A primer set, kit and method for detecting tomato brown rugose fruit virus and tobacco mosaic virus
By combining RT-RAA with lateral flow test strips, the complexity and difficulty of detecting ToBRFV and tobacco mosaic virus in the existing technology were solved, and rapid, simple and accurate detection results were achieved in the field.
Patent Information
- Application Number
- CN202310581536.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-23
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2043-05-23
AI Technical Summary
Existing methods for detecting tomato brown wrinkled fruit virus and tobacco mosaic virus require complex laboratory equipment and techniques, making it difficult to quickly and easily distinguish and detect these viruses under field conditions. Existing methods also make it difficult to distinguish ToBRFV from other tobacco mosaic viruses.
Recombinase-mediated isothermal nucleic acid amplification (RT-RAA) technology combined with lateral flow test strips was used to design specific primer sets to detect ToBRFV and tobacco mosaic virus. After RT-RAA amplification, visual detection was achieved on the lateral flow test strips.
It has achieved rapid, simple and accurate differentiation and detection of ToBRFV and tobacco mosaic virus under field conditions, reduced dependence on laboratory equipment and technology, and improved the sensitivity and specificity of detection.
Smart Images

Figure CN117165719B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant virus biological detection, and in particular to a primer set, a kit and a method for detecting tomato brown rugose fruit virus and tobacco mosaic virus based on recombinase-mediated isothermal nucleic acid amplification technology (RT-RAA). Background Art
[0002] Tomato brown rugose fruit virus (ToBRFV) is a new member of the genus Tobamovirus in the family Virgaviridae. It was first discovered in Jordan in 2015 and subsequently reported in Israel in 2017. This non-enveloped, positive-sense, single-stranded RNA virus is primarily transmitted mechanically by humans and tools, but can also be spread by bees, birds, and diseased fruit. ToBRFV has occurred in several countries, including Turkey, the United Kingdom, the United States, and Mexico. Through seed trade and germplasm exchange, its distribution has expanded across Europe, the Americas, and Asia. The virus's primary hosts are tomatoes and peppers. It can disrupt all forms of tobacco mosaic virus resistance in tomatoes, making all currently commercially available tomato varieties susceptible to the virus. The main symptoms of infection in tomatoes are mosaic, dark green protrusions, narrow leaves, yellowing or necrosis of leaf veins, a reduction in the number of flowers and fruits, the appearance of yellow or brown spots on the fruits, smaller fruits, wrinkles, and severe cases of stalk necrosis, posing a significant threat to the production of solanaceous vegetables such as tomatoes and peppers. Like other tobacco mosaic viruses in the same genus, ToBRFV is very stable and easily infective. It can survive for long periods of time in water, on surfaces, and even when separated from its host plant, remaining infectious. This allows the virus to be transmitted through daily operations such as transplanting, pruning, tying, spraying, and harvesting, as well as agricultural materials such as clothing, shoes, equipment, and tools. Currently, countries are taking measures to prevent the spread of ToBRFV. In 2021, Tomato Brown Fruit Virus was added to the "List of Quarantine Pests of Plants Entering the People's Republic of China". Customs and local agricultural and rural departments are closely monitoring the entry inspection and quarantine and epidemic monitoring of the virus's host plants and other regulated items.
[0003] Currently, the main detection methods for ToBRFV include electron microscopy, high-throughput sequencing, and nucleic acid-based molecular biology assays (RT-PCR, RT-qPCR, and PCR-Cas12 enzyme digestion assays, etc.), with RT-PCR being the most commonly used. Because the virus is an RNA virus, current detection methods require nucleic acid extraction and transcription before subsequent amplification and detection.
[0004] Recombinase-mediated isothermal nucleic acid amplification (RT-RAA) is a recently developed nucleic acid amplification technology that can achieve highly specific DNA amplification at a constant low temperature (39°C) and reach detectable levels within minutes. RT-RAA simultaneously performs reverse transcription and amplification in the same amplification tube. The products can be detected by agarose gel electrophoresis or visualized using lateral flow strips (LFS). RT-RAA and LFS offer advantages such as simple operation, low sample volume, rapid detection, and low cost. They have been widely used in various fields, including medicine, food, and the environment. Summary of the Invention
[0005] Problem to be solved
[0006] Currently, there are many molecular biological detection methods for Tomato brown rugose fruit virus (Peppermild mottlevis, ToBRFV) and viruses of the same genus, such as RT-PCR and RT-qPCR, which have become conventional means of detection. However, these means and methods are either highly dependent on well-trained laboratory technicians, or require complex and expensive laboratory instruments, or the detection operation process is cumbersome and difficult to be applied outside the laboratory environment and in field conditions.
[0007] Furthermore, tobacco mosaic virus (TBMV) has a very broad host range, encompassing over 350 plant species across 36 families, including Solanaceae, Amaranthaceae, and Leguminosae. When infected with tobacco mosaic virus (TMV), leaves may exhibit mosaic, wrinkling, or curling symptoms. However, current detection methods mostly target one of these viruses, making it difficult to distinguish ToBRFV from other TMVs. Due to the greater harmfulness of ToBRFV, field control measures can differ significantly depending on whether samples contain ToBRFV or other TMVs. Therefore, a rapid, simple, and accurate dual pathogen detection method is urgently needed. The development of an RT-RAA / RAA dual isothermal nucleic acid amplification system for ToBRFV and TMVs, combined with lateral flow strip detection, would not only meet the urgent needs of customs and local agricultural and rural authorities for virus identification and targeted disease prevention, but also provide new technical support for national agricultural technical services, plant protection, and plant quarantine agencies.
[0008] Technical Solution
[0009] In order to solve the above technical problems, the object of the present invention is to provide a primer set, a kit and a method for detecting ToBRFV and tobacco mosaic virus based on RT-RAA.
[0010] In one aspect of the present invention, the present invention provides an RT-RAA detection primer set for detecting tomato brown rugose fruit virus (ToBRFV) and tobacco mosaic virus, the primer set comprising a tomato brown rugose fruit virus detection primer, a tobacco mosaic virus detection primer, a tomato brown rugose fruit virus detection probe ToBRFV-P, and a tobacco mosaic virus detection probe TVes-P; wherein the tomato brown rugose fruit virus detection primers comprise a forward primer ToBRFV-F and a reverse primer ToBRFV-R, the sequence of the forward primer ToBRFV-F is 5′-AACCAGACAAAAACCAAAGGAAG-3′ (SEQ ID NO. 1), and the sequence of the reverse primer ToBRFV-R is 5′-AAGCAGTAACTAGAGGATCTA-3′ (SEQ ID NO. 2);
[0011] In one aspect of the present invention, the tomato brown rugose fruit virus detection probe ToBRFV-P of the present invention has a sequence of 5′-TCACTAGGTAATCAG-TTCCAAACACAACAAG(THF)TAGAACAACCGTTCA-3′ (SEQ ID NO. 3); the tobacco mosaic virus detection probe TVes-P, the tobacco mosaic virus detection primers include a forward primer TVes-F and a reverse primer TVes-R,
[0012] The sequence of the forward primer TVes-F is: 5′-ACAACTACAATGGCATACACACA-3′ (SEQ ID NO. 4), and the sequence of the reverse primer TVes-R is: 5′-GCAAAATTCCCACCTATATCATATGT-3′ (SEQ ID NO. 5).
[0013] The tobacco mosaic virus detection probe TVes-P has a sequence of 5′
[0014] -TAYCCDGARTTCCARATHACSTTYTAYAAY(THF)CKCARAAYGCYGTRC-3′ (SEQ ID NO.6);
[0015] The 5′ end of the ToBRFV reverse primer ToBRFV-R is modified with FITC, the 5′ end of the detection probe ToBRFV-P is modified with biotin, the 3′ end of ToBRFV-P is phosphorylated, and THF is tetrahydrofuran; the 5′ end of the tobacco mosaic virus reverse primer TVes-R is modified with digoxigenin, the 5′ end of the probe primer TVes-P is modified with rhodamine, the 3′ end of TVes-P is phosphorylated, and THF is tetrahydrofuran.
[0016] In one aspect of the present invention, the present invention provides a kit for detecting tomato brown rugose fruit virus (ToBRFV) and tobacco mosaic virus, the kit comprising the aforementioned primer set.
[0017] In one aspect of the present invention, an RT-RAA detection primer set for detecting tomato brown rugose fruit virus (ToBRFV) and tobacco mosaic virus provided by the present invention can be used to prepare a kit for determining whether a sample to be tested contains ToBRFV and / or tobacco mosaic virus.
[0018] In one aspect of the present invention, the kit of the present invention may further contain other reagents, including RNA extraction reagent, DNA extraction reagent, sample lysis solution, buffer, PCR sample amplification reagent, and kit instructions.
