Bionic nanoscale enzyme complex system based on high expression of trail and preparation method and application thereof

Abstract

The application discloses a kind of based on TRAIL high expression's biomimetic nanoenzyme composite system and preparation method and application.The application is by constructing TRAIL high expression's cell, extracts TRAIL high expression's cell membrane;The cell membrane and Cu 2‑x Se nano particle mixture, solid-liquid separation is washed after, obtains based on TRAIL high expression's Cu 2‑ x Se biomimetic nanoenzyme composite system.This system greatly improves the Cu 2‑x Se catalase and glutathione peroxidase's enzyme ability, can be better under the action of combined X ray Promote the apoptosis of radioresistant cervical cancer cell, so as to better play the role of reversing radioresistance.

Description

Technical Field

[0001] This invention belongs to the field of drug carriers, and specifically relates to a biomimetic nanozyme composite system based on TRAIL high expression, its preparation method and application. Background Technology

[0002] Cervical cancer is the second leading cause of cancer death among women worldwide. Radiotherapy is one of the main clinical treatments for cervical cancer, especially advanced and recurrent cervical cancer, with over 80% of patients with advanced cervical cancer requiring radiotherapy. However, radiation tolerance remains a challenge in cervical cancer treatment. Statistics show that approximately 21.7% of cervical cancer patients experience local recurrence after radiotherapy due to radiation tolerance. Furthermore, radiotherapy for cervical cancer also presents challenges such as dose-related toxicity and damage to surrounding tissues. Therefore, increasing the radiosensitivity of cervical cancer, overcoming radiation tolerance, and simultaneously reducing the toxic side effects of radiotherapy on normal tissues and preventing recurrence are crucial issues that urgently need to be addressed in the radiotherapy of cervical cancer.

[0003] Radiation tolerance in cervical cancer is related to the specific tumor microenvironment, such as hypoxia, immunosuppression, and energy metabolism inhibition. Furthermore, the hypoxic environment of the tumor significantly reduces the efficacy of radiotherapy. For radiation-tolerant tumors, high-dose X-ray irradiation is necessary for complete local tumor ablation; however, high-dose X-ray irradiation often induces radiation-induced immunosuppression, thus limiting the efficacy of conventional radiosensitizers in radiation-tolerant cervical cancer. Therefore, disrupting the radiation-tolerant tumor microenvironment is a crucial strategy for reversing radiation tolerance in cervical cancer.

[0004] Although there has been extensive research on increasing the local oxygen content of tumors with nanomaterials to improve the efficacy of tumor radiotherapy, the number of nanomaterials that can be directly used to treat tumors is very limited, and the delivery of nanomedicines has certain drawbacks, which limits their clinical application. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of existing technologies and provide a Cu based on TRAIL high expression. 2-x Preparation method of Se biomimetic nanozyme composite system.

[0006] Another object of the present invention is to provide Cu based on TRAIL high expression obtained by the above preparation method. 2-x Se biomimetic nanoenzyme composite system.

[0007] Another object of the present invention is to provide the above-mentioned Cu based on TRAIL high expression. 2-x Application of Se biomimetic nanoenzyme composite system.

[0008] The application discloses a Cu 2-x The preparation method of the Se biomimetic nano-enzyme composite system comprises the following steps:

[0009] (1) constructing TRAIL high-expression cells, and extracting cell membranes of the TRAIL high-expression cells;

[0010] (2) mixing the cell membranes obtained in the step (1) and Cu 2-x Se nanoparticles, performing solid-liquid separation, and then washing to obtain the Cu 2-x Se biomimetic nano-enzyme composite system based on TRAIL high expression.

[0011] The TRAIL high-expression cells in the step (1) are preferably prepared by the following steps: cloning a gene coding TRAIL into an expression vector to obtain a recombinant expression vector; and transfecting the recombinant expression vector into expression cells to obtain the TRAIL high-expression cells.

[0012] The expression vector is preferably a lentiviral expression vector PLVX-IRES-ZsGreen1.

