A low molecular weight collagen with a 164.88° triple helix structure

Abstract

Provided is a low molecular weight collagen with a 164.88° triple helix structure. Relates to a small molecule collagen, a preparation method and use thereof. The collagen of the present application comprises an amino acid sequence as shown in SEQ ID NO:1 or a variant amino acid sequence after mutation of the amino acid sequence, and the variant amino acid sequence retains the function of the amino acid sequence as shown in SEQ ID NO:1. The amino acid sequence of the collagen of the present application is shorter and has better transdermal absorption performance.

Description

[0001] This application claims the priority rights of the Chinese invention patent application with the application date of March 16, 2023, application number 202310268735.1, and the invention name of "A low molecular weight collagen with a triple helix structure of 164.88°"; the Chinese invention patent application with the application date of May 16, 2023, application number 202310553965.2, and the invention name of "A low molecular weight collagen with a triple helix structure of 164.88°"; and the PCT patent application with the application date of August 1, 2023, and the invention name of "A low molecular weight collagen with a triple helix structure of 164.88°" and application number PCT / CN2023 / 110578. The above applications are incorporated herein by reference. Technical Field

[0002] The present application relates to the field of collagen, and in particular to small molecule collagen, a preparation method and use thereof. Background Art

[0003] Collagen is a type of protein widely distributed in human connective tissues. It is also the most abundant protein in the human body, accounting for 25% to 35% of the total protein. Its main functions are to maintain the extracellular environment, maintain the normal physiological functions of tissues and organs, and repair body damage. Collagen is a natural biological resource with bio-tissue compatibility, cell-supporting elasticity and degradability that other polymer materials cannot match. Therefore, collagen can be widely used in industries such as medicine and cosmetics.

[0004] Natural collagen molecules can form a special superhelical structure, which is a left-handed helix with three amino acid residues as the basic repeating body. These three amino acid residues are usually Gly-X-Pro. Gly is necessary for the formation of hydrogen bonds in collagen. It has no side chains to make collagen densely packed, which can maintain skin tension and elasticity. As people age, collagen in the dermis degrades and ages, and the skin becomes dry and wrinkles appear. In order to prevent skin aging, some scholars have studied how to delay the aging process of the skin by supplementing collagen. At present, it is known that collagen is a high molecular weight protein. In terms of molecular weight, it is difficult to be absorbed through the skin. It can only enter the dermis through the micro-wounds of damaged skin, hair follicles and sweat glands to supplement collagen. Therefore, in previous studies, how to promote the transdermal absorption of collagen has become a research hotspot.

[0005] In recent years, with the widespread application of genetic engineering technology, researchers have created various types of recombinant collagen. For example, recombinant collagen can be constructed by selecting short amino acid sequences from natural human collagen. The recombinant collagen constructed in this way has advantages such as low immunogenicity, high biological activity, and good stability. In theory, the shorter the amino acid sequence of this recombinant collagen, the better the transdermal absorption performance, but the shorter the amino acid sequence is, the better. How to design a short amino acid sequence so that the constructed recombinant collagen has better transdermal absorption performance, there is no theory in the prior art that can serve as a guide.

[0006] There is a need in the art for new small molecule collagens. Summary of the invention

[0007] In response to current needs, the inventors have discovered a new collagen with a molecular weight of about 2814.07Da, which can penetrate the dermis of the skin to reach the subcutaneous tissue. After research, data show that the collagen of this application has a skin permeation rate of more than 85% after acting on the skin for 12 hours, showing excellent collagen transdermal absorption effect, and the effect is significantly better than the large molecule collagen on the market.

[0008] In one aspect, provided herein is a collagen comprising the following amino acid sequence:

[0009] (1) the amino acid sequence shown in SEQ ID NO: 1;

[0010] (2) an amino acid sequence having 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; or

[0011] (3) An amino acid sequence in which one or more amino acid residues are mutated in the amino acid sequence shown in SEQ ID NO: 1.

[0012] In one embodiment, the mutation is a substitution, insertion, deletion or addition. In one embodiment, the substitution is a conservative amino acid substitution.

[0013] In one embodiment, the collagen is derived from humans. In one embodiment, the collagen has a triple helical structure. In one embodiment, the collagen has a flexible triple helical structure. In one embodiment, the collagen is in the form of a trimer.

[0014] In one embodiment, the collagen has one or more of the following activities or effects: cell adhesion activity, cell migration promotion activity, transdermal absorption, anti-wrinkle effect, skin oil control effect, skin repair effect, skin soothing effect.

[0015] In one aspect, provided herein is a nucleic acid encoding the collagen described herein. In one embodiment, the nucleic acid has a nucleotide sequence as shown in SEQ ID NO:2.

[0016] In one aspect, provided herein are vectors comprising a nucleic acid as described herein. In one embodiment, the vector comprises nucleotides encoding a purification tag, nucleotides encoding a leader, and / or a regulatory element.

[0017] In one embodiment, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag.

[0018] In one embodiment, the regulatory element is selected from a promoter, a terminator and / or an enhancer.

[0019] In one aspect, provided herein is a host cell comprising a nucleic acid or vector as described herein. In one embodiment, the host cell is a eukaryotic cell or a prokaryotic cell. In one embodiment, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell. In one embodiment, the prokaryotic cell is an Escherichia coli cell. In one embodiment, the prokaryotic cell is an Escherichia coli BL21.

[0020] In one aspect, provided herein is a method for producing the collagen described herein, comprising:

[0021] (1) culturing the host cell described herein under appropriate culture conditions;

[0022] (2) harvesting host cells and / or culture medium containing collagen; and

[0023] (3) Purify the fusion protein.