[0019] In one aspect of the present invention, an RT-RAA detection primer set for detecting tomato brown rugose fruit virus (ToBRFV) and tobacco mosaic virus provided by the present invention can be used to determine whether the sample to be detected contains ToBRFV and / or tobacco mosaic virus.
[0020] In one aspect of the present invention, the kit provided by the present invention can be used to detect whether a biological sample to be tested contains ToBRFV and / or tobacco mosaic virus.
[0021] In one aspect of the present invention, the present invention provides a method for detecting ToBRFV and / or tobacco mosaic virus using a kit, comprising the following steps:
[0022] 1) Extracting total RNA from the biological sample to be tested, or performing lysis treatment on the plant sample;
[0023] 2) using the total RNA or plant lysate extracted in step 1) as a template, performing RT-RAA amplification using the forward primer and reverse primer in the primer set to obtain an amplified product;
[0024] 3) Detecting the amplified product, and determining whether the amplified product contains ToBRFV and / or tobacco mosaic virus based on the detection result of the amplified product.
[0025] Preferably, in the present invention, if the amplified product contains a 362bp DNA fragment, the biological sample to be tested contains ToBRFV; if the amplified product does not contain a 362bp DNA fragment, the biological sample to be tested does not contain ToBRFV; if the amplified product contains a 347bp DNA fragment, the biological sample to be tested contains tobacco mosaic virus; if the amplified product does not contain a 347bp DNA fragment, the biological sample to be tested does not contain tobacco mosaic virus.
[0026] In one aspect, the present invention provides a method for detecting whether a biological sample to be tested contains ToBRFV and / or tobacco mosaic virus, comprising:
[0027] Detect whether the lysate or total RNA amplification product of the biological sample to be tested contains a specific DNA fragment. If it contains a specific DNA fragment, the biological sample to be tested contains ToBRFV and / or tobacco mosaic virus. If it does not contain a specific DNA fragment, the biological sample to be tested does not contain ToBRFV and / or tobacco mosaic virus; wherein the specific DNA fragment is the target sequence of the forward primer and the reverse primer described in the present invention.
[0028] In one aspect of the present invention, a method for detecting ToBRFV and / or tobacco mosaic virus based on RT-RAA amplification is provided.
[0029] Preferably, the method comprises the following steps:
[0030] 1) Lyse the plant sample according to the instructions provided with the nucleic acid release reagent; or extract total RNA according to the TRIzol reagent instructions and dissolve it in TE solution or pure water;
[0031] 2) Using the total RNA or plant lysate extracted in step 1) as a template, RT-RAA amplification is performed using the forward primer and reverse primer in the ToBRFV detection primer set. If the amplified product contains a 362bp DNA fragment, the biological sample to be tested contains ToBRFV; if the amplified product does not contain a 362bp DNA fragment, the biological sample to be tested does not contain ToBRFV; RT-RAA amplification is performed using the forward primer and reverse primer in the tobacco mosaic virus detection primer set. If the amplified product contains a 347bp DNA fragment, the biological sample to be tested contains tobacco mosaic virus; if the amplified product does not contain a 347bp DNA fragment, the biological sample to be tested does not contain tobacco mosaic virus.
[0032] The sequence of the forward primer ToBRFV-F is 5′-AACCAGACAAAAACCAAAGGAAG-3′ (SEQ ID NO. 1),
[0033] The sequence of the reverse primer ToBRFV-R is 5′-AAGCAGTAACTAGAGGATCTA-3′ (SEQ ID NO. 2);
[0034] The sequence of the forward primer TVes-F is: 5′-ACAACTACAATGGCATACACACA-3′ (SEQ ID NO. 4), and the sequence of the reverse primer TVes-R is: 5′-GCAAAATTCCCACCTATATCATATGT-3′ (SEQ ID NO. 5).
[0035] Preferably, the reaction system of the RT-RAA amplification is as follows:
[0036] Element Volume (μL) Plant sample lysate or total RNA solution 2 Basal buffer 29.4 ToBRFV-F (5 μM) 1.6 ToBRFV-R (5 μM) 2.4 TVes-F (5 μM) 1.92 TVes-R (5μM) 2.88 <![CDATA[ddH2O]]> The total system is 47.5
[0037] Preferably, the reaction conditions for RAA amplification are set as follows: after the reaction solution is prepared, 2.5 μL of 280 mM MgAc2 is added to each 0.2 mL eppendorf tube and mixed thoroughly; the 0.2 mL eppendorf tube is placed in a PCR instrument with a heated cover function, and kept warm at 39°C for 25 minutes.
[0038] Preferably, the amplified product can be detected by agarose gel electrophoresis. The minimum copy number of the target sequence initial amplification template for the agarose gel electrophoresis detection of ToBRFV RT-RAA amplified product is 10 1 The minimum copy number of the target sequence for the initial amplification template was 10 when the RT-RAA amplification product of tobacco mosaic virus was detected by agarose gel electrophoresis. 1 copies.
[0039] The detection process for RT-RAA amplification products is as follows: After the RT-RAA reaction is completed, remove the reaction tubes. Add 100 μL of phenol / chloroform (1:1) to each reaction tube, vortex thoroughly, and centrifuge at 12,000 rpm for 10 minutes (a vortex mixer can be used for vigorous mixing). Mix 10 μL of the supernatant with 2 μL of 6× Loading Buffer, load the sample onto a 1.5% agarose gel, and electrophorese at 200 V for 15 minutes. Electrophoresis is terminated when bromophenol blue migrates to the lower two-thirds of the gel. Stain with EB for 5 minutes, then observe and photograph under UV light.
[0040] In one aspect, the present invention provides a method for detecting whether a biological sample to be tested contains ToBRFV and / or tobacco mosaic virus.
[0041] Preferably, the method includes: detecting whether the lysate of the biological sample to be tested or the amplified product of the nucleic acid sample contains a specific DNA fragment; if it contains a specific DNA fragment, the biological sample to be tested contains ToBRFV or other tobacco mosaic virus viruses; if it does not contain a specific DNA fragment, the biological sample to be tested does not contain ToBRFV or other tobacco mosaic virus viruses; wherein, the specific DNA fragment is the target sequence of the primer set described in the present invention in the total DNA of the biological sample to be tested.
[0042] In one aspect of the present invention, a method for detecting ToBRFV and / or tobacco mosaic virus based on RT-RAA-lateral flow chromatography technology is provided.
[0043] Preferably, the method comprises the following steps:
[0044] 1) Lyse the plant sample according to the instructions provided with the nucleic acid release reagent; or extract total RNA according to the TRIzol reagent instructions and dissolve it in TE solution or pure water;
[0045] 2) performing RT-RAA amplification using the plant lysate or extracted total RNA obtained in step 1) as a template and a primer set;
[0046] The sequence of the forward primer ToBRFV-F is 5′-AACCAGACAAAAACCAAAGGAAG-3′ (SEQ ID NO. 1),
[0047] The sequence of the reverse primer ToBRFV-R is 5′-AAGCAGTAACTAGAGGATCTA-3′ (SEQ ID NO. 2);
[0048] The tomato brown wrinkled fruit virus detection probe ToBRFV-P has the sequence 5′-GCACTTCTCGGAGCCTTTGATACTAGG(THF)ACAGGATAATAGAAGTT-3′ (SEQ ID NO.3). The sequence of the forward primer TVes-F is: 5′-ACAACTACAATGGCATACACACA-3′ (SEQ ID NO.4), and the sequence of the reverse primer TVes-R is: 5′-GCAAAATTCCCACCTATATCATATGT-3′ (SEQ ID NO.5).
[0049] Tobacco mosaic virus detection probe TVes-P,
[0050] Its sequence is 5′-TAYCCDGARTTCCARATHACSTTYTAYAAY(THF)CKCARAAYGCYGTRC-3′ (SEQ ID NO. 6);
[0051] Preferably, the reaction system of the RT-RAA amplification is as follows:
[0052] Element Volume (μL) Plant sample lysate or total RNA solution 2 Basal buffer 29.4 ToBRFV-F (5 μM) 1.6 ToBRFV-R (5 μM) 2.4 ToBRFV-P (1 μM) 2.1 TVes-F (5 μM) 1.92 TVes-R (5μM) 2.88 TVes-P (1 μM) 5.2 <![CDATA[ddH2O]]> upto47.5
[0053] Preferably, the reaction conditions for RAA amplification are set as follows: after the reaction solution is prepared, 2.5 μL of 280 mM MgAc2 is added to each 0.2 mL eppendorf tube and mixed thoroughly; the 0.2 mL eppendorf tube is placed in a PCR instrument with a heated cover function, and kept warm at 39°C for 16 minutes.