[0013] The specific steps of the transfection are preferably as follows: packaging the recombinant expression vector through a packaging cell to obtain virus particles; and then infecting the expression cells with the virus particles to obtain the TRAIL high-expression cells.

[0014] The packaging cell is preferably a 293T cell.

[0015] The expression cell is preferably a cervical cancer Hela cell.

[0016] The TRAIL high-expression cell membrane in the step (1) is preferably obtained by the following steps: resuspending the TRAIL high-expression cells with a hypotonic solution and an EDTA-free protease inhibitor, then rapidly freezing in liquid nitrogen, taking out and restoring to liquid state at room temperature, repeatedly freezing and thawing, centrifuging, and taking the supernatant; centrifuging the supernatant, taking the precipitate, resuspending the precipitate with ultrapure water to recover the precipitate, and obtaining the TRAIL high-expression cell membrane.

[0017] The hypotonic solution is composed of 20 mM Tris, 10 mM KCl and 2 mM MgCl, and the solvent is water.

[0018] The freezing time is preferably 6-10 s; more preferably 8 s.

[0019] The freezing and thawing times are preferably 4-8 times; more preferably 6 times.

[0020] The centrifugal condition is preferably 15-25 min at 4℃, 12000-18000 rpm; more preferably 20 min at 4℃, 15000 rpm.

[0021] The Cu 2-x The Se nanoparticles are preferably prepared by the following steps:

[0022] A. mixing polyvinylpyrrolidone solution and sodium selenite solution to obtain solution A;

[0023] B. mixing solution A with ascorbic acid solution to obtain solution B;

[0024] C. reacting solution B with CuSO4·5H2O solution and ascorbic acid solution; performing solid-liquid separation on the product obtained by the reaction, and washing the solid to obtain Cu 2-x Se nanoparticles.

[0025] The concentration of polyvinylpyrrolidone in solution A is preferably 11-12 mg / mL.

[0026] The concentration of sodium selenite in solution A is preferably 2.5-3 mmol / L.

[0027] The ratio of the components in solution B is preferably calculated as polyvinylpyrrolidone:sodium selenite:ascorbic acid=400 mg:100 μmol:600 μmol.

[0028] The reaction time in step B is preferably 10-20 min; more preferably 15 min.

[0029] The amount of CuSO4·5H2O used in step C is preferably calculated as sodium selenite:CuSO4·5H2O=molar ratio 1:2.

[0030] The amount of ascorbic acid used in step C is preferably calculated as CuSO4·5H2O:ascorbic acid=molar ratio 1:4.

[0031] The reaction time in step C is 25-35 h; more preferably 30 h.

[0032] The cell membrane and the Cu 2-x The Se nanoparticles are preferably mixed at a mass ratio of 1.5-2.5:1; more preferably at a mass ratio of 2:1.

[0033] The mixing mode in step (2) is preferably ultrasonic.

[0034] The ultrasonic condition is 90-150 min in ice; more preferably 120 min.

[0035] The mode of solid-liquid separation in step (2) is preferably centrifugation.

[0036] The condition of centrifugation is preferably 8000-12000 rpm for 15-25 min; more preferably 10000 rpm for 20 min.

[0037] The washing in step (2) is preferably washing with ultrapure water.

[0038] A Cu 2-x Se biomimetic nano-enzyme composite system is prepared by the above preparation method.

[0039] The Cu 2-x Se biomimetic nano-enzyme composite system in the preparation of an anti-tumor drug.

[0040] The time units in the text are seconds represented by s, minutes represented by min, and hours represented by h.