[0024] In one embodiment, the method comprises (1) crudely purifying collagen on a Ni affinity chromatography column; (2) adding a collagen tool for enzymatic cleavage; and / or (3) purifying collagen on an ion exchange column.

[0025] In one aspect, provided herein is a composition comprising the collagen described herein, the nucleic acid described herein, the vector described herein, and / or the host cell described herein.

[0026] In one embodiment, the composition is a pharmaceutical composition or a cosmetic composition.

[0027] In one embodiment, the composition is one or more of biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printing artificial organ biomaterials, cosmetic raw materials and pharmaceutical excipients. In one embodiment, the composition is in solution dosage form, lyophilized powder dosage form, gel dosage form, sponge dosage form or fiber dosage form.

[0028] In one embodiment, the cosmetic composition is an anti-wrinkle effect, skin oil control effect, skin repair effect and / or skin soothing effect cosmetic composition. In one embodiment, the skin oil control effect is facial skin oil control effect.

[0029] In one embodiment, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier.

[0030] In one embodiment, the composition is a solid, liquid or gel composition.

[0031] In one embodiment, the composition is an oral and / or topical composition. In one embodiment, topical application is topical application to the skin. In one embodiment, the composition is a transdermal composition. In one embodiment, the composition is a kit.

[0032] In one embodiment, the composition is a liquid formulation comprising the collagen described herein and a pharmaceutically and cosmetically acceptable carrier. In one embodiment, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

[0033] In one aspect, provided herein is a method of causing cells to adhere or attach, the method comprising contacting the cells with a collagen, composition and / or liquid formulation described herein.

[0034] In one aspect, provided herein is a method of promoting cell migration, the method comprising contacting the cells with the collagen and / or composition described herein.

[0035] In another aspect, provided herein is a cosmetic or beauty method comprising applying to the skin the collagen and / or composition described herein. In one embodiment, the cosmetic or beauty method comprises applying to the skin other cosmetic and / or makeup products.

[0036] In one embodiment, the cosmetic or beauty method is a skin anti-wrinkle, oil control, repair and / or soothing method. In one embodiment, the application is topical application. In one embodiment, the application is transdermal application.

[0037] In yet another aspect, provided herein is the use of the collagen, nucleic acid, vector and / or host cell described herein in a pharmaceutical, cosmetic or beauty product.

[0038] In one embodiment, the product is an external product. In one embodiment, the cosmetic or beauty product is a skin anti-wrinkle, oil control, repair and / or soothing product. In one embodiment, the product is selected from biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printing artificial organ biomaterials.

[0039] In another aspect, the present invention provides the use of collagen, nucleic acid, vector and / or host cell described herein in the preparation of a drug or kit for anti-inflammatory or reducing inflammatory cytokines. In one embodiment, the inflammatory cytokine is TNF-α. In one embodiment, inflammation is caused by inflammatory cytokines, such as TNF-α.

[0040] In yet another aspect, provided herein is a method of reducing inflammatory cytokine levels in a cell, comprising contacting the cell with the collagen, composition and / or liquid formulation herein.

[0041] Advantages of the present invention include:

[0042] 1) The collagen in this article is prepared by synthetic biology technology. Its amino acid sequence is 100% consistent with the amino acid sequence of the core functional region of human collagen. It is the only small molecule protein with a 164.88° flexible triple helix structure.

[0043] 2) The collagen in this article is a small molecule collagen with a molecular weight of about 2814.07Da. It can penetrate the dermis of the skin to reach the subcutaneous tissue. Studies have shown that the permeability rate is as high as 85% or more after 12 hours of exposure to the skin, showing excellent collagen transdermal absorption effect, which is significantly better than the large molecule collagen on the market.

[0044] 3) The collagen structure in this article is clear: The collagen in this article uses the internationally advanced X-ray crystal diffraction technology to successfully analyze the triple helix structure of collagen. The relevant data has been included in the International Protein Database (PDB: 6A0A and 6A0C). It is the only small molecule collagen with a triple helix structure on the market.

[0045] 4) The collagen in this article is highly active and highly hydrophilic: it has higher cell adhesion activity than human collagen (twice that of human type I collagen).

[0046] 5) The collagen herein has skin anti-wrinkle, oil control, repair, soothing and / or anti-inflammatory effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Expression vector maps are shown.

[0048] Figure 2 The electrophoresis results during the collagen purification process are shown. Lane 1 is the marker, Lane 2 is the purified sample, Lane 3 is the collagen after liquid replacement, and Lane 4 is the collagen after enzyme digestion.

[0049] Figure 3 The mass spectrometry detection results of the small molecule collagen C3T1 of the present invention are shown.

[0050] Figure 4 The purity detection of the small molecule collagen C3T1 of the present invention is shown.

[0051] Figure 5 The effect of collagen on cell adhesion is shown. Compared with the control group, the sample is P < 0.05, which is indicated by *, P < 0.01, which is indicated by **, and P < 0.001, which is indicated by ***. From the results in the figure, it can be seen that the collagen of the present invention has better adhesion activity than bovine type I collagen.

[0052] Figure 6 Fluorescence microscopy observation results are shown.

[0053] Figure 7 Bar graph showing the effect of collagen on cell migration.

[0054] Figure 8 The actual diffusion percentage of the collagen sample is shown. As can be seen from the figure, the collagen permeability gradually increases with time, reaching as high as 86% in 12 hours.

[0055] Fig. 9 The qualitative analysis of the actual diffusion of the collagen sample is shown. The blue color is the DAPI fluorescence of the cell nucleus, and the green color is the fluorescence of the sample labeled with FITC. As can be seen from the figure, at 2 hours, the sample mainly stays on the surface of the skin, and after 4, 8, and 12 hours, the sample penetrates through the epidermis of the skin and into the dermis.