[0054] 3) Use lateral flow chromatography test strips to detect the amplified products. If only one band appears in the quality control area of the test strip and no band appears in the test area, the result is negative, indicating that the sample does not contain ToBRFV or tobacco mosaic virus; if two bands appear on the test strip, one in the quality control area and one in the test area T1, the result is positive, indicating that the sample contains other tobacco mosaic virus viruses other than ToBRFV; if three bands appear on the test strip, one in the quality control area, one in the test area T1, and one in the test area T2, the result is positive, indicating that the sample contains ToBRFV and tobacco mosaic virus viruses including ToBRFV; if the quality control line of the test strip does not show color, the test is invalid and the test strip needs to be replaced and retested.
[0055] The specific testing process can be as follows: Open the cap of an Eppendorf tube containing 50 μL of RT-RAA amplification product, transfer 2.5 μL of the amplification product to a new 1.5 mL Eppendorf tube, and dilute 20-fold. Insert the conjugated pad end of a new nucleic acid lateral flow test strip directly into the Eppendorf tube containing the diluted product. The liquid level must not exceed the upper immersion mark of the sample pad. After the interpretation area is completely soaked, lay the test strip flat for 1 minute. Observe the color development result and record it within 10 minutes. At least one quality control line should appear for each test sample, with or without a test line. If only one band appears in the quality control area of the test strip and no band appears in the test area, the result is negative, indicating that the sample does not contain ToBRFV or other tobacco mosaic virus viruses; if two bands appear on the test strip, one in the quality control area and one in the test area T1, the result is positive, indicating that the sample contains other tobacco mosaic virus viruses other than ToBRFV; if three bands appear on the test strip, one in the quality control area, one in the test area T1, and one in the test area T2, the result is positive, indicating that the sample contains ToBRFV and tobacco mosaic virus viruses including ToBRFV; if the quality control line of the test strip does not show color, the test is invalid and the test strip needs to be replaced and retested.
[0056] Among them, the RT-RAA-lateral flow chromatography technology can detect a minimum copy number of 21 copies of the ToBRFV initial amplification template and a minimum copy number of 44 copies of the tobacco mosaic virus target sequence initial amplification template in each 50 μL reaction system.
[0057] Beneficial effects
[0058] The present invention provides a specific primer set for detecting ToBRFV and tobacco mosaic virus, and establishes a dual rapid detection method for ToBRFV and tobacco mosaic virus. The primers designed in this invention can effectively amplify the target gene, have high specificity and sensitivity, and do not cross-react with other viruses. They can be used for rapid on-site detection of ToBRFV and tobacco mosaic virus, which is of great significance for the effective prevention and control of diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0059] Figure 1 These are the results of ToBRFV RTRAA using amplification primer sets 1 to 4 for different viruses;
[0060] Figure 2 These are the results of RTRAA of universal detection primers for tobacco mosaic virus genus using primer sets 5 to 8 for different viruses;
[0061] Figure 3 Comparison of the amplification products of Tobacco mosaic virus replicase gene primer set 5 in ToBRFV, TMV, TMMoV, PMMoV and TMGMV;
[0062] Figure 4 The sensitivity of ToBRFV RT-RAA amplification was tested using primer set 1 (ToBRFV-F and ToBRFV-R) and primer set 2 (ToBRFV-F2 and ToBRFV-R2). 10-fold serial dilutions of plasmids transformed with the amplification products of primer set 1 and primer set 2 were used as templates for ToBRFV RT RAA amplification. The sensitivity of primer set 1 and primer set 2 was analyzed. ToBRFV-F and ToBRFV-R RT-RAA amplification could detect as low as 10 1 10 copies of ToBRFV CP gene plasmid. 10 copies of ToBRFV-F2 and ToBRFV-R2 RT-RAA amplification can be detected 3 10 copies of the ToBRFV CP gene plasmid. 50 μL RT RAA amplified the initial template copy number from 10 6 Copy to 10 0 The copies are in descending order; among them, M: Plus DNA marker; “-”: negative control in which the same volume of plasmid was replaced by ddH2O;
[0063] Figure 5 In the experiment, the amplification products of primer set 5, tobacco mosaic virus amplification primers (TVes-F and TVes-R), were used to transform the plasmid into 10-fold serial dilutions as RT RAA templates. The detection sensitivity of primer set 5 was analyzed. TVes-F and TVes-R could detect 10 1 10 copies of ToBRFV and TMGMV tobacco mosaic virus replicase genes can be detected 2 The number of replicase genes of TMV, TMMoV and PMMoV tobacco mosaic virus was 10 copies. 6 Copy to 10 0 The copies are in descending order; among them, M: Plus DNA marker; “-”: negative control in which the same volume of plasmid was replaced by ddH2O;
[0064] Figure 6 Schematic diagram of the structure and test results of the single-target disposable nucleic acid test strip (JY0201);
[0065] Figure 7 ToBRFV primer set A, primer set B, primer set C, primer set D were used for 10 6 The positive plasmid and negative control were amplified with ToBRFV RT-RAA and the product test strips were tested.
[0066] Figure 8 The results are from RT-RAA amplification of tobacco mosaic virus using primer set E, primer set F, primer set G, and primer set H on positive plasmids and negative controls, and the test strips of the products.
[0067] Figure 9 Sensitivity test of ToBRFV primer set A and primer set C RT RAA-LFS;
[0068] Figure 10 Sensitivity detection of the tobacco mosaic virus primer set E RTRAA-LFS;
[0069] Figure 11 Effect of the amount of downstream primer added in ToBRFV primer set A on the sensitivity of RT RAA-LFS;
[0070] Figure 12 Effect of the amount of magnesium acetate added in ToBRFV primer set A on the sensitivity of RT RAA-LFS;
[0071] Figure 13The optimized RTRAA amplification system was used to detect the sensitivity of the tobacco mosaic virus primer set E RT RAA-LFS;
[0072] Figure 14 Evaluation of the specificity of ToBRFV primer set A and tobacco mosaic virus primer set E RT RAA-LFS primers;
[0073] Figure 15 Schematic diagram of the dual-target disposable nucleic acid test strip (JY0209) structure and test results;
[0074] Figure 16 Determination of the amount of ToBRFV primer set A and tobacco mosaic virus primer set E2 added in the dual RT-RAA-LFS detection system;
[0075] Figure 17 ToBRFV primer set AqPCR absolute quantitative melting curve analysis;
[0076] Figure 18 Tobacco mosaic virus primer set E qPCR absolute quantitative melting curve analysis;
[0077] Figure 19 AqPCR absolute quantitative amplification curve analysis of ToBRFV primer set;
[0078] Figure 20 Analysis of absolute quantitative amplification curves of qPCR primer set E for tobacco mosaic virus;
[0079] Figure 21 The detection sensitivity of dual RTRAA-LFS of ToBRFV primer set A and tobacco mosaic virus primer set E2;
[0080] Figure 22 Optimization of the amount of primers added to ToBRFV primer set A and tobacco mosaic virus primer set E2;
[0081] Figure 23 The detection sensitivity of dual RTRAA-LFS after optimizing the addition amount of ToBRFV primer set A and tobacco mosaic virus primer set E2;
[0082] Figure 24 Dual RT RAA-LFS assay of supernatants of tobacco leaf lysates infected with ToBRFV and tobacco mosaic virus;
[0083] Figure 25 Pepper plants were randomly sampled in the field for RT RAA-LFS rapid detection of ToBRFV and tobacco mosaic virus. DETAILED DESCRIPTION
[0084] The following is a detailed description of the specific embodiments of the present invention with reference to the accompanying drawings.
[0085] The experimental methods in the following examples are all conventional unless otherwise specified. The experimental materials described in the following examples were not purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative experiments in the following examples were all repeated three times, and the results were averaged.
[0086] The virus samples involved in this invention come from:
[0087] The virus samples, tobacco mosaic virus isolates and their corresponding total RNA or cDNA involved in the present invention are all stored in the Virus-Host Interaction Laboratory of the Institute of Plant Virology, Ningbo University.
[0088] Among them, pepper plant samples infected with ToBRFV were collected in Yuanmou County, Yunnan Province in 2022. The leaves showed mosaic and fern leaves, and the fruits showed yellow spots, deformities, browning, and necrosis. After collection, the samples were quickly frozen in liquid nitrogen and stored at -70°C. Among them, in the experiments of screening ToBRFV RT-RAA-specific primers and universal amplification primers for tobacco mosaic virus, plant samples infected with Tomato brown rugose fruit virus (ToBRFV), Tomato mosaic virus (TMV), Tomato mottle mosaic virus (ToMMV), pepper mild mottle virus (PMMoV) and tobacco mild green mosaic virus (TMGMV) of the tobacco mosaic virus genus, and broadbean will virus2 (BBWV2) of the fabavirus genus, pepper vein yellows virus (PeVYV) of the potato leafroll virus genus, and pepper vein mottle virus (ChiVMV) of the potato Y virus genus were used as experimental objects. Total plant RNA was extracted as amplification template, and healthy pepper plant leaves were used as negative controls.