[0041] The present application has the following advantages and effects relative to the prior art:

[0042] (1) Cu 2-x Se as a new type of nanomaterial has both Fenton-like reaction and nano-enzyme activity, can simulate the role of catalase to improve the hypoxic environment of tumors. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) also has the effect of targeting tumor killing, but TRAIL alone has problems such as systemic toxicity, poor bioavailability, easy to be cleared in blood, drug resistance, etc. The Cu 2-x Se biomimetic nano-enzyme composite system (CCMT) of the present application based on high expression of TRAIL has better targeting effect on cervical cancer cells than Cu 2-x Se nanoparticles (Cu 2-x Se) alone and cell membrane modified Cu 2-x Se (CCM) alone. 2-x Se Fenton-like reaction and glutathione peroxidase enzyme activity, and the energy inhibition effect and mitochondrial damage of CCMT on radioresistant cervical cancer cells are also significantly stronger than Cu 2-x Se nanoparticles alone, which can better promote the apoptosis of radioresistant cervical cancer cells under the action of X-rays, thereby better playing the role of reversing radioresistance.

[0043] (2) Cell membrane modification belongs to biomimetic modification, has immune escape and high tumor targeting, and the targeting of the nano-composite system CCMT modified by the cell membrane on cervical cancer is significantly higher than that of Cu2-x Se nanoparticles, while it was found that the uptake of CCMT by antigen-presenting cells was significantly lower than that of Cu 2-x Se nanoparticles.

[0044] (3) TRAIL is a soluble type II transmembrane protein that can specifically bind to death receptors (TRAILR1 / DR4 and TRAILR2 / DR5) on the membrane of tumor cells, triggering caspase-dependent apoptosis, which can achieve high specificity targeting and anti-tumor effect on tumor cells but no binding effect on normal cells. Taking advantage of the dual effects of TRAIL on anti-tumor and targeting, the cervical cancer cells with high expression of TRAIL were constructed, and the TRAIL and Cu 2-x Se nanoparticles were connected together to exert stronger anti-tumor effect. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 are transmission electron micrographs of cell membranes and biomimetic nanocomposite systems; wherein, from left to right, are tumor cell membranes CMT, Cu 2-x Se, CCM and CCMT with high expression of TRAIL.

[0046] Figure 2 are photos of Coomassie blue staining and Western Blot results of cell membranes and biomimetic nanocomposite systems.

[0047] Figure 3 are biomimetic nanocomposite system enzyme-like activity effect diagrams; wherein, (a) is the infrared detection result; (b) is the GSH clearance rate effect diagram; (c) is the GSH concentration result.

[0048] Figure 4 are biomimetic nanocomposite system survival rate inhibition experiment effect diagrams on radioresistant cervical cancer death; wherein, the three diagrams in the upper column are the results of Cu 2-x Se, CCM and CCMT with 0 Gy dose of X-ray inhibiting the proliferation of radioresistant cervical cancer cells, Cu 2-x Se, CCM and CCMT with 4 Gy dose of X-ray inhibiting the proliferation of radioresistant cervical cancer cells, and the isobologram analysis results of CCMT and X-ray; the three diagrams in the lower column are the results of Cu 2-x Se, CCM and CCMT with 8 Gy dose of X-ray inhibiting the proliferation of radioresistant cervical cancer cells, Cu 2-x Se, CCM and CCMT with 12 Gy dose of X-ray inhibiting the proliferation of radioresistant cervical cancer cells, Cu 2-x Se, CCM and CCMT cytotoxicity results on Ect / E6E7 cells.

[0049] Figure 5 Experimental results of the bionic nanocomposite system causing cell cycle arrest.

[0050] Figure 6 Experimental results of the bionic nanocomposite system causing apoptosis.

[0051] Figure 7 Experimental results of the bionic nanocomposite system causing mitochondrial membrane potential damage.

[0052] Figure 8 Experimental results of the bionic nanocomposite system promoting intracellular ROS production.

[0053] Figure 9 Experimental results of the bionic nanocomposite system inhibiting energy metabolism of radioresistant cervical cancer cells. DETAILED DESCRIPTION

[0054] The application will be described in further detail below with reference to the embodiments and accompanying drawings, but the embodiments of the application are not limited thereto.

