization to obtain F1 fruit samples and seeds, and then allowed the F1 plants to self-pollinate and harvest F2 generation seeds (a conventional method). Subsequently, the F2 seeds were color-identified, and the F2 population was sown. 27 individual samples of dark brown seeds and 67 individual samples of gray-yellow seeds were selected. Equal amounts of leaves were taken from each pool to construct a mixed pool. Genomic DNA was extracted from fresh tomato leaves using the conventional CTAB method (Roger and Bendich, 1988) and sequenced. The sequencing depth of each pool was 30×.

[0069] The genomic DNA in the sample was extracted, and the library was constructed after the electrophoresis test was qualified. The qualified DNA samples were randomly sheared into 350bp-500bp fragments by Covaris, and the library was constructed using the TruSeq DNALT Sample Prep kit. The DNA fragments were repaired at the end, ployA tailed, sequencing adapter added, purified, PCR amplified, and other steps to complete the library construction. After the library construction was qualified, double-end sequencing was performed using a sequencer.

[0070] In order to eliminate the influence of sequencing errors on the results, it is necessary to perform quality control on the original sequencing data to obtain clean reads. Clean reads were aligned to the reference genome (reference genome version: SL4.0) using BWA. After the alignment results were converted to the format by SAMtools, redundancy was removed by Picard, and the alignment results were analyzed by Qualimap software.

[0071] Based on the comparison results between the sample and the reference genome, the Haplotypecaller module of GATK4 software was used to perform SNP and InDel detection. Annovar software was used to annotate the SNP and InDel detection results.

[0072] During the construction of the segregation population, the offspring will be selected according to the phenotype, and the mutant offspring pool and the wild-type offspring pool will be screened. According to the law of genetic linkage exchange, the genotype of the offspring pool will co-segregate with the phenotype, which will be reflected at the physical map level. The chromosome segments linked to the phenotype will produce stable InDel-index differences with the unlinked chromosome intervals. The offspring InDel determines the Reads from the mutant parent based on the genotype of the parents, and calculates the InDel-index; the InDel index of the dark brown seed pool minus the InDel index of the normal gray-yellow seed pool is obtained to obtain the ΔInDel index.

[0073] The significant peak of ΔInDel index indicates that there is a gene regulating dark brown seed formation at this site or an InDel site linked to dark brown seeds, and there is a site regulating dark brown seed formation on chromosome 1 ( Figure 3 shown).

[0074] Example 4

[0075] Obtaining the InDel locus and KASP marker closely linked to dark brown seeds of tomato.

[0076] Another object of the present invention is to provide an InDel site variation and molecular marker using the dark brown tomato seeds and their positioning intervals. The inventor screened an InDel site with a high InDel index. The InDel site is located at position 64581846 of the first chromosome of tomato, and the corresponding gene is Solyc01g065540, SEQ ID No: 1 501-502bp, the polymorphism is TC / T, and it is developed into a KASP marker. When the base is TC, the color of the tomato seeds is normal gray-yellow; when the base is T, the color of the tomato seeds is dark brown; using the InDel site, the color of tomato seeds can be well distinguished.

[0077] The present invention provides a molecular marker for the dark brown seed color trait of tomato, comprising an F1 primer, an F2 primer and a C primer, wherein the nucleotide sequence of the F1 primer is shown in SEQ ID NO: 2, the nucleotide sequence of the F2 primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the C primer is shown in SEQ ID NO: 4.

[0078] The method for identifying the color trait of tomato seeds by using the above-mentioned specific molecular marker primer pair sequence comprises the following steps: (1) using dark brown seed tomato bs-1 as the female parent, grayish yellow seed tomato H1706 as the male parent and their F1 genomic DNA as the template, designing KASP primers based on the InDel site information, and using the molecular marker to perform PCR amplification on the parents and F1 to obtain the amplified product;

[0079] (2) After amplification, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader. The genotypes of the parents and F1 are determined based on the color of the fluorescence signal, and a genotyping diagram that can simultaneously identify the father, the mother, and their heterozygotes is obtained.

[0080] The sample processing process in step (1) is as follows: take a leaf with a length and width of about 1 cm and put it into a deep well plate (96 wells 1.2 ml); add 100 μL of 0.3M sodium hydroxide, (Shanghai Jingxin tissue grinder) 50Hz grinding for 2 minutes (until the sample is completely ground); after grinding, centrifuge at 3000rpm for 1 minute, and boil in water bath for 2 minutes; then add 200 μL of 0.2M Tris-HCl (pH6.8-7.0) and mix well, and boil in water bath for 2 minutes again; after the water bath is completed, centrifuge at 3000rpm for 1 minute, take the supernatant and dilute it 20 times, freeze it at -20℃, and use it as a template for subsequent PCR amplification.