[0089] The sample preparation method involved in the present invention is:
[0090] TRIzol reagent (Thermo Fisher Scientific) was used to extract plant total RNA containing viral nucleic acids from ToBRFV plant samples, laboratory-stored tobacco mosaic virus (TMV), tomato mottle mosaic virus (ToMMV), pepper mild mottle virus (PMMoV) and tobacco mild green mosaic virus (TMGMV), as well as bean wilt virus 2 (BBWV2) of the Favavirus genus, pepper vein yellow virus (PeVYV) of the Potatovirus genus, and pepper vein mottle virus (ChiVMV) of the Potyvirus genus, according to the instructions of the TRIzol reagent. The nucleic acid lateral flow test strips were sourced from Beijing Baoying Tonghui Biotechnology Co., Ltd.
[0091] In order to evaluate whether the RT-RAA-LFS system used can be used for the rapid detection of plants infected with ToBRFV and tobacco mosaic virus, samples of plants infected with ToBRFV collected from Yuanmou County, Yunnan Province, and samples of tobacco mosaic virus (TMV), tomato mottle mosaic virus (ToMMV), pepper mild mottle virus (PMMoV) and tobacco mild green mosaic virus (TMGMV) stored in the laboratory, as well as bean wilt virus 2 (BBWV2) of the genus Favavirus, pepper vein yellow virus (PeVYV) of the genus Potatovirus, and pepper vein mottle virus (ChiVMV) of the genus Potyvirus were used as experimental subjects. Total RNA of plants was extracted as amplification template, and healthy pepper plant leaves were used as negative controls. Fresh pepper leaf samples were placed in 100 μL Gently triturate a 1.5 mL eppendorf tube containing CoolSniff Nucleic Acid Release (Tiosbio, Beijing Baoying Tonghui Biotechnology Co., Ltd.) with a pipette tip to obtain the corresponding plant sample lysate. Use 2 μL of the plant sample lysate or its dilution as the template for RT-RAA amplification. The plant sample lysate can be used immediately or stored at -70°C for at least 3 months.
[0092] Experimental Example 1: Primer Design and Screening for ToBRFV and Tobacco Mosaic Virus Detection
[0093] After extensive sequence analysis, the present research team identified the ToBRFV coat protein (CP) gene and the 183 kDa replicase gene of the tobacco mosaic virus as target genes. After analyzing the sequence characteristics of the target genes, they used Primer Premier 5.0 software to design species-specific amplification primers. Primer design followed the following principles.
[0094] ① The length of the amplification primer is approximately 20 to 30 bp, and the annealing temperatures of different primers should be as consistent or similar as possible; ② The length of the amplification product is approximately 200 to 500 bp and is species-specific.
[0095] The primer amplification region sequences were aligned using the BLAST function of the National Center for Biotechnology Information (NCBI) to perform preliminary identification of primer amplification specificity. The primers that passed the identification were synthesized by General Biosystems (Anhui) Co., Ltd. to HPLC purity. The specific primer sequences are shown in Table 1.
[0096] Table 1 Primers for basic RT-RAA amplification of TOBRFV and tobacco mosaic virus
[0097]
[0098] use The RT RAA Nucleic Acid Amplification Kit (basic version JY0203) uses total RNA from healthy pepper plants or leaf lysates from pepper plants infected with ToBRFV or tobacco mosaic virus as templates. RT-RAA amplification is performed using forward and reverse primers from groups 1 to 2 and 5 to 8, respectively. The amplification system (single sample / reaction) is as follows:
[0099] Element Volume (μL) Plant sample lysate or total RNA solution 2 Basal buffer 29.4 Forward primer (10 μM) 2.1 Reverse primer (10 μM) 2.1 <![CDATA[ddH2O]]> The total system is 47.5
[0100] After the reaction solution is prepared, add 2.5 μL of 280 mM MgAc2 to each 0.2 mL eppendorf tube and mix thoroughly; place the 0.2 mL eppendorf tube in a PCR instrument with a heated cover function and keep it at 39°C for 30 minutes.
[0101] After the RT-RAA reaction is complete, remove the reaction tubes. Add 100 μL of phenol / chloroform (1:1) to each tube, vortex thoroughly, and centrifuge at 12,000 rpm for 10 minutes (you can use a vortex shaker to vigorously mix at this step). Mix 10 μL of the supernatant with 2 μL of 6× Loading Buffer, load the sample onto a 1.5% agarose gel, and run electrophoresis at 200 V for 15 minutes. End the electrophoresis when bromophenol blue has migrated to the lower two-thirds of the gel. Stain with EB for 5 minutes, and observe and photograph under UV light.
[0102] like Figure 1As shown in the figure, under the premise of adding 2 μL of plant total RNA solution or sample lysate, ToBRFV amplification primer set 1 (ToBRFV-F and ToBRFV-R) and ToBRFV amplification primer set 2 (ToBRFV-F2 and ToBRFV-R2) were used to perform RT-RAA amplification in the total RNA of plants infected with different viruses, among which the electrophoresis bands of the amplification products of ToBRFV amplification primer set 1 and ToBRFV amplification primer set 2 in the total RNA of plants containing ToBRFV virus materials were clear and bright. The amplified band size was consistent with expectations, while no obvious amplification products were observed in plants infected with other viruses. The electrophoretic bands of the amplified products of ToBRFV amplification primer set 3 (ToBRFV-F3 and ToBRFV-R3) and ToBRFV amplification primer set 4 (ToBRFV-F4 and ToBRFV-R4) in total RNA from plants containing ToBRFV virus material were ladder-like, and obvious amplification products were also obtained in total RNA from plants infected with other viruses. Therefore, these primers cannot be used as dedicated primers for ToBRFV detection. The product amplified by primer set 1 in RNA samples infected with Tomato Brown Rough Fruit Virus (ToBRFV) was cloned, sequenced, and aligned, indicating the target sequence.
[0103] Primer sets 5 to 8 were used to amplify the 183 kDa replicase gene of the tobacco mosaic virus genus. Primer set 5 produced clear, bright electrophoretic bands with no spurious bands in total RNA from plants harboring the tobacco mosaic virus (ToBRFV), tobacco mosaic virus (TMV), tomato mottle mosaic virus (ToMMV), pepper mild mottle virus (PMMoV), and tobacco mild green mosaic virus (TMGMV). The amplified product was consistent with the expected size. However, no amplified product bands were produced in total RNA from plants harboring the fabavirus (BBWV2), the potato leafroll virus (PeVYV), and the potato leaf vein mottle virus (ChiVMV). Primer sets 6, 7, and 8 failed to achieve the same amplification efficiency as primer set 5, confirming that primer set 5 (TVes-F and TVes-R) is suitable for detecting tobacco mosaic viruses. The products amplified by primer set 5 in RNA samples carrying tomato brown rugose fruit virus ToBRFV, tobacco mosaic virus TMV, tomato mottle mosaic virus ToMMV, pepper mild mottle virus PMMoV and tobacco mild green mosaic virus TMGMV were cloned, sequenced and aligned, showing that they were all target sequences ( Figure 3 ).
[0104] Experimental Example 2: Preparation and composition of ToBRFV and tobacco mosaic virus test sample comparison plate
[0105] The CP gene amplification products of ToBRFV amplification primer set 1 (ToBRFV-F and ToBRFV-R), ToBRFV amplification primer set 2 (ToBRFV-F2 and ToBRFV-R2) and the amplification products of Tomato brown rugose fruit virus ToBRFV, Tobacco mosaic virus TMV, Tomato mottle mosaic virus ToMMV, Pepper mild mottle virus PMMoV and Tobacco mild green mosaic virus TMGMV, and the amplification products of Tobacco mosaic virus 183kDa replicase amplification primer set 5 (TVes-F and TVes-R) were cloned and sequenced correctly. The plasmids were transformed and shaken overnight, and then the plasmids were extracted. The OD260, OD280 and OD260 / OD280 values of the recombinant plasmids were measured by UV spectrophotometer, and repeated three times to determine the plasmid DNA concentration and purity.