[0055] Example 1

[0056] The Cu2Se bionic nanocomposite system based on TRAIL high expression was prepared according to the following method, in which Cu2Se was used as the core particle, and the membrane of TRAIL high expression cervical cancer cells was used for surface bionic modification. The preparation method is as follows: 2-x 2-x The Cu2Se bionic nanocomposite system based on TRAIL high expression was prepared according to the following method, in which Cu2Se was used as the core particle, and the membrane of TRAIL high expression cervical cancer cells was used for surface bionic modification. The preparation method is as follows:

[0057] After 5 mL of polyvinylpyrrolidone solution with a concentration of 80 mg / mL was fully dissolved by stirring with 30.5 mL of water, 0.5 mL of sodium selenite solution with a concentration of 200 mM was added and stirred to mix uniformly, followed by adding 1.5 mL of ascorbic acid solution with a concentration of 400 mM and stirring for 15 min, and then adding 0.5 mL of CuSO4·5H2O solution with a concentration of 400 mM and 2 mL of ascorbic acid solution with a concentration of 400 mM and stirring for 30 h to obtain Cu2Se nanoparticles.

[0058] The TRAIL gene sequence was searched through the GenBank database, and a sequence containing the TRAIL coding frame and enzyme cutting sites (EcoR I and BamH I) was synthesized:

[0059] CCG GAATCC ​ATGGCTATGATGGAGGTCCAGGGGGGACCCAGCCTGGGACAGACCTGCGTGCTGATCGTGATCTTCACAGTGCTCCTGCAGTCTCTCTGTGTGGCTGTAACTTACGTGTACTTTACCAACGAGCTGAAGCAGATGCAGGACAAGTACTCCAAAAGTGGCATTGCTTGTTTCTTAAAAGAAGATGACAGTTATTGGGACCCCAATGACGAAGAGAGTATGAACAGCCCCTGCTGGCAAGTCAAGTGGCAACTCCGTCAGCTCGTTAGAAAGATGATTTTGAGAACCTCTGAGGAAACCATTTCTACAGTTCAAGAAAAGCAACAAAATATTTCTCCCCTAGTGAGAGAAAGAGGTCCTCAGAGAGTAGCAGCTCACATAACTGGGACCAGAGGAAGAAGCAACACATTGTCTTCTCCAAACTCCAAGAATGAAAAGGCTCTGGGCCGCAAAATAAACTCCTGGGAATCATCAAGGAGTGGGCATTCATTCCTGAGCAACTTGCACTTGAGGAATGGTGAACTGGTCATCCATGAAAAAGGGTTTTACTACATCTATTCCCAAACATACTTTCGATTTCAGGAGGAAATAAAAGAAAACACAAAGAACGACAAACAAATGGTCCAATATATTTACAAATACACAAGTTATCCTGACCCTATATTGTTGATGAAAAGTGCTAGAAATAGTTGTTGGTCTAAAGATGCAGAATATGGACTCTATTCCATCTATCAAGGGGGAATATTTGAGCTTAAGGAAAATGACAGAATTTTTGTTTCTGTAACAAATGAGCACTTGATAGACATGGACCATGAAGCCAGTTTTTTTGGGGCCTTTTTAGTTGGCTAA GGATCC GCG.

[0060] The sequence was digested with EcoR I and BamH I, ligated with ligase, transformed, plated, and single clones were selected. The correct TRAIL overexpression recombinant plasmid PLVX-IRES-ZsGreen1-TRAIL was obtained by sequencing. The empty vector was used as a negative control. Then, the virus was packaged in 293T cells at a ratio of psPAX2: pMD2.G: TRAIL overexpression or empty vector = 3:1:4, and the virus titer was determined. The recombinant lentivirus was transfected into cervical cancer Hela cells. Finally, the green fluorescence of TRAIL in the cells was detected by fluorescence microscopy, and the expression level of TRAIL protein was detected by Western Blot.