[0056] Fig.10 The bar graph of the type I collagen content of each group is shown. Error bar graph: 95% confidence interval. As can be seen from the figure, when the sample concentration is 25%-100%, the protein content of type I collagen can be significantly increased (p < 0.05), and it has the ability to promote the synthesis of type I collagen, indicating that the sample has obvious anti-wrinkle effect.

[0057] Fig.11The bar graph shows the relative expression of FLG in each group. Error bars: 95% confidence interval.

[0058] Fig.12 The bar graphs show the relative expression levels of TGM1 in each group. Error bars: 95% confidence interval.

[0059] Fig.13 A bar graph showing the TNF-α content of each group is shown. Error bars: 95% confidence interval. DETAILED DESCRIPTION

[0060] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0061] As used herein, a peptide or polypeptide refers to a plurality of amino acid residues connected by peptide bonds. Collagen may also be referred to herein as collagen peptides or polypeptides.

[0062] As used herein, "nucleic acid" refers to a plurality of nucleotides connected by internucleotides. Internucleotide connections can be, for example, phosphodiester bonds. The nucleic acid herein can include a polynucleotide encoding the collagen of the present invention. In order to facilitate subsequent processing of the collagen, the nucleic acid of the present invention can also include nucleotides encoding purification tags, such as His tags, GST tags, MBP tags, SUMO tags or NusA tags, and nucleotide sequences encoding leader sequences when necessary.

[0063] As used herein, the term "vector" is a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector can express the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or artificial chromosomes (PAC) derived from P1; bacteriophages such as lambda phage or M13 phage and animal viruses, etc. The vector may contain a variety of elements for controlling expression, including but not limited to promoter sequences, transcription start sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may also contain a replication initiation site. The vector may contain a nucleic acid of the present invention to facilitate introduction into cells for expression. The vector may contain expression control elements such as promoters, terminators and / or enhancers that are operably linked to the nucleic acid.

[0064] As used herein, the term "recombinant human collagen" refers to the full-length amino acid sequence encoded by a specific type of human collagen gene prepared by DNA recombinant technology, and has a triple helical structure. As used herein, the term "recombinant humanized collagen" refers to the full-length or partial amino acid sequence fragment encoded by a specific type of human collagen gene prepared by DNA recombinant technology, or a combination of functional fragments containing human collagen.

[0065] As used herein, the term "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. These techniques include transfection of viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. The host cell can be a eukaryotic cell or a prokaryotic cell. For example, a eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell. A prokaryotic cell can be an E. coli cell.

[0066] As used herein, the degree of association between two amino acid sequences or between two nucleotide sequences is described by parameter " sequence identity ".For purposes of the present invention, use as in EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. [Genetics Trend] 16: 276-277) (preferred 5.0.0 version or updated version) Niederman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [J.Molecular Biology] 48: 443-453) determine the sequence identity between two amino acid sequences.The parameter used is gap opening penalty 10, gap extension penalty 0.5 and EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.The output (using non-simplified option to obtain) of Nieder marked as "longest identity" is used as identity percentage and is calculated as follows:

[0067] (number of identical residues x 100) / (length of alignment - total number of gaps in the alignment)

[0068] For the purposes of the present invention, the sequence identity between two deoxynucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) implemented by the Needle program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, supra) (preferably 5.0.0 version or updated version). The parameters used are gap opening penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle, labeled "longest identity", (obtained using the non-simplified option) is used as identity percentage and is calculated as follows:

[0069] (number of identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment)

[0070] In the context of the present invention, conservative amino acid substitutions or conservative substitutions may be defined by substitutions within the amino acid classes reflected in one or more of the following tables:

[0071] Conservative categories of amino acid residues:

[0072] Acidic residue D and E Basic residues K, R, and H Hydrophilic uncharged residues S, T, N and Q Aliphatic uncharged residue G, A, V, L, and I Nonpolar uncharged residues C, M and P Aromatic residues F, Y and W

[0073] Physical and functional classification of candidate amino acid residues:

[0074] Alcohol residue S and T Aliphatic residues I, L, V, and M Cycloalkenyl related residues F, H, W, and Y Hydrophobic residues A, C, F, G, H, I, L, M, R, T, V, W and Y Negatively charged residues D and E Polar residues C, D, E, H, K, N, Q, R, S, and T Positively charged residues H, K and R Small residues A, C, D, G, N, P, S, T and V Minimal residue A, G, and S Residues involved in turn formation A, C, D, E, G, H, K, N, Q, R, S, P and T Flexible residues Q, T, K, S, G, P, D, E, and R

[0075] Collagen

[0076] In this article, the collagen of the present invention may have certain mutations. For example, the amino acid sequence of one or more of these parts may have substitution, deletion, addition or insertion of amino acid residues. That is to say, variants can be used in the present invention as long as the variant retains the activity of promoting cell adhesion and / or proliferation. Specifically, the variant may have a certain percentage identity with the specified sequence, such as 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity. The specified sequence can be any sequence of the present invention, such as SEQ ID NO.1, but it is preferred that these variants retain the function of the collagen of the present invention. The collagen of the present invention can have good transdermal performance and can reach the dermis directly. The multi-day of the present invention can be used for one or more of the following functions: anti-wrinkle effect, skin oil control effect, skin repair effect, skin soothing effect and anti-inflammatory effect.

[0077] The collagen of the present invention can be prepared by any suitable means, for example, by synthesis. Preferably, the collagen of the present invention can be prepared by recombinant means.

[0078] The collagen of the present invention may have a triple helical structure region. For example, the collagen has a flexible triple helical structure region. The collagen of the present invention may form a triple helical structure. After measurement, the small molecule collagen C3T1 of the present invention may form a 164.88° triple helical structure.