[0106] The copy number of the plasmid was obtained according to the following formula:
[0107] Copy number = plasmid concentration × 6.02 × 10 23 / (660×total length of plasmid)
[0108] Calculate the copy number and dilute to 1 × 10 8 copies / μL, stored at –20℃ for future use. Dilute the recombinant plasmid to 1×10 6 copies / μL, and then serially diluted 10-fold to obtain 1×10 0 copies / μL, 1×10 1 copies / μL, 1×10 2 copies / μL, 1×10 3 copies / μL, 1×10 4 copies / μL, 1×10 5 copies / μL and 1×10 6 The plasmid dilution with the number of copies / μL was used as the template for subsequent amplification.
[0109] Experimental Example 3: Detection of primer sensitivity for ToBRFV and tobacco mosaic virus detection
[0110] To further test the sensitivity of ToBRFV amplification primer set 1 (ToBRFV-F and ToBRFV-R), ToBRFV amplification primer set 2 (ToBRFV-F2 and ToBRFV-R2), and Tobacco mosaic virus amplification primer set 5 (TVes-F and TVes-R), 10-fold serial dilutions (10 μl per μl) of the corresponding amplified plasmid DNA were added to the PCR product. 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 100 ddH2O was used as a negative control template. 1.5% agarose gel electrophoresis was used to compare the amplification of RT-RAA using different primers on the same template.
[0111] The results of the RT-RAA amplification sensitivity test of the ToBRFV amplification primer set are as follows Figure 4 As shown in the experimental results, it can be seen that primer set 1 (ToBRFV-F and ToBRFV-R) RT-RAA amplification can detect as low as 10 1 10 copies of ToBRFV CP gene plasmid; primer set 2 (ToBRFV-F2 and ToBRFV-R2) RT-RAA amplification can detect 3 copies of the ToBRFV CP gene plasmid.
[0112] The results of the sensitivity test of the 5RT-RAA amplification primer set for tobacco mosaic virus are as follows: Figure 5 As shown in the experimental results, it can be seen that primer set 5 (Ves-F and TVes-R) can detect RT-RAA amplification as low as 10 in the comparison plate of ToBRFV and TMGMV. 1 The replicase gene plasmid of the tobacco mosaic virus genus can be detected at a level as low as 10 in the TMV, TMMoV and PMMoV comparison plates. 2 A plasmid containing 1 copy of the replicase gene of the tobacco mosaic virus genus.
[0113] Experimental Example 4: RT-RAA-LFS detection of ToBRFV and tobacco mosaic virus
[0114] For the amplification region of primer sets 1 to 8 in Example 1, species-specific probe sequences were designed using Primer Premier 5.0 software. The probe sequences were located in the middle region of the amplification primers and were modified with tetrahydrofuran. Primer design followed the following principles: 1. The probe length was approximately 30 to 45 bp; 2. The probe sequence was species-specific.
[0115] The primer amplification region sequences were aligned using the BLAST function of the National Center for Biotechnology Information (NCBI) to perform preliminary identification of primer amplification specificity. The primers that passed the identification were synthesized by General Biosystems (Anhui) Co., Ltd. to HPLC purity. The specific primer sequences, probes, and downstream primer labels for the amplification are shown in Table 2.
[0116] Table 2 Primers used for amplification of TOBRFV and tobacco mosaic virus RT-RAA test strips
[0117]
[0118] The upstream and downstream primers of each primer set corresponded to the amplified product 1×10 6 Copies / μL recombinant plasmid solution as template, using The RT RAA Nucleic Acid Amplification Kit (Test Strip Method) (JY0204) was used to prepare the RAA reaction system (single sample / reaction) of Primer Set A to Primer Set H. The system is as follows:
[0119]
[0120]
[0121] The order of adding samples is negative control sample (1×10 6 copies / μL recombinant plasmid solution was replaced with the same volume of ultrapure water), 1×10 6 100 copies / μL of recombinant plasmid solution. Immediately secure the tube cap after adding each sample to avoid aerosol contamination. Mix the above reaction system thoroughly and add the base reaction unit. Dissolve the lyophilized powder thoroughly. Note: Do not use a vortex shaker to mix vigorously during this step. Open the reaction unit and add 2.5 μL of 280 mM MgAc2 to each 0.2 mL eppendorf tube. Mix thoroughly and collect by centrifugation. Note: Do not use a vortex shaker to mix vigorously during this step.
[0122] Place the reaction tube at 39°C for 16 minutes. After the RAA reaction is complete, open the eppendorf tube, pipette the amplified product into a new eppendorf tube, label it, and dilute it 20-50 times.
[0123] The structural diagram of the single-target disposable nucleic acid detection test strip (JY0201) is as follows Figure 6 As shown, insert the liquid-immersion end of the test strip (marked with the blue arrow pointing upward) into the eppendorf tube. The liquid level must not exceed the MAX indicator line in the liquid-immersion area. Wait until the reading area is completely soaked (approximately 30-60 seconds). Lay the test strip flat for 1 minute and wait for the red strip to appear. Read the test result directly based on the color development of the test strip. Observe the result within 10 minutes; any reading after 10 minutes will be invalid.
[0124] like Figure 7As shown, when the ToBRFV primer sets B (ToBRFV-F+ToBRFV-P2+ToBRFV-R) and D (ToBRFV-F2+ToBRFV-P4+ToBRFV-R2) were used for amplification, the negative control RTRAA amplification product was diluted 20 times and the test strip test result was positive, and it could not be used for subsequent RTRAA nucleic acid amplification test strip sensitivity detection; when the primer set A (ToBRFV-F+ToBRFV-P+ToBRFV-R) and primer set C (ToBRFV-F2+ToBRFV-P3+ToBRFV-R2) were used for amplification, the negative control RT RAA amplification product was diluted 20 times and the test strip test result was negative, 1×10 6 The RTRAA test result of the recombinant plasmid solution at 100 copies / μL is positive and can be used for subsequent RT RAA nucleic acid amplification test strip sensitivity detection.
[0125] like Figure 8 As shown, the test strip test result of the negative control RT RAA amplification product of the tobacco mosaic virus primer group F after dilution of 20 times was strongly positive, and the test strip test results of the negative control RT RAA amplification product of primer group G and primer group H after dilution of 20 times were weakly positive, and both cannot be used for subsequent RTRAA nucleic acid amplification test strip sensitivity testing; the test strip test result of the negative control RT RAA amplification product of primer combination E after dilution of 20 times was negative, 1×10 6 The RTRAA test result of the recombinant plasmid solution at 10 copies / μL is positive and can be used for subsequent RTRAA nucleic acid amplification test strip sensitivity detection.
[0126] Experimental Example 5: Comparison of RT-RAA-LFS Detection Sensitivity of Different Primer Sets for ToBRFV and Tobacco Mosaic Virus
[0127] Using the ToBRFV primer set A (ToBRFV-F+ToBRFV-P+ToBRFV-R) and primer set C (ToBRFV-F2+ToBRFV-P3+ToBRFV-R2) as templates, the RTRAA amplification system in Experimental Example 4 was used to complete the 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL and 1×10 0 RT RAA amplification of 100 copies / μL plasmid dilutions was performed, and the amplified products were diluted 20-fold before strip testing to determine the detection sensitivity of different primer combinations.
[0128] The RT RAA-LFS sensitivity test results of ToBRFV primer set A (ToBRFV-F+ToBRFV-P+ToBRFV-R) and primer set C (ToBRFV-F2+ToBRFV-P3+ToBRFV-R2) are as follows Figure 9 As shown in Figure 2, the minimum detection threshold of the ToBRFV primer set ARTRAA-LFS is 10 3 The minimum detection threshold of ToBRFV primer set C RTRAA-LFS is 10 4 copies.
[0129] The sensitivity test results of RT RAA-LFS of the primer set E (TVes-F+TVes-P+TVes-R) for the tobacco mosaic virus genus are as follows: Figure 10 As shown, the minimum detectable value of ToBRFV primer set E RTRAA-LFS is 10 1 copies of ToBRFV, 10 2 copies of TMV, 10 1 copies of TMMoV, 10 2 copies of PMMoV and 10 2 copies of TMGMV, but the minimum detection limit showed a lighter color.
[0130] Example 6: Optimization of RT-RAALFS detection system using ToBRFV primer set A
[0131] The probe used in the experiment has the following characteristics: ① The design direction is forward, that is, the same direction as the upstream primer; ② The length is 46-52 nt; ③ The 3' end is phosphorylated to inhibit DNA chain extension; ④ A cleavage site is added inside the sequence, which is cleaved by the exo enzyme when the probe binds to the template DNA and initiates DNA chain extension; ⑥ The 5' end is biotin-modified, and the double-stranded amplification product of the probe and the downstream (FITC-modified) primer can be detected by the nucleic acid test strip.