[0061] The TRAIL high-expression cervical cancer cells were collected, trypsinized, and centrifuged. The cells were resuspended in a prepared hypotonic solution (consisting of 20 mM Tris, 10 mM KCl, and 2 mM MgCl; amount 10 mL, containing Tris 0.0242 g, KCl 0.00745 g, and MgCl 0.0019 g) + EDTA-free protease inhibitor (Thermo Fisher Scientific, item number: 36978, used according to the instructions), then quickly frozen in liquid nitrogen for 8 s, taken out, and restored to liquid state at room temperature. The cells were repeatedly frozen and thawed 6 times, then centrifuged at 4°C and 15000 rpm for 20 min. The supernatant was centrifuged again (4°C, 38000 rpm, 30 min), and the precipitate was resuspended in 1 mL ultrapure water to recover the TRAIL high-expression Hela cell membrane (CMT). The protein concentration of the two cell membranes was detected by BCA protein concentration determination method. The purified cervical cancer cell membrane CMT and Cu 2-x Se nanoparticles were mixed at a mass ratio of 2:1, ultrasonicated in ice for 2 h, centrifuged at 10000 rpm for 20 min, and washed once with ultrapure water. Finally, the membrane-capsule-coated Cu 2-x The biomimetic nanocomposite system CCMT of Se.

[0062] The ordinary cervical cancer Hela cells were collected, trypsinized, and centrifuged. The cells were resuspended in a prepared hypotonic solution + EDTA-free protease inhibitor, repeatedly frozen and thawed in liquid nitrogen, and centrifuged to obtain the cervical cancer cell membrane (the specific method is the same as above). Then, the cervical cancer cell membrane was mixed with Cu 2-x Se nanoparticles were mixed at a mass ratio of 2:1, ultrasonicated in ice for 2 h, and centrifuged. Finally, the membrane-capsule-coated Cu 2-x The biomimetic nanocomposite system CCM of Se.

[0063] Example 2

[0064] The Cu 2-x Se based on TRAIL high expression prepared by the method of Example 1 2-x Se nanoparticles (Cu 2-x Se), Cu 2-x Se(CCM) modified by cell membrane alone were used for control test.

[0065] (1) Transmission electron microscopy was used to observe three kinds of nanomaterials, which were; Cu 2-x Se nanoparticles (Cu 2-x Se), Cu 2-x Se(CCM) modified by cell membrane alone and Cu 2-x Se(CCMT) modified by TRAIL high expression cervical cancer cell membrane. As Figure 1 shown, single Cu 2-x Se presented spherical structure nanoparticles with uniform size, and after being completely encapsulated by cell membrane CM or CMT, it constructed spherical particles with high dispersion and nuclear membrane structure, and the outer membrane structure could be seen. Therefore, the nanocomposite system

[0066] (2) Coomassie blue staining and Western Blot experiment were used to verify the existence of cell membrane, as follows:

[0067] 1) Coomassie blue staining experiment was used to verify the membrane surface antigen of cell membrane CM, CMT and nanocomposite system Cu 2-x Se, CCM, CCMT: ① According to the operation method of BCA kit instruction, the concentration of different samples was determined, and the protein sample was prepared by adding 5x SDS sample buffer and ultrapure water to the sample, and then boiled in 95℃ oscillator for 5min to denature the protein. ② 20μL sample was added to 10% SDS-PAGE gel, and concentrated at 80V for 40min, and then separated at 120V for 90min, then the gel was placed in 0.25%(w / v) coomassie blue staining solution for 30min, and then washed with decolorizing solution several times and photographed.

[0068] 2) Western blot: collect protein from cells under different treatment conditions, determine the protein concentration by BCA assay, mix with SDS loading buffer according to 40 μg loading amount, and place in an incubation plate at 95°C for 10 min. After cooling, take 20 μL volume of protein and add to the pre-prepared SDS-PAGE gel for electrophoresis, separate the protein, and set the voltage of the concentrated gel and the separation gel to 70V and 110V, respectively. After the electrophoresis process is completed, take out the gel for the next membrane transfer operation, set the conditions to constant current 300mA, 90min to transfer the protein to the PVDF membrane, then block the membrane with 5% skim milk for 2h. After washing with TBST buffer, add the pre-prepared primary antibody for 4°C overnight incubation (uPAR: rabbit antibody, 1:1000, CST; Galectin-3: rabbit antibody, 1:1000, CST, Integrin β3 / R: rabbit antibody, 1:1000, CST). The next day, take out the membrane, wash with TBST three times, and add the corresponding secondary antibody for 1h incubation at room temperature. After transferring the membrane to TBST solution and washing three times, add the color developing solution and develop the color with Kodak luminescence detector.