[0081] The PCR amplification reaction system in step (1) is as follows

[0082]

[0083] PCR amplification reaction conditions are as follows (dual-head 384 PCR instrument ABI GeneAmp 9700)

[0084]

[0085] In each reaction system in step (1), A is connected to FAM (the blue fragment in #3 is the FAM blue fluorescent linker sequence GAAGGTGACCAAGTTCATGCT, #1 is connected to the blue fluorescent group, and its partial sequence can be complementary to u3, so that the base and the fluorescence are combined). When detected, if the homozygous is blue on the typing diagram, the output result is FAM. C is connected to HEX (the green fragment in #4 is the HEX green fluorescent linker sequence GAAGGTCGGAGTCAACGGATT, #2 is connected to the green fluorescent group, and its partial sequence can be complementary to #4, so that the base and the fluorescence are combined). When detected, if the homozygous is green on the typing diagram, the output result is HEX; while the heterozygous signal is red on the typing diagram, the output result is FAMHEX ( Figure 4 ).

[0086] For each InDel site, two fluorescent connectors will be added to the two variant sites respectively. FAM HEX can correspond back to the variant base. The specific correspondence can be viewed in the primer sequence file. The three sequences in the primer sequence (F1 primer, F2 primer and C primer) are the #3#4#5 primers here.

[0087] After the PCR in step (2) is completed, the fluorescence signal is read using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) is used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and output the genotype results according to the different colors. The results show that the maternal parent bs-1 (dark brown seeds) is green, the paternal parent H1706 (gray-yellow seeds) is blue, and the F1 generation is red, which is a heterozygous genotype gray-yellow seeds. The typing diagram is as follows Figure 5 shown.

[0088] Example 5

[0089] Verification of the relative performance of markers tightly linked to dark brown seeds.

[0090] To further verify the accuracy of the marker, seed color identification and KASP marker detection were performed using a maternal dark brown seed tomato material bs-1, a paternal gray-yellow seed material H1706, and 333 F2 segregating strains thereof. After DNA extraction and amplification using the method described in Example 4, the genotype of each individual plant based on each InDel site was determined based on the color of the fluorescent signal.

[0091] Molecular marker analysis was performed on the above materials using the tightly linked KASP molecular markers obtained. The results showed that the fluorescence signals of the bs-1 strain were all green (HEX type), and the fluorescence signals of the H1706 strain were all blue (FAM type); among the 143 strains of the dark brown seed strain, 138 strains had green fluorescence signals (HEX type), 1 strain had blue fluorescence signals (FAM type), and 4 strains had red fluorescence signals (FAMHEX type), and the marker detection accuracy was 96.50%; among the 190 strains of the gray-yellow seed strain, 63 strains had blue fluorescence signals (FAM type), 124 strains had red fluorescence signals (FAMHEX type), 1 strain had green fluorescence signals (HEX type), and 2 strains could not be interpreted, and the marker detection accuracy was 98.42%.

[0092] It can be seen from the above examples that the present invention discloses the pollen xenia effect and contemporary dominant characteristics of dark brown tomato seeds, and provides a material basis for purity identification, purity screening and improvement of tomato hybrid seeds.

[0093] The present invention screens out an InDel site linked to dark brown tomato seeds, and discloses a KASP marker primer set. The tomato breeding population is subjected to auxiliary selection by using the primer set of the present invention to obtain a tomato strain with dark brown seeds, which indicates that the molecular markers of the present invention are effective in molecular marker-assisted selection of tomato seed color traits. The molecular marker-assisted selection using the present invention can improve selection efficiency and accelerate the breeding process.

[0094] This method is used to identify whether tomato seeds have the dark brown color trait. The identification of samples can be completed by simple DNA extraction, PCR specific amplification, and KASP genotyping detection. This method does not require restriction endonuclease digestion, and the marker has strong specificity and high stability. The screening method of the marker is simple and fast to operate, has the advantages of small amount of test reagents, fast speed, low cost, suitable for large batches, high throughput, and automation, and is very suitable for the realization of modern agricultural molecular breeding. The tomato strains with dark brown seeds identified by this method can be used for the identification and improvement of seed purity in tomato hybrid seed production.

[0095] When tomato strains with dark brown seeds are used as female parents and hybridized with tomato strains with ordinary gray-yellow seeds, the hybrids produced after pollination are gray-yellow, while tomato seeds that cannot be pollinated are dark brown. The dark brown seeds that cannot be pollinated can be selected by manual selection or seed color sorting, thereby improving the purity of the produced seeds. In particular, for seeds that do not meet the purity standards, the losses of seed producers can be greatly reduced, and the tomato seed production yield and seed purity can be effectively guaranteed.

[0096] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A set of KASP molecular marker primers, characterized in that: InDel loci for identifying tomato seed color; comprising an F1 primer as shown in SEQ ID NO: 2, an F2 primer as shown in SEQ ID NO: 3, and a C primer as shown in SEQ ID NO: 4; The InDel site is located at 501-502 bp as shown in SEQ ID NO: 1, and the polymorphism is TC / T; When the base at the InDel site is TC, the color of the tomato seeds is grayish yellow; when the base is T, the color of the tomato seeds is dark brown.

2. The KASP molecular marker primer set according to claim 1, characterized in that: The 5' end of the F1 primer carries a fluorescent modification group FAM, and the 5' end of the F2 primer carries a fluorescent modification group HEX.

3. Use of the KASP molecular marker primer set as claimed in claim 1 or 2 in rapid identification or auxiliary identification of tomato seed color.

Images