[0132] The test strip test product is a double-stranded amplification product of the probe after exo-enzyme cleavage and the downstream primer (modified with FITC). Therefore, theoretically, increasing the amount of downstream primer added can help improve the sensitivity of RAA nucleic acid test strip detection. However, excessive addition of downstream primer can also lead to the formation of downstream primer-probe primer dimers, resulting in false positive test results.
[0133] use The RT RAA nucleic acid amplification kit (test strip method) (JY0204) was used to prepare the RAA reaction system (single sample / reaction), and the amount of downstream primers added was adjusted as shown in Table 3. 2Copies / μL sample plate, 10 1 Copies / μL sample plate, 10 0 Copy / μL sample plate, and test the negative quality control sample. After adding the sample, immediately fasten the tube cap to avoid aerosol contamination. Mix the above reaction system and add the basic reaction unit. Dissolve the lyophilized powder thoroughly. Note that this step should not be vigorous vortexing. Open the reaction unit and add 2.5μL of 280mM MgAc2 to each 0.2mL eppendorf tube. Mix thoroughly and collect by centrifugation. Note that this step should not be vigorous vortexing.
[0134] The reaction tube was placed at 39°C for 16 minutes. After the RAA reaction was completed, the eppendorf tube was opened and the amplified product was transferred to a new eppendorf tube, which was labeled and diluted 20-fold. The optimal addition amount was determined by strip testing.
[0135] Table 3 Adjustment of the amount of downstream primers added in the ART-RAA amplification system of the TOBRFV amplification primer set
[0136]
[0137]
[0138] result Figure 11 Display, with 10 2 Copies / μL sample plate, 10 1 Copies / μL sample plate, 10 0 The negative control sample was used as the template. Under the same template addition volume, the amount of downstream primers was adjusted. When the amount of downstream primers (10 μM) in the 50 μL amplification system was adjusted to 3 μL, the detection sensitivity was the best. Not only could 10 1 copies / μL of the sample, while the negative control sample was negative.
[0139] Adding MgAc2 to the amplification system can initiate RAA amplification, and the amount of MgAc2 added directly affects amplification efficiency and product yield. In theory, increasing the amount of MgAc2 added can help improve amplification product yield and increase the sensitivity of RAA nucleic acid test strips. However, excessive MgAc2 addition can also result in false positive results for negative samples.
[0140] use The RT RAA Nucleic Acid Amplification Kit (Test Strip Method) (JY0204) was used to prepare the RAA reaction system (single sample / reaction). The MgAc2 addition amount was adjusted as follows.
[0141] Table 4 Adjustment of MgAc2 addition amount in TOBRFV amplification primer sets A and C RT-RAA amplification system
[0142]
[0143] Each system is 10 2 Copies / μL sample plate, 10 1 Copies / μL sample plate, 10 0 Copy / μL sample plate, and test the negative quality control sample. After adding the sample, the tube cap must be fastened immediately to avoid aerosol contamination. Mix the above reaction system and add the basic reaction unit. Dissolve the lyophilized powder thoroughly. Note that this step cannot be vigorously shaken on a vortex shaker. Open the reaction unit and add different volumes of 280mM MgAc2 in Table 3 to each 0.2mL eppendorf tube. Mix thoroughly and collect by centrifugation. Note that this step cannot be vigorously shaken on a vortex shaker.
[0144] The reaction tube was placed at 39°C for 16 minutes. After the RAA reaction was completed, the eppendorf tube was opened and the amplified product was transferred to a new eppendorf tube, which was labeled and diluted 20-fold. The optimal addition amount was determined by strip testing.
[0145] Experimental results Figure 12 As shown, 10 2 Copies / μL sample plate, 10 1 Copies / μL sample plate, 10 0 The negative control sample was used as the template. Under the same template addition volume, the amount of MgAc2 was adjusted. When the MgAc2 was adjusted to 2.5μL and 2.8μL, the detection sensitivity was the same. Not only could 10 1 The sample had a low number of copies / μL, while the negative control sample was negative. The results for Adjustment Systems 2 and 3 in Table 3 indicate that excessive addition of MgAc2 can lead to false positives in negative control samples. Given that the detection sensitivity was the same when 2.5 μL and 2.8 μL of MgAc2 were added per 50 μL of amplification system, 2.5 μL was determined to be the optimal addition amount to avoid false positives in negative samples.
[0146] Example 7: Detection sensitivity of the RT RAA-LFS primer set for tobacco mosaic virus
[0147] Use the method described in Example 6 The RT RAA nucleic acid amplification kit (test strip method) (JY0204) amplification system and test strip detection method were used to prepare the RT RAA reaction system of the tobacco mosaic virus primer combination E, and different primer combinations 1×10 2 copies / μL, 1×10 1 copies / μL and 1×10 0 RT RAA amplification of 100 copies / μL plasmid dilution was performed, and the amplified product was diluted 20 times before strip detection.
[0148] The sensitivity test results of RT RAA-LFS of the primer set E (TVes-F+TVes-P+TVes-R) for the tobacco mosaic virus genus are as follows: Figure 10 As shown, the minimum detectable value of ToBRFV primer set E RTRAA-LFS is 10 1 copies of ToBRFV, 10 2 copies of TMV, 10 1 copies of TMMoV, 10 2 copies of PMMoV and 10 1 copies of TMGMV( Figure 13 ).
[0149] Combined with the results of Example 6 and Example 7, it was finally determined that ToBRFV primer set A and tobacco mosaic virus primer set E can be used for primer specificity detection and subsequent dual RT RAA-LFS detection.
[0150] Example 8: Specificity evaluation of primers for detecting ToBRFV and tobacco mosaic virus
[0151] In this example, plants infected with TobRFV, TMV, ToMMV, PMMoV, and TGMMV, BBWV2 of the Favavirus genus, PeVYV of the Potatovirus genus, and ChiVMV of the Potyvirus genus, as verified by RT-PCR, were used as experimental subjects. Total RNA from the plants was extracted as a template for amplification, and healthy pepper plant leaves were used as negative controls. The primers selected in Example 4, the TobRFV primer set A, and the Tobacco mosaic virus primer set E of Example 7 were used, and the primers described in Example 6 were used. The RAA reaction system was prepared using the RT RAA nucleic acid amplification kit (test strip method) (JY0204) amplification system and test strip detection method. RT-RAA amplification was performed on the total RNA carrying the above-mentioned viruses, and RT-RAA amplification of the total RNA of plants with different viruses was completed. The amplified products were diluted 20 times and then tested on test strips to determine the specificity of detection with different primer combinations.
[0152] The specificity evaluation results of ToBRFV primer set A and tobacco mosaic virus primer set E RT RAA-LFS primers are as follows Figure 14 As shown, it can be seen that the LFS test results of the amplified products of ToBRFV primer group A were positive only in the total RNA of ToBRFV-infected plants, and no cross-reaction was found with other viruses, indicating that this primer pair has good specificity and is suitable for RT RAA-LFS detection of ToBRFV; the RT RAA-LFS test results of tobacco mosaic virus primer group E were positive in the total RNA of plants infected with the pathogenic tobacco mosaic virus tested, indicating that this primer is suitable for RT RAA-LFS detection of multiple pathogenic tobacco mosaic virus.
[0153] Experimental Example 9: Establishment of a dual RT-RAA-LFS detection system using different primer sets for ToBRFV and tobacco mosaic virus
[0154] The primers used in Experimental Example 9 were synthesized by Universal Biosystems (Anhui) Co., Ltd. and were HPLC-purified. The specific sequences of the primers, probes, and downstream primer labels for amplification are shown in the following table:
[0155]
[0156] The ToBRFV primer set A and the tobacco mosaic virus primer set E in Example 9 were configured as a mix to facilitate optimization of the primer addition amount in the RT RAA dual amplification system. The components of the primer mix are as follows:
[0157]
[0158] 1×10 of the product amplified by the upstream and downstream primers of each primer set 6 Copies / μL of plasmid dilution was used as template, The RT RAA Nucleic Acid Amplification Kit (Test Strip Method) (JY0204) is used to prepare a dual RT RAA reaction system for ToBRFV and tobacco mosaic virus (single sample / reaction). The system is as follows:
[0159]
[0160] Take 100 μL of the plant leaf samples that were positive for ToBRFV and tobacco mosaic virus by RT-PCR. Cool Flash Nucleic Acid Releaser (BT0068) was used to crush the sample to be tested several times with the tip of the pipette, centrifuged, and the supernatant was collected for testing. RT-RAA amplification was performed separately, and negative quality control samples (1×10 6 The recombinant plasmid solution was replaced with the same volume of ultrapure water (1×10 copies / μL), and the order of addition was negative control sample, 1×106 Copies / μL of the mixed plasmid solution containing Tobacco Mosaic Virus (TMV) and Tobacco Mosaic Virus. Immediately secure the cap after adding each sample to prevent aerosol contamination. Mix the reaction mixture thoroughly and add the base reaction unit. Dissolve the lyophilized powder thoroughly. Note: Do not use a vortex shaker to mix vigorously during this step. Open the reaction unit and add 2.5 μL of 280 mM MgAc2 to each 0.2 mL eppendorf tube. Mix thoroughly and collect by centrifugation. Note: Do not use a vortex shaker to mix vigorously during this step.