[0069] As shown in Figure 2 , CCMT all showed cell membrane protein bands and the protein bands were the same as the cell membrane CMT alone, indicating that there were tumor cell membrane antigens on the surface of CCMT, proving that the nano composite system CCMT successfully encapsulated the tumor cell membrane.

[0070] (3) Detect whether the three nano systems have similar hydrogen peroxidase and glutathione peroxidase activities: use the kit (Biyun Tian, S0053) for detection. As shown in Figure 3 , compared with the other two nano selenium materials, CCMT has the strongest ability to decompose H2O2 to produce oxygen and the strongest ability to remove glutathione, and the best enzyme-like function.

[0071] (4) Survival inhibition experiment of three kinds of nanocomposite systems on radioresistant cervical cancer cells: CCK-8 assay was used to evaluate the cytotoxicity of biomimetic nanodrugs on HeLa-XR (according to the literature "Guo X, Xiao H, Guo S, et al. Long noncoding RNA HOTAIR knockdown inhibits autophagy and epithelial-mesenchymal transition through the Wnt signaling pathway in radioresistant human cervical cancer HeLa cells. J Cell Physiol 2019; 234: 3478-3489. 2018 / 10 / 28. DOI: 10.1002 / jcp.26828. PMID: 30367473" Hela-R cell construction for construction) cells. Specifically, HeLa-XR cells and Ect1 / E6E7 cells (available from ATCC) were seeded in 96-well plates at 3 x 10 4 cells / well and incubated with different concentrations of Cu 2-x Se, CCM or CCMT (0, 2.5, 5, 10, 20 and 40 mg / L as Cu 2-x Se concentration), 100 μL / well, for 72 h, then 10 μL CCK-8 was added per well, and incubated at 37°C for 3 h. Subsequently, the absorbance of each well at 450 nm was read and analyzed. The radiation reversal efficacy of biomimetic nanodrugs on HeLa-XR cells was further evaluated. HeLa-XR cells were treated with Cu 2- x Se, CCM or CCMT for 4 h, then exposed to X-ray irradiation (0 Gy, 4 Gy, 8 Gy and 12 Gy). After 72 h of incubation, the synergistic effect of biomimetic nanodrugs and X-ray was evaluated by CCK-8 assay, and isobologram analysis was also performed to analyze the interaction between CCMT and X-ray. As shown in Figure 4 , CCMT had the best killing effect on radioresistant cervical cancer cells compared to the other two nanocomposites, and had no obvious killing effect on normal cervical cells, and had a synergistic radiotherapy sensitization effect with X-ray.

[0072] (5) Experiment of three kinds of nanocomposite systems causing radioresistant cell cycle arrest: HeLa-XR cells cultured in 10 cm culture dishes at a density of 2 x 10 4 cells / well were incubated with 10 mg / L Cu 2-xCells were incubated with Se, CCM, or CCMT (10 mL of culture medium per dish) for 4 h, followed by X-ray irradiation (4 Gy). After 48 h, the cells were digested with trypsin, washed with PBS, fixed overnight in 75% ethanol at 4°C, and stained with PI in the dark for 30 min. Cell cycle phase distribution was then detected by flow cytometry, and the data were analyzed in Modfit software. Figure 5 As shown, compared with the other two nanocomposites, CCMT showed the best enhancement of the Sub-G1 apoptosis peak and S-phase arrest.

[0073] (6) Experiment on the induction of apoptosis in radiation-tolerant cells by three nanocomposite systems: The cells were cultured in 10cm dishes at a concentration of 2×10⁻⁶ nanoparticles. 4 / Density of HeLa-XR cells cultured with 10 mg / L Cu 2-x Cells were incubated with Se, CCM, or CCMT (10 mL of culture medium per dish) for 4 h, followed by X-ray irradiation (4 Gy). After 48 h, the cells were digested with EDTA-free trypsin and stained with annexin V-FITC and PI in the dark for 30 min. The apoptosis rate was then detected by flow cytometry and CytExpert software. Figure 6 As shown, compared to the other two nanocomposites, CCMT showed the best effect, significantly inhibiting both early and late apoptosis in radiation-resistant cervical cancer cells.