[0079] Composition

[0080] The collagen of the present invention can be prepared as a composition. The composition may include the collagen described herein, nucleic acid, vector and / or host cell. The composition may also include a pharmaceutically or cosmetically acceptable carrier or solvent. The composition may be a pharmaceutical composition or a cosmetic composition for the purpose of medicine and / or cosmetics. For example, the composition is one or more of a biological dressing, a human bionic material, a plastic surgery material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material and a vascular repair and regeneration material, a 3D printed artificial organ biomaterial, a cosmetic raw material and a pharmaceutical excipient.

[0081] The cosmetic composition may be a cosmetic composition having anti-wrinkle effect, skin oil control effect, skin repair effect and / or skin soothing effect. The part to which the cosmetic composition is applied is not particularly limited, and may be the face, hands, legs, trunk, etc. For example, the skin oil control effect is the facial skin oil control effect.

[0082] The form of the composition is not particularly limited as long as the intended function can be achieved. For example, the composition is a solid, liquid or gel composition.

[0083] The composition can be applied in any suitable manner, for example, for oral and / or topical compositions. Topical application can be topical application to the skin. Due to the transdermal properties of the composition, the composition can be prepared into transdermal products, transdermal cosmetics. The composition can also be prepared as a test kit. The test kit can include additional ingredients, such as auxiliary ingredients, such as buffers, and include instructions for use. In particular, the composition can be formulated into a suitable formulation, such as a liquid formulation. The formulation can include a buffer, such as a D-PBS buffer or a PBS buffer.

[0084] method

[0085] Provided herein is a method for making cells adhere or adhere to a wall, the method comprising contacting the cells with collagen, compositions and / or liquid formulations described herein. The method of the present invention can be performed in vitro to increase the adhesion of cells to a culture container. Alternatively, the method of the present invention can also be performed in vivo.

[0086] Also provided herein is a method of promoting cell migration, the method comprising contacting cells with collagen and / or the composition.The method of the present invention can be performed in vitro or in vivo.

[0087] Also provided herein is a makeup or beauty method, which includes applying the collagen and / or composition described herein to the skin. Application to the skin can be topical application, for example, application to a skin part that needs anti-wrinkle, oil control, repair and / or soothing. The method can also include applying other beauty and / or makeup products to the skin. The types of other beauty and / or makeup products are not particularly limited, and can be other cosmetics with skin anti-wrinkle, oil control, repair and / or soothing effects, such as collagen. These makeup or beauty methods can be skin anti-wrinkle, oil control, repair and / or soothing methods. Since the collagen of the present invention has a good transdermal effect, it can act on the inner layer of the skin percutaneously after application to the skin.

[0088] Also provided herein is a method of administering the collagen or composition described herein to a subject in need thereof. The method can be used to treat or prevent conditions associated with collagen deficiency, or can be used for anti-wrinkle, oil control, repair and / or soothing of the skin in a subject. The administration can be oral administration.

[0089] Also provided herein is a method for reducing the level of inflammatory cytokines in cells, comprising contacting the cells with the collagen, composition and / or liquid formulation described herein. The type of inflammatory cytokine is not particularly limited, but is preferably TNF-α.

[0090] use

[0091] The present invention also provides the use of collagen, nucleic acid, vector and / or host cell in medicine, cosmetic or beauty products or for anti-wrinkle, oil control, repair and / or soothing of skin. These products can be external products, such as external cosmetic products or beauty products. These cosmetic or beauty products can be anti-wrinkle, oil control, repair and / or soothing products. For example, the product can be selected from biological dressings, human bionic materials, plastic surgery materials, organoid culture materials, cardiovascular stent materials, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printing artificial organ biomaterials.

[0092] The present invention also provides the use of the collagen, nucleic acid, vector and / or host cell described herein in the preparation of a drug or a kit for anti-inflammatory or reducing inflammatory cytokines, such as TNF-α.

[0093] Example

[0094] The following examples are provided to illustrate the present invention. Those skilled in the art should understand that the examples are merely illustrative and not limiting. The present invention is limited only by the scope of the appended claims.

[0095] Example 1: Construction and expression of small molecule collagen C3T1

[0096] 1. Construction of genetically engineered Escherichia coli

[0097] The amino acid sequence corresponding to the small molecule collagen C3T1 is: GERGAPGFRGPAGPNGIPGEKGPAGERGAP (SEQ ID NO: 1). The nucleotide sequence corresponding to the amino acid sequence is: GGAGAAAGGGGGGCGCCAGGCTTCCGCGGTCCGGCGGGTCCGAACGG CATCCCGGGTGAGAAGGGTCCGGCTGGCGAACGTGGCGCACCG (SEQ ID NO: 2). The nucleotide sequence of the small molecule collagen C3T1 is cloned into an expression vector, and then the expression vector is transferred into an Escherichia coli expression strain, and the Escherichia coli genetic engineering bacteria are screened.

[0098] Specifically, according to the amino acid sequence of C3T1, the codon gene SEQ ID NO: 2 preferred by Escherichia coli was optimized and selected. The nucleotide sequence of SEQ ID NO: 2 was synthesized. The C3T1 gene fragment was inserted into the pET-32a expression vector (Beijing Shengyuan Kemeng Biotechnology Co., Ltd.) through the restriction sites of Kpn I (NEB Company, Catalog No.: R0136L) and Xho I (NEB Company, Catalog No.: R0146L) to construct the pET-32a-C3T1 expression vector, see Figure 1 , the expression vector was introduced into Escherichia coli BL21 (DE3), and positive Escherichia coli genetic engineering bacteria were screened. The above operations were entrusted to Beijing Shengyuan Kemeng Biotechnology Co., Ltd.