[0161] Place the reaction tube at 39°C for 16 minutes. After the RAA reaction is complete, open the eppendorf tube, pipette the amplified product into a new eppendorf tube, label it, and dilute it 20-50 times.
[0162] The schematic diagram of the dual-target disposable nucleic acid detection test strip (JY0209) is as follows Figure 15 As shown, insert the liquid-immersion end of the test strip (marked with the blue arrow pointing upward) into the eppendorf tube. The liquid level must not exceed the MAX indicator line in the liquid-immersion area. Wait until the reading area is completely soaked (approximately 30-60 seconds). Lay the test strip flat for 1 minute and wait for the red strip to appear. Read the test result directly based on the color development of the test strip. Observe the result within 10 minutes; any reading after 10 minutes will be invalid.
[0163] The results of the double RT RAA-LFS test of plasmid and negative control are as follows Figure 16 As shown, the negative control amplification products of primer set A and primer set E2 were negative after a 20-fold dilution. The plasmid amplification products were positive after a 20-fold dilution. These results can be used for subsequent dual RT RAA-LFS testing of leaf lysates. Based on the color intensity of the positive plasmid amplification products, the addition ratio of dual primer set Mix 1 was determined to be the optimal reaction system, and subsequent experiments were completed.
[0164] Experimental Example 10: Drawing of absolute quantitative standard curves for ToBRFV primer set A and tobacco mosaic virus primer set E
[0165] From the qPCR melting curve analysis results, it can be seen that ToBRFV primer group A (ToBRFV-F and ToBRFV-R) ( Figure 17 ), Tobacco mosaic virus primer set E (TVes-F and TVes-R) and ToBRFV ( Figure 18 a)TMV( Figure 18 b)TMMoV( Figure 18 c)PMMoV( Figure 18 d) and TMGMV( Figure 18e) The qPCR melting curve analysis of the amplified products of the corresponding plasmids showed sharp single peaks, indicating that the ToBRFV primer group A (ToBRFV-F and ToBRFV-R) and tobacco mosaic virus primer group E (TVes-F and TVes-R) screened in this example had high amplification specificity.
[0166] ToBRFV primer set A (ToBRFV-F and ToBRFV-R, Figure 19 ) can successfully detect 10 1 ~10 6 The initial template of the copy number spanned a dynamic detection range of 6 log values, and the Ct difference between each template concentration gradient was similar. Tobacco mosaic virus primer set E (TVes-F and TVes-R, Figure 20 a~20e) can successfully detect ToBRFV( Figure 20 a)TMV( Figure 20 b)TMMoV( Figure 20 c)PMMoV( Figure 20 d) and TMGMV( Figure 20 e) 10 of the corresponding plasmid 1 ~10 6 The initial template copies spanned a 6-log dynamic detection range, and the Ct differences between each template concentration gradient were similar.
[0167] ToBRFV primer set A (ToBRFV-F and ToBRFV-R) Ct values and log-transformed copy numbers (y = -6.2146x + 48.206, R 2 >0.9889), the Ct values and log-transformed copy numbers of the tobacco mosaic virus primer set E (TVes-F and TVes-R) were higher in ToBRFV (y=-3.6873x+33.244, R 2 =0.9973), TMV(y=-4.053x+38.109, R 2 =0.9975),ToMMV(y=-3.324x+34.712, R 2 =0.9913), PMMoV(y=-4.4399x+40.522, R 2 =0.9993) and TMGMV (y = -3.951x + 36.512, R 2 =0.9982), indicating that the primers designed in this example have good amplification specificity and high amplification efficiency, and can be used for RT-PCR and RT-RAA analysis of ToBRFV and tobacco mosaic virus.
[0168] Experimental Example 11: Dual RT RAA-LFS sensitivity detection of ToBRFV and tobacco mosaic virus
[0169] Using the ToBRFV primer set A and the tobacco mosaic virus primer set E2 primer set to the corresponding plasmid of the amplified fragment as a template, the RTRAA amplification system in Experimental Example 9 was used to complete 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The RT RAA amplification of a mixed plasmid dilution of ToBRFV and tobacco mosaic virus at 10 copies / μL was performed. The amplified product was diluted 20 times and then tested on a test strip to determine the detection sensitivity of the primer combination.
[0170] The RT RAA-LFS sensitivity test results of ToBRFV primer set A and tobacco mosaic virus primer set E2 are as follows Figure 21 As shown, the detection sensitivity of the ToBRFV primer set ARTRAA-LFS was 10 2 copies / reaction, and the detection sensitivity of the tobacco mosaic virus primer set E2 did not reach 10 3 copies / reaction ( Figure 21 ).
[0171] Experimental Example 12: Optimization of the dual RT-RAA-LFS detection system for ToBRFV and tobacco mosaic virus
[0172] ToBRFV Primer Set A and Tobacco Mosaic Virus Primer Set E2 were pre-mixed to facilitate adjustment of primer addition amounts within the RT RAA duplex amplification system. The amounts of each primer added for different primer mixes are as follows:
[0173]
[0174] use The RT RAA Nucleic Acid Amplification Kit (Test Strip Method) (JY0204) is used to prepare a dual RT RAA reaction system for ToBRFV and tobacco mosaic virus (single sample / reaction). The system is as follows:
[0175]
[0176] The order of adding samples is negative control sample (the supernatant of plant leaf lysate is replaced with the same volume of ultrapure water), 1×10 3Copies / μL of primer pair A and primer pair E2 to the corresponding plasmids for the BRFV amplification products. Immediately secure the cap after adding each sample to avoid aerosol contamination. Mix the above reaction system thoroughly and add the base reaction unit. Dissolve the lyophilized powder thoroughly. Note: Do not use a vortex shaker to mix vigorously during this step. Open the reaction unit and add 2.5 μL of 280 mM MgAc2 to each 0.2 mL eppendorf tube. Mix thoroughly and collect by centrifugation. Note: Do not use a vortex shaker to mix vigorously during this step.
[0177] The reaction tube was placed at 39°C for 16 minutes. After the RTRAA reaction was completed, the eppendorf tube was opened and the amplified product was transferred to a new eppendorf tube, marked, and diluted 20-50 times.
[0178] like Figure 22 As shown in the results, the RAA amplification primers of primer set A and primer set E2 were added in different amounts, and the negative control and 1×10 3 The results of the test strip test after the positive plasmid amplification product was diluted 20 times were correct only for the primer combinations optimized 3 and optimized 4, and the detection rates of tobacco mosaic virus (test line T1) and ToBRFV (test line T2) were 1×10 3 The detection results of the mixed plasmid amplification products with a concentration of 100 copies / μL were all positive. Based on the color development results, the optimized 4 addition amount for better color development of the amplification product was determined to be the addition amount of the dual RTRAA-LFS primer set.
[0179] ToBRFV primer set A and tobacco mosaic virus primer set E2 primer set were used to amplify the corresponding plasmids as templates, and the primer addition amount scheme was optimized 4, with the added concentration of 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The plasmid with 10 copies / μL was used as a template to complete the double RTRAA amplification of the mixed plasmid dilution of ToBRFV and tobacco mosaic virus. The amplified product was diluted 20 times and then tested on the test strip to determine the detection sensitivity of the primer combination.
[0180] The RT RAA-LFS sensitivity test results of ToBRFV primer set A and tobacco mosaic virus primer set E2 are as follows Figure 23 As shown in the figure, the detection sensitivity of ToBRFV primer set A and tobacco mosaic virus primer set E2 double RT RAA-LFS can reach 10 1 copies.
[0181] Experimental Example 13: Establishment of a dual RT RAA-LFS detection system using a primer set for ToBRFV and tobacco mosaic virus plus lysis buffer
[0182] RT-qPCR identified the positive results for ToBRFV (about 3.2×10 3 virus copies / mg leaf), tobacco mosaic virus TMV positive (about 3.8×10 6 virus copies / mg leaf), TMMoV positive (about 5.4×10 5 virus copies / mg leaf), PMMoV positive (about 7.1×10 6 virus copies / mg leaf) and TMGMV positive (about 1.3×10 5 Virus copies / mg leaf) of plant leaf samples, 20mg plant leaf samples and 100μL Cool Flash Nucleic Acid Releaser (BT0068) was used to crush the material to be tested several times with the tip of the pipette, and then centrifuged. 2 μL of the leaf lysate supernatant was taken for testing.