[0074] (7) Experiments on the mitochondrial membrane potential damage induced by three nanocomposite systems: The nanocomposite systems were cultured in 10cm petri dishes at a concentration of 2×10⁻⁶ ppm. 4 / Density of HeLa-XR cells cultured with 10 mg / L Cu 2-x Cells were incubated with Se, CCM, or CCMT for 4 hours (10 mL of culture medium per dish) and then irradiated with X-rays (4 Gy). After 48 hours, the treated cells were digested with trypsin and stained with JC-1 in the dark for 30 minutes. The proportion of cells with decreased membrane potential was then detected by flow cytometry and CytExpert software. Figure 7 As shown, CCMT is the most effective nanocomposite compared to the other two, and it can significantly reduce the membrane potential of radiation-resistant cervical cancer cells.

[0075] (8) Experiments on the promotion of intracellular reactive oxygen species (ROS) production by three nanocomposite systems: using 2×10 5 HeLa-XR cells were seeded at a density of 100 μL / mL into 96-well plates and cultured for 24 h until they adhered. 100 μL of Cu... 2-xSe, CCM or CCMT were incubated with cells at 10 mg / L for 6 h, then washed with pre-cooled PBS for 3 times, added with 100 μL DCFH-DA probe (working concentration: 10 μM), and incubated in the incubator for 30 min in the dark. The control group was detected for the fluorescence intensity of each well using the full-automatic enzyme marker for 2 h, and the radiotherapy group was detected for the fluorescence intensity of each well using the full-automatic enzyme marker for 2 h after the cells were irradiated by the X-ray irradiator at a dose of 4 Gy. The excitation wavelength was 488 nm, the emission wavelength was 525 nm, and finally the fluorescence microscope was used for observation and photography. Figure 8 As shown in Table 2, compared with the other two kinds of nanocomposites, CCMT has the best effect, which can obviously promote the production of reactive oxygen species (ROS) in radioresistant cervical cancer cells.

[0076] (9) Experiment of three kinds of nanocomposite systems inhibiting cell energy metabolism: cells (2 x 10 4 per well) were inoculated in Seahorse XF Pro M cell culture microporous plates (Agilent, 103774-100). After the cells adhered, 100 μL of complete culture medium (containing 10% calf serum, 1% penicillin-streptomycin RPMI-1640 medium) diluted Cu 2-X Se, CCM and CCMT were added to the cells at 10 mg / L. Extracellular acidification rate (ECAR) and oxygen consumption rate (OCAR) were measured by XFp cell mitochondrial stress test kit and XFp glycolysis stress test kit in Seahorse XF96 extracellular flux analyzer (Agilent). The concentration of XFp cell mitochondrial stress test kit and XFp glycolysis stress test kit was 0.5 mM rotenone / antimycin A, 10 mM glucose and 50 mM 2-DG. The detection results are shown in Table 3. Figure 9 As shown in Table 3, compared with the other two kinds of nanocomposites, CCMT has the best effect, which can obviously inhibit the oxidative phosphorylation level and glycolysis level of radioresistant cervical cancer cells.

[0077] In summary, the application not only demonstrates the preparation method of the Cu2Se biomimetic nanozyme composite system based on the high expression of TRAIL, but also provides more evidence for the clinical application of nanomaterials in radiosensitization of radioresistant cervical cancer and future radiotherapy of tumors. Through the detection of the enzyme-like function, it is verified that CCMT has the ability to decompose H2O2 to produce oxygen and remove glutathione, and it is found that it can reverse the radioresistance of cervical cancer, which is achieved by inhibiting cell energy metabolism, promoting the production of excess ROS in cells, promoting the oxidative damage of mitochondria, and thus promoting cell apoptosis and cycle arrest.