[0099] 2. Fermentation of genetically engineered Escherichia coli

[0100] a. Pick a single colony of genetically engineered E. coli after optimization, place it in 5 ml LB medium and culture it overnight at 35-38℃, the temperature is 37℃. b. Inoculate the bacterial solution at 1:100, culture it at 37℃ for 7 hours, add 0.5mM IPTG for induction, cool it down to 16℃, and culture it overnight; the protein expressed at this time is C3T1, and collect the bacteria by centrifugation. c. Resuspend the collected bacteria with balanced working solution (200mM sodium chloride, 25mM Tris, 20mM imidazole, pH8.0), cool the bacterial solution to ≤15℃, homogenize it, homogenize it twice with high pressure, and collect the bacterial solution after completion. The homogenized bacterial solution is divided into centrifuge bottles, centrifuged at 17000rpm and 4℃ for 30min, collect the supernatant, and take the supernatant and precipitate for electrophoresis detection.

[0101] 3. Purification of small molecule collagen C3T1

[0102] a. Wash the column (Ni6FF, Cytiva) with water for 5 column volumes (CV). b. Equilibrate the column with equilibration solution (200mM sodium chloride, 25mMTris, 20mM imidazole) for 5 CV. c. Load: Add the supernatant after centrifugation to the column until the liquid flows out. d. Wash the impurities: Add 25mL of washing solution (200mM sodium chloride, 25mM Tris, 20mM imidazole) until the liquid flows out. e. Collect the target protein: Add 25mL of elution solution (200mM sodium chloride, 25mM Tris, 250mM imidazole), and collect the flow-through to obtain the target polypeptide Trx-His-C3T1. F. Replace the solution: Use G-25 column (Cytiva) to replace the collected target protein with PBS (300mM sodium chloride, 50mM sodium dihydrogen phosphate, pH7.3). If the target protein with Trx-His tag needs to be removed, an appropriate amount of collagenase can be added and incubated at 16°C for 2 hours to obtain the small molecule collagen C3T1 with Trx-His tag removed. Figure 2 As shown (1: Maker; 2: collected target protein; 3: target protein replaced with PBS; 4: sample after enzyme digestion).

[0103] 4. Mass spectrometry detection of small molecule collagen C3T1

[0104] The theoretical molecular weight of small molecule collagen C3T1 is 2814.07Da, which cannot be detected by conventional SDS-PAGE and needs to be identified by mass spectrometry. TM 1.8 μm dSEC-2, LC Column 150×4.6mm chromatographic column, the enzyme-digested samples were analyzed using LC-MS equipment under the conditions of molecular weight detection mass spectrometry method MS method and liquid chromatography method LC method.

[0105] like Figure 3 As shown, according to the mass spectrometry method, the actual molecular weight of the small molecule collagen C3T1 of the present invention is 2814 Da, which is consistent with the theoretical molecular weight.

[0106] 5. Purity detection of small molecule collagen C3T1

[0107] The test method refers to the general rules of Part IV of the Pharmacopoeia of the People's Republic of China (2020 edition) (0512 High Performance Liquid Chromatography) to analyze the protein test sample by molecular exclusion chromatography, and the results are further calculated by the peak area normalization method to obtain the purity percentage of the main peak.

[0108] Place the test blank and collagen C3T1 into the sample tray for measurement. The experimental parameters are set as follows:

[0109]

[0110] The test results are as follows:

[0111] Table 1

[0112] Chromatographic peak sample Retention time (minutes) Area (μV*sec) %area 1 protein 4.889 5582783 87.70 2 -- 6.030 783115 12.30

[0113] Figure 4 The purity test of the small molecule collagen C3T1 of the present invention is shown. The purity of the small molecule collagen C3T1 is as high as 87.70%.

[0114] Example 2: Detection of cell adhesion activity of small molecule collagen C3T1

[0115] Reference standard for cell adhesion activity detection, Pharmaceutical Industry Standard of the People's Republic of China YYT 1849-2022 Recombinant Collagen

[0116] The specific implementation methods are as follows:

[0117] The sample was dissolved in D-PBS, filtered through a 0.22 μm filter membrane, and diluted to the working concentration for later use; the positive control bovine type I collagen (Hebei Kaolisen Biotechnology Co., Ltd.; product number: CSC113A) was diluted to 1 mg / ml using D-PBS for later use; the negative control was D-PBS buffer.

[0118] Different concentrations (0.5, 1 or 2 mg / mL) of collagen C3T1 and positive and negative controls were added to the ELISA plate, 100 μL per well, 5 replicate wells were set for each group, and incubated at 4°C overnight.

[0119] Add 10 5 Resuspend 3T3 / NIH cells in good culture state in D-PBS and incubate at 37℃ for 120min. Wash each well with D-PBS solution for 3 times.

[0120] The absorbance at OD450 nm was measured using the CCK8 detection kit (Vazyme; Catalog No.: A311-01-AA) according to the product manual. The degree of cell adhesion was calculated according to the following formula: Cell adhesion rate = (test well - blank well) × 100% / (positive well - blank well). The cell adhesion rate can reflect the cell adhesion ability of collagen. The higher the cell adhesion ability, the better the external environment can be provided to the cells in a short time, helping the cells to adhere.

[0121] Results Figure 5 .from Figure 5 It can be seen that the collagen C3T1 in this article has better adhesion activity than bovine type I collagen.