[0183] The optimized dual RT RAA amplification system in Experimental Example 12 was used for amplification, and the supernatant of plant leaf lysate was used as a template. The RT RAA Nucleic Acid Amplification Kit (Test Strip Method) (JY0204) is used to prepare a dual RT RAA reaction system for ToBRFV and tobacco mosaic virus (single sample / reaction). The system is as follows:
[0184] Components Dosage (μL) Basal buffer 29.4 ToBRFV-F (5 μM) 1.6 ToBRFV-R (5 μM) 2.4 ToBRFV-P (1 μM) 2.1 TVes-F (5 μM) 1.92 TVes-R (5μM) 2.88 TVes-P (1 μM) 5.2 Plant leaf lysate supernatant 2 Fill up to volume with water 47.5
[0185] Each material was amplified and LFS tested for ToBRFV, ToBRFV+another virus of the same genus, another virus of the same genus, and negative control. The order of sample addition was negative control sample (the supernatant of plant leaf lysate was replaced with the same volume of ultrapure water) and plant leaf lysate supernatant. The tube cap should be fastened immediately after each sample was added to avoid aerosol contamination. Mix the above reaction system and add the basic reaction unit. Dissolve the freeze-dried powder fully. Note that this step cannot be vigorously shaken and mixed using a vortex oscillator. Open the reaction unit, add 2.5μL280mM MgAc2 to each 0.2mL eppendorf tube, mix thoroughly and collect by centrifugation. Note that this step cannot be vigorously shaken and mixed using a vortex oscillator.
[0186] Place the reaction tube at 39°C for 16 minutes. After the RAA reaction is complete, open the eppendorf tube, pipette the amplified product into a new eppendorf tube, label it, and dilute it 20-50 times.
[0187] like Figure 24As shown, after the tobacco leaves infected with ToBRFV, TMV, TMMoV, PMMoV and TMGMV were lysed, the supernatant was taken and the lysate supernatant was mixed or amplified individually according to the optimal reaction system determined in Example 12, and all of them could be correctly amplified and colored.
[0188] Experimental Example 14: Rapid Field Detection of ToBRFV and Tobacco Mosaic Viruses in Pepper Plants Using Dual RT RAA-LFS
[0189] The double RTRAA amplification system in Experimental Example 11 was used for amplification. Random sampling of pepper plants was performed in the field. 40 mg of each sample was selected, 20 mg of which were used to extract total RNA for RT qPCR analysis, to determine the Ct value and calculate the sample copy number; the other 20 mg samples were used according to The method provided by Cool Flash Nucleic Acid Releaser was used to lyse pepper leaf and seed samples and perform RT-RAA amplification reaction. The system is as follows:
[0190] Element Volume (μL) Plant sample lysate or total RNA solution 2 Basal buffer 29.4 ToBRFV-F (5 μM) 1.6 ToBRFV-R (5 μM) 2.4 ToBRFV-P (1 μM) 2.1 TVes-F (5 μM) 1.92 TVes-R (5μM) 2.88 TVes-P (1 μM) 5.2 <![CDATA[ddH2O]]> The total system is 47.5
[0191] The RTA amplification reaction conditions were as follows: After preparing the reaction solution, add 2.5 μL of 280 mM MgAc2 to each 0.2 mL eppendorf tube and mix thoroughly. The 0.2 mL eppendorf tubes were placed in a thermal cycler with a heated lid and incubated at 39°C for 16 minutes. After the RTA amplification reaction was complete, the eppendorf tubes were opened, the amplified product was transferred to a new eppendorf tube, labeled, and diluted 20-fold.
[0192] The RT qPCR results of the four samples at different sampling locations are shown in the following table:
[0193]
[0194] The RT RAA-LFS test results of each sample are as follows Figure 25 As shown, the system can achieve rapid field detection of ToBRFV and tobacco mosaic virus in the same sample by means of rapid sample lysis.
[0195] In summary, this application has screened out a primer set that can simultaneously detect ToBRFV and tobacco mosaic virus through a series of verifications. This primer set can effectively amplify the target gene, has high specificity and sensitivity, and has no cross-reaction with other viruses. It can be used for on-site rapid detection of plant ToBRFV and tobacco mosaic virus, which is of great significance for the effective prevention and control of these diseases.
[0196] The invention shown and described herein can be implemented in the absence of any element or limitation specifically disclosed herein. The terms and expressions used are used as terms of illustration rather than limitation, and it is not intended that any equivalents of the features shown and described or portions thereof be excluded from the use of these terms and expressions, and it should be recognized that various modifications are feasible within the scope of the present invention. It should therefore be understood that although the present invention is specifically disclosed through various embodiments and optional features, modifications and variations of the concepts described herein can be adopted by those of ordinary skill in the art, and it is believed that these modifications and variations fall within the scope of the present invention as defined in the appended claims.
[0197] The contents of the articles, patents, patent applications, and all other documents and electronically available information described or cited herein are incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other documents.
Claims
1. A RT-RAA detection primer probe set for detecting tomato brown rugose fruit virus ToBRFV and tobacco mosaic virus, characterized in that: The primer probe set includes a tomato brown rugose fruit virus detection primer, a tobacco mosaic virus detection primer, a tomato brown rugose fruit virus detection probe ToBRFV-P, and a tobacco mosaic virus detection probe TVes-P; wherein, The tomato brown wrinkled fruit virus detection primers include a forward primer ToBRFV-F and a reverse primer ToBRFV-R. The sequence of the forward primer ToBRFV-F is 5´- AACCAGACAAAAACCAAAGGAAG -3´, The sequence of the reverse primer ToBRFV-R is 5´- AAGCAGTAACTAGAGGATCTA -3´; The tobacco mosaic virus detection primers include a forward primer TVes-F and a reverse primer TVes-R. The sequence of the forward primer TVes-F is: 5'-ACAACTACAATGGCATACACACA-3', The sequence of the reverse primer TVes-R is: 5´-GCAAAATTCCCACCTATATCATATGT-3´; The sequence of the tomato brown wrinkled fruit virus detection probe ToBRFV-P is 5'-TCACTAGGTAATCAGTTCCAAACACAACAAG(THF)TAGAACAACCGTTCA-3'; the sequence of the tobacco mosaic virus detection probe TVes-P is 5´-TAYCCDGARTTCCARATHACSTTYTAYAAY(THF)CKCARAAYGCYGTRC -3´; The 5' end of the ToBRFV reverse primer ToBRFV-R is modified with FITC, the 5' end of the detection probe ToBRFV-P is modified with biotin, the 3' end of ToBRFV-P is phosphorylated, and THF is tetrahydrofuran; the 5' end of the tobacco mosaic virus reverse primer TVes-R is modified with digoxigenin, the 5' end of the probe TVes-P is modified with rhodamine, the 3' end of TVes-P is phosphorylated, and THF is tetrahydrofuran.
2. Use of the primer probe set according to claim 1 for detecting ToBRFV and tobacco mosaic virus in a biological sample for non-diagnostic purposes, or for preparing a kit for detecting whether a biological sample contains ToBRFV and / or tobacco mosaic virus.
3. A kit for detecting tomato brown rugose fruit virus ToBRFV and tobacco mosaic virus, characterized in that: The kit comprises the primer-probe set according to claim 1.
4. Use of the kit according to claim 3 in detecting whether a biological sample to be tested contains ToBRFV and tobacco mosaic virus for non-diagnostic purposes.
5. A method for detecting ToBRFV and tobacco mosaic virus based on RT-RAA-lateral flow chromatography technology for non-diagnostic purposes, characterized in that: The following steps are involved: 1) Lyse the sample or extract total RNA from the biological sample to be tested; 2) using the sample lysate or extracted total RNA obtained in step 1) as a template, and performing RT-RAA amplification using the primer probe set of claim 1; 3) Use lateral flow chromatography test strips to detect the amplified products. If only one band appears on the quality control line and no band appears on the test line, the result is negative, indicating that the sample does not contain ToBRFV and other tobacco mosaic virus viruses; if two bands appear on the test strip, one on the quality control line and one on the test line T1, the result is positive, and a positive test line T1 indicates that the sample contains tobacco mosaic virus viruses other than ToBRFV; if three bands appear on the test strip, one on the quality control line, one on the test line T1, and one on the test line T2, the result is positive, indicating that the sample contains ToBRFV and tobacco mosaic virus viruses including ToBRFV; if the quality control line of the test strip does not show color, the test is invalid and the test strip needs to be replaced and retested.
Citation Information
Patent Citations
Primer group, kit and method for detecting pepper mild mottle virus and colletotrichum gloeosporioides
CN114959116A