[0078] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications, etc. made without departing from the spirit and principles of the present application should be equivalent replacement manners and should be included in the protection scope of the present application.

Claims

1. A Cu based on TRAIL high expression 2-x The preparation method of the Se biomimetic nano-enzyme composite system is characterized by: Includes the following steps: (1) Construct cells with high TRAIL expression and extract the cell membrane of cells with high TRAIL expression; (2) The cell membrane obtained in step (1) and Cu 2-x Se nanoparticles were mixed, and after solid-liquid separation and washing, Cu based on TRAIL high expression was obtained. 2-x Se biomimetic nanoenzyme composite system; The TRAIL-high expression cells described in step (1) are prepared by the following steps: cloning the gene encoding TRAIL into an expression vector to obtain a recombinant expression vector; transfecting the recombinant expression vector into expression cells to obtain TRAIL-high expression cells; The cells expressing this expression are cervical cancer HeLa cells.

2. The Cu based on TRAIL high expression according to claim 1 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The expression vector is the lentiviral expression vector PLVX-IRES-ZsGreen1; The specific steps of the transfection are as follows: the recombinant expression vector is packaged in packaging cells to obtain viral particles; then the viral particles are used to infect expression cells to obtain cells with high TRAIL expression. The packaging cells are 293T cells.

3. The Cu based on TRAIL high expression according to claim 1 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The TRAIL-overexpressing cell membrane described in step (1) is obtained by the following steps: resuspending the TRAIL-overexpressing cells in a hypotonic solution and without EDTA protease inhibitor, then rapidly freezing them in liquid nitrogen and restoring them to a liquid state at room temperature, repeating the freeze-thaw cycle, centrifuging, and collecting the supernatant; centrifuging the supernatant, collecting the precipitate, resuspending it in ultrapure water to recover the precipitate, and obtaining the TRAIL-overexpressing cell membrane.

4. The Cu based on TRAIL high expression according to claim 1 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The Cu mentioned in step (2) 2-x Se nanoparticles were prepared through the following steps: A. Mix the polyvinylpyrrolidone solution and the sodium selenite solution to obtain solution A; B. Mix solution A with ascorbic acid solution and react to obtain solution B; C. React solution B with CuSO4·5H2O solution and ascorbic acid solution; perform solid-liquid separation on the product obtained from the reaction, wash the solid, and obtain Cu. 2-x Se nanoparticles.

5. The Cu based on TRAIL high expression according to claim 4 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The concentration of polyvinylpyrrolidone in solution A is 11-12 mg / mL; The concentration of sodium selenite in solution A is 2.5–3 mmol / L; The ratio of each component in solution B is calculated according to polyvinylpyrrolidone: sodium selenite: ascorbic acid = 400mg: 100µmol: 600µmol; The reaction time described in step B is 10–20 min; The amount of CuSO4·5H2O used in step C is calculated based on a molar ratio of sodium selenite to CuSO4·5H2O of 1:

2. The amount of ascorbic acid used in step C is calculated based on a molar ratio of CuSO4·5H2O:ascorbic acid of 1:

4. The reaction time described in step C is 25–35 hours.

6. The Cu based on TRAIL high expression according to claim 1 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The cell membrane and Cu mentioned in step (2) 2-x Se nanoparticles were mixed at a mass ratio of 1.5 to 2.5:

1.

7. The Cu based on TRAIL high expression according to claim 1 2-x The preparation method of the Se biomimetic nanoenzyme composite system is characterized by: The mixing method described in step (2) is ultrasound; The solid-liquid separation method described in step (2) is centrifugation; The cleaning described in step (2) is cleaning with ultrapure water.

8. A Cu based on TRAIL high expression 2-x The Se biomimetic nano-enzyme composite system is characterized by: It is obtained by the preparation method according to any one of claims 1 to 7.

9. The Cu based on TRAIL high expression as described in claim 8 2-x The application of the Se biomimetic nanozyme composite system in the preparation of antitumor drugs is characterized by: The tumor in question is cervical cancer.

Images