[0122] Example 3: Detection of the cell migration promoting activity of small molecule collagen C3T1

[0123] The culture medium containing 0.4% serum (ECM: 500ml basal medium + 25ml FBS serum + 5ml ECGS endothelial cell growth additive + 5ml P / S penicillin / streptomycin solution) was used as the negative control (NC), EGF was used as the positive control (PC), and collagen C3T1 was used as the test product. The cultured cells were HUVEC cells. Collagen was dissolved in ECM culture medium containing 0.4% serum to the working concentration, filtered and sterilized with a 0.22μm microporous filter membrane, and diluted sequentially by the half-dilution method. The final concentrations of collagen C3T1 in the culture medium were 0.001, 0.002, 0.05, and 0.5mg / mL. EGF was dissolved in ECM culture medium containing 0.4% serum to a final concentration of 10ng / ml, and filtered and sterilized. Digest the cells, centrifuge and discard the culture medium after terminating the digestion, and wash 1-2 times with PBS. Resuspend in serum-free culture medium and adjust the cell density to 1x10 6 / ml. Use a two-chamber system (Nest, cell chamber culture plate). Add 500μl of sample to the lower chamber and 200μl of cell suspension to the upper chamber and culture for 12-48h. Carefully remove the upper chamber with tweezers, dry the liquid and move it to the well to which about 800μl of methanol has been added in advance. Fix it at room temperature for 30 minutes and then wash it twice with PBS. Add 100μl of DAPI to the upper chamber, stain it for 15 minutes, and gently wipe off the unmigrated cells in the upper layer with a cotton swab and wash it three times with PBS. Observe and take pictures under a fluorescence microscope, and count them with image J. The calculation formula is as follows: Relative cell migration rate = experimental group count / average value of negative group count × 100%

[0124] Figure 6 Fluorescence microscopy observation results of different test groups are shown. Figure 7 Relative cell migration rates (%) of the different test groups are shown.

[0125] according to Figure 7 The results showed that the positive control group could promote cell migration compared with the negative control group, and the difference was statistically significant. As the concentration of collagen C3T1 increased, its effect on promoting cell migration gradually increased. Cell migration activity is an indicator of the biological activity of collagen. The higher the migration rate, the higher the biological activity of collagen. By comparing with EGF, collagen C3T1 has higher cell migration activity.

[0126] Example 4: Transdermal absorption test of small molecule collagen C3T1

[0127] The transdermal absorption test of small molecule collagen C3T1 refers to GB / T27818-2011 in vitro experimental method standard for skin absorption of chemicals.

[0128] The specific implementation methods are as follows:

[0129] Quantitative determination steps of transdermal absorption: Add receiving solution (normal saline) to the receiving chamber, and place the matching magnetic stirrer in the receiving chamber. Fix the piglet skin (the test product is placed on the surface of the piglet skin) between the diffusion chamber and the receiving chamber of the Franz cell diffusion cell, add 1ml of receiving solution to the sampling tube, so that the dermis of the piglet skin is in close contact with the receiving solution. Fix the Franz cell diffusion cell in the transdermal absorption diffusion instrument. Turn on the electromagnetic stirrer, stir at 300rpm, and keep the water bath interlayer free of bubbles. After the temperature is constant, draw 400μl of sample to the surface of the piglet skin. Extract 1ml of receiving solution at 2, 4, and 8h, respectively, place it in a 2ml EP tube, add an appropriate amount of normal saline solution to the receiving chamber, and collect the sample at 12h. Treatment of the unpenetrated part on the skin: After the 12h (sample) penetration is completed, wash the surface of the piglet skin with normal saline and fix the volume to 2ml. Treatment of the residual part in the skin: After the 12h (sample) penetration is completed, the suckling pig skin is cut into pieces and placed in an EP tube, and the volume is adjusted to 2ml with physiological saline, and ultrasonicated for 30min. Samples are taken at each time point for quantitative analysis of the content of collagen C3T1 (the test product is placed on the surface of the suckling pig skin) using the Folin phenol method.

[0130] Qualitative determination steps of transdermal absorption: Add receiving solution to the receiving chamber, and place the matching magnetic stirrer in the receiving chamber. Fix the piglet skin between the diffusion chamber and the receiving chamber of the Franz cell diffusion pool, and add 1 ml of receiving solution to the sampling tube to make the dermis of the piglet skin in close contact with the receiving solution. Fix the Franz cell diffusion pool in the transdermal absorption diffusion instrument. Turn on the electromagnetic stirrer, stir at 300 rpm, and keep the water bath interlayer free of bubbles. After the temperature is constant, draw 400 μl of sample collagen C3T1 (fluorescently labeled with FITC (fluorescein isothiocyanate)) onto the surface of the piglet skin. Qualitative analysis: Collect each group of pig skin for frozen sectioning, and take pictures with a fluorescence microscope after DAPI re-staining. Make three parallel groups according to the above method. Cumulative penetration calculation formula: Q = Cn × V + ΣCi × V 0 (i=1···n-1)

[0131] Where: Q: cumulative penetration

[0132] V: Volume of receiving liquid in receiving chamber

[0133] V 0 : The volume of each sample

[0134] Ci: The concentration of the target substance in the receiving solution from the 1st to the n-1th sampling

[0135] Cn: Target concentration measured at the nth sampling point.

[0136] Diffusion percentage calculation formula: P = Q / P 0 ×100%

[0137] Where: P: diffusion percentage

[0138] Q: Cumulative permeation at each time point in the receiving chamber

[0139] P 0 : Initial sample loading in the diffusion chamber

[0140] The results are as follows Figure 8 As shown in . Figure 8 It can be seen that with the extension of time, the permeability of collagen C3T1 gradually increases, reaching as high as 86% in 12 hours. Fig. 9 The results of qualitative analysis fluorescence microscopy are shown. Fig. 9 It can be seen that the 2h sample mainly stayed on the skin surface, and after 4, 8, and 12h, the sample penetrated through the epidermis layer of the skin into the dermis layer.

[0141] In summary, after deducting the blank group from the collagen test group, the 2h sample mainly stayed in the skin; at 4h, the collagen C3T1 permeability was 33%, and the FITC-labeled collagen C3T1 penetrated through the epidermis to the dermis; at 8h, the collagen permeability was 70%, and the FITC-labeled collagen C3T1 penetrated through the epidermis to the dermis; at 12h, the collagen permeability was 86%, and the FITC-labeled collagen C3T1 penetrated through the epidermis to the dermis; this shows that collagen C3T1 is a true small molecule collagen with a higher permeability, which can directly reach the dermis and play a role in directly supplementing collagen.

[0142] Example 5: Cytotoxicity test of small molecule collagen C3T1

[0143] Human fibroblasts (purchased from Guangdong Boxi Biotechnology Co., Ltd.) were cultured at 1×10 4 The inoculation density was 1000 cells / well and the plates were inoculated into 96-well plates in an incubator (37°C, 5% CO 2) and incubate overnight. Samples were given when the cell plating rate in the 96-well plate reached 40%-60%. The zeroing group was a cell-free inoculation, with only 200 μL of FbGrowth culture solution (supplier: Boxi Bio and item number: PY3091) added to each well; the solvent control group was a well inoculated with cells and 200 μL of FbGrowth culture solution was added to each well, the positive control group was a well inoculated with cells and 200 μL of FbGrowth culture solution containing 10% DMSO (manufacturer: MACKLIN item number: D806645) was added to each well, and the sample group was a well inoculated with cells and 200 μL of FbGrowth culture solution containing the corresponding concentration of collagen C3T1 was added to each well. After the sampling was completed, the 96-well plate was placed in an incubator (37°C, 5% CO2) for incubation.

[0144] Detection: After the cells were incubated for 24 hours, the supernatant was discarded, and MTT working solution (supplier: Yuanyehe product number: S19063) (0.5 mg / mL) was added. The cells were incubated at 37°C in the dark for 4 hours, the supernatant was discarded, 150 μL DMSO was added to each well, the OD value was read at 490 nm, and the relative cell viability was calculated according to the formula: Relative cell viability (%) = (sample well OD-zero well OD) ÷ (solvent control well OD-zero well OD) × 100%. Table 2 shows the cytotoxicity results.

[0145] Table 2: Cytotoxicity results

[0146]

[0147] As can be seen from Table 2, collagen C3T1 has less toxicity to cells in the set concentration gradient, and the experimental results are credible.

[0148] Example 6: In vitro anti-wrinkle efficacy determination of small molecule collagen C3T1

[0149] Collagen is the most important component of the extracellular matrix. It can make the skin firmer and more elastic. When collagen is reduced, obvious wrinkles will appear. Human dermal fibroblasts can synthesize type I procollagen in the body and secrete it outside the cells, where they aggregate to form collagen fibers. Therefore, human dermal fibroblasts can be used as a cell model to study whether cosmetics can promote the synthesis of type I collagen, and to evaluate whether the test substance has the effect of promoting collagen synthesis, thereby evaluating the anti-wrinkle effect of cosmetics.

[0150] In order to determine the anti-wrinkle effect of collagen in vitro, the ability of fibroblasts to synthesize type I collagen in vitro was used to illustrate its anti-wrinkle effect.

[0151] The specific implementation is as follows:

[0152] Cell culture:

[0153] Human fibroblasts in the logarithmic growth phase were collected and seeded into 96-well plates at a cell density of 1×10 4 cells / well and cultured in an incubator at 37°C and 5% CO 2 for 24 h. When the cell confluence in the 96-well plates reached 40%-60%, the samples were added. The blank control group was added with FbGrowth culture medium in the wells seeded with cells. The positive control group was added with TGFβ1 (Supplier: Absin, Catalog No. ABS04204) (Weighed 10 μg of TGFβ1 and dissolved it in 200 μl of 10 mM citric acid solution as the stock solution; Absorbed 2 μl of the TGFβ1 stock solution and dissolved it in 998 μl of FbGrowth culture medium as the positive control working solution) in the wells seeded with cells. The sample group was added with FbGrowth culture medium containing different concentrations of collagen C3T1 in the wells seeded with cells. After adding the samples, the 96-well plates were placed in an incubator (37°C, 5% CO2) and cultured for 24 h.

[0154] After the culture, the cells were collected in EP tubes, and type I collagen was detected using a type I collagen ELISA kit (Supplier: ELK Biotechnology, Catalog No. ELK2377. For detailed operation, refer to the kit instruction manual).

[0155] Detection results: As can be seen from Fig.10 when the sample concentration was 25%-100% (concentration was 0.075-0.3 μg / ml), the protein content of type I collagen could be significantly up-regulated (p < 0.05), indicating the ability to promote the synthesis of type I collagen, suggesting that the collagen C3T1 sample has an obvious anti-wrinkle effect.

[0156] Example 7: In vitro facial oil control effect of small molecule collagen C3T1

[0157] Cell culture: KC human epidermal cells (purchased from Guangdong Boxi Biotechnology Co., Ltd.) in the logarithmic growth phase were collected and seeded into 96-well plates at a cell density of 1×10 4 cells / well and cultured in an incubator at 37°C and 5% CO 2KC human epidermal cells were cultured in an incubator for 24 hours, and the drug was administered when the cell plating rate in the 96-well plate reached 40%-60%. The blank control group was KcGrowth culture solution (supplier: Boxi Biology and item number: PY3011) added to the wells inoculated with cells, the negative control group was KcGrowth culture solution with 0.2% SLS (supplier: Solarbio and item number: S8100) added to the wells inoculated with cells, the positive control group was KcGrowth culture solution with 0.2% SLS and WY14643 (supplier: Biyuntian and item number: SD7189-25mg) added to the wells inoculated with cells, and the sample group was KcGrowth culture solution with 0.2% SLS and various concentrations of collagen C3T1 added to the wells inoculated with cells. After the administration was completed, the 96-well plate was placed in an incubator (37°C, 5% CO2) and cultured for 24 hours.

[0158] Detection: After the culture was completed, the cells were collected in EP tubes, the supernatant was taken, and human filaggrin was detected using a human filaggrin ELISA kit (supplier: ELK Biotechnology and catalog number ELK3513, for detailed operations, refer to the kit instructions).

[0159] The experimental results are shown in Fig.11 When the test sample concentration was between 25% and 100% (concentration was 0.075-0.3 μg / ml), it could promote the increase of the expression of filaggrin (FLG) in human keratinocytes in a dose-dependent manner, which was significantly different from the negative control (P<0.05); the test sample collagen C3T1 had an oil-control effect.

[0160] Example 8: In vitro repair efficacy test of small molecule collagen C3T1

[0161] Cell culture: KC human epidermal cells in the logarithmic growth phase (purchased from Guangdong Boxi Biotechnology Co., Ltd.) were collected and cultured at a cell density of 1×10 4 Inoculate 1000 cells / well into a 96-well plate and incubate at 37°C with 5% CO 2 KC human epidermal cells were cultured in an incubator for 24 hours. Samples were given when the cell plating rate in the 96-well plate reached 40%-60%. The blank control group was KcGrowth culture medium in the wells inoculated with cells, the negative control group was KcGrowth culture medium with 0.2% SLS added to the wells inoculated with cells, the positive control group was KcGrowth culture medium with 0.2% SLS and WY14643 added to the wells inoculated with cells, and the sample group was KcGrowth culture medium with 0.2% SLS and various concentrations of collagen C3T1 added to the wells inoculated with cells. After the sample was given, the 96-well plate was placed in an incubator (37°C, 5% CO2) and cultured for 24 hours.

[0162] Detection: After the culture was completed, the cells were collected in EP tubes, and the supernatant was taken for TGM1 detection. Human TGM1 was detected using a human TGM1 ELISA kit (supplier: ELK Biotechnology and catalog number ELK2193, for detailed operations, see the kit instructions).

[0163] The experimental results are shown in Fig.12 When the test sample concentration is between 25% and 100% (concentration is 0.075-0.3 μg / ml), it can promote the increase of TGM1 expression in human keratinocytes in a dose-dependent manner; the test sample collagen C3T1 has a repair effect.

[0164] Example 9: In vitro soothing efficacy test of small molecule collagen C3T1

[0165] Cell culture: Mouse macrophages RAW264.7 (purchased from Guangdong Boxi Biotechnology Co., Ltd.) in the logarithmic growth phase were collected and cultured at a cell density of 1×10 4 Inoculate 1000 cells / well into a 96-well plate and incubate at 37°C with 5% CO 2 Mouse macrophage RAW264.7 was cultured in an incubator for 24 hours, and samples were added when the cell plating rate in the 96-well plate reached 40%-60%. The blank control group was cell culture medium (high-glucose DMEM culture medium (10% fetal bovine serum)) (supplier: Biosharp, item number: BL301A), 200 μL per well, the negative control group was cell culture medium containing LPS (1 μg / ml) (manufacturer: absin, item number: ABS47014848), 200 μL per well, the positive control group was culture medium containing positive control (10 mg dexamethasone (manufacturer Solarbio, item number: D8040) dissolved in 1 mL DMSO solution, dexamethasone stock solution, concentration 10 mg / mL; the dexamethasone stock solution was diluted 1:100 with high-glucose DMEM culture medium containing LPS to 100 μg / mL as the positive control working solution) and LPS, 200 μL per well, and the sample group was culture medium containing a certain concentration of collagen C3T1 and LPS, 200 μL per well. After the sampling was completed, the 96-well plate was placed in an incubator (37° C., 5% CO 2 ) for 24 h.

[0166] Detection: After the culture is completed, the cell culture medium is collected, and the supernatant is collected by centrifugation for TNF-α detection. For specific steps, please refer to the instructions of the TNF-α inflammatory factor ELISA kit (supplier: ELK Biotechnology and catalog number: ELK1190).

[0167] The experimental results are shown in Fig.13When the concentration of collagen C3T1 was between 25% and 100% (concentration was 0.075-0.3 μg / ml), the TNF-α content of each group decreased compared with the negative control, and there was a significant difference (P<0.05), which had the effect of inhibiting TNF-α content and had a soothing or anti-inflammatory effect.

[0168] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of collagen with the amino acid sequence of SEQ ID NO: 1 in preparing a transdermally absorbable composition for skin anti-wrinkle, skin oil control, skin repair, skin soothing and / or anti-inflammatory.

2. The use according to claim 1, wherein the collagen is in the form of a trimer.

3. The use according to claim 1, wherein the composition is a topically administrable composition.

4. The use according to claim 1, wherein the composition is a pharmaceutical composition.

5. The use according to claim 4, wherein the composition comprises a pharmaceutically acceptable carrier.

6. The use according to claim 1, wherein the composition is a cosmetic composition.

7. The use according to claim 6, wherein the composition comprises a cosmetically acceptable carrier.

8. The use according to claim 6 or 7, wherein the composition is a composition for facial application.

9. The use according to claim 1, wherein the composition is a solid, liquid or gel composition.

10. The use according to claim 9, wherein the composition is in the form of a solution, a lyophilized powder, a gel, a sponge or a fiber.

11. The use according to claim 1, wherein the composition is a liquid formulation comprising the collagen of SEQ ID NO: 1 and a cosmetically acceptable carrier.

12. The use according to claim 11, wherein the carrier is a buffer.

13. The use according to claim 12, wherein the carrier is D-PBS buffer or PBS buffer. The use according to claim 1 , wherein the composition is used to reduce the content of inflammatory cytokine TNF-α.

Images