A lncRNA biomarker for non-small cell lung cancer and its application

Abstract

The present invention belongs to the field of biomedicine technology, and specifically relates to a non-small cell lung cancer lncRNA biomarker and its application. The marker is lncRNA RP11-242D8.1, and the nucleotide sequence of its cDNA is shown in SEQ ID NO.1. The research results of the present invention show that lncRNA RP11-242D8.1 is downregulated in non-small cell lung cancer, and low expression of lncRNA RP11-242D8.1 is associated with a shorter overall survival of patients, indicating that lncRNA RP11-242D8.1 may be a potential biomarker for poor prognosis in patients with non-small cell lung cancer. The present invention uses lncRNA RP11-242D8.1 as a molecular intervention target, and the results show that after reducing the expression of lncRNA RP11-242D8.1, the effect of metformin on promoting H1299 cell apoptosis and inhibiting the expression of inflammatory factors in H1299 cells can be weakened, and finally the resistance of H1299 cells to metformin is enhanced.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a lncRNA biomarker for non-small cell lung cancer and its application. Background Art

[0002] Lung cancer is the cancer with the highest age-standardized incidence rate (ASIR) and age-standardized mortality rate (ASMR) in the world, and it is also the malignant tumor with the most new cases and deaths in my country. According to GLOBO-CAN2020 data, there were about 2.2 million new cases of lung cancer in the world in 2020, ranking second among all cancers, accounting for about 11.4%; there were about 1.8 million deaths from lung cancer, ranking first among all cancers, accounting for about 18%. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, accounting for about 85% of lung cancer patients. Compared with small cell carcinoma, NSCLC has a slow proliferation and division process and late tumor spread and metastasis. Therefore, most NSCLC patients lack specific clinical manifestations in the early stage, miss the best time for treatment, and have a five-year survival rate of less than 20%. Radiotherapy and chemotherapy are the main treatment methods for advanced NSCLC, but serious adverse reactions such as cardiotoxicity, immune suppression, liver and kidney damage, etc., significantly reduce the quality of life of patients. Therefore, it is particularly important to explore new treatment approaches for lung cancer and improve patient prognosis.

[0003] Long noncoding RNAs (lncRNAs) are a class of noncoding RNAs with transcripts of more than 200 nucleotides. They are transcribed by RNA polymerase II but not translated into proteins. They play an important role in epigenetic, transcriptional, and post-transcriptional regulation biological processes. lncRNAs are widely involved in regulating a variety of biological processes such as tumor cell proliferation, apoptosis, invasion, and drug resistance. In addition, lncRNAs are also of great significance in clinical practice and can be used as biomarkers for diagnosis and treatment. Therefore, it is an urgent clinical need to clarify the role of lncRNA in non-small cell lung cancer and screen lncRNAs with diagnostic potential and prognostic value. At present, there are no markers for predicting the prognosis of non-small cell lung cancer. Summary of the invention

[0004] In order to solve the problem that there is no marker for predicting the prognosis of non-small cell lung cancer in the prior art, and to achieve the above-mentioned purpose, the present invention adopts the following technical solution:

[0005] The present invention provides a lncRNA biomarker for non-small cell lung cancer, wherein the marker is lncRNA RP11-242D8.1, and the nucleotide sequence of its cDNA is shown in SEQ ID NO.1.

[0006] Preferably, the fluorescent quantitative PCR primers for the biomarker include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0007] The present invention also provides the use of the non-small cell lung cancer lncRNA biomarker in preparing a kit for early screening and auxiliary diagnosis of lung cancer, wherein the kit comprises the non-small cell lung cancer lncRNA biomarker and a detection reagent.

[0008] Preferably, the detection reagents include multiple ones of RNA extraction reagents, reverse transcription reagents, real-time fluorescence quantitative PCR reagents, lncRNA primers, and GAPDH primers.

[0009] Preferably, the lncRNA primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0010] Preferably, the GAPDH primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.16, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.17.

[0011] The present invention also provides the use of the non-small cell lung cancer lncRNA biomarker in the preparation of a drug for screening and / or treating non-small cell lung cancer tumors.

[0012] Preferably, the drug comprises the expression inhibitor of the lncRNA RP11-242D8.1.

[0013] Preferably, the expression inhibitor comprises any one or more of si-lncRNARP11-242D8.1-1744, si-lncRNA RP11-242D8.1-1358, and si-lncRNA RP11-242D8.1-75; the sense chain sequence of the si-lncRNARP11-242D8.1-1744 is shown in SEQ ID NO.4, and the antisense chain sequence is shown in SEQ ID NO.5; the sense chain sequence of the si-lncRNA RP11-242D8.1-1358 is shown in SEQ ID NO.6, and the antisense chain sequence is shown in SEQ ID NO.7; the sense chain sequence of the si-lncRNARP11-242D8.1-75 is shown in SEQ ID NO.8, and the antisense chain sequence is shown in SEQ ID NO.9.

[0014] Preferably, the drug contains the expression inhibitor of lncRNA RP11-242D8.1 as an active ingredient, and is supplemented with a pharmaceutically acceptable excipient or carrier.

[0015] The above-mentioned lncRNA RP11-242D8.1 expression inhibitor of the present invention can be prepared into oral dosage forms, such as tablets, powders, pills, solutions, capsules and granules, among which solutions, capsules and granules are preferred.

[0016] The above-mentioned lncRNA RP11-242D8.1 expression inhibitor of the present invention is prepared with different excipients or carriers according to different dosage forms, and processed into dosage forms that can be used by animals through the preparation process of the corresponding dosage form. The corresponding excipients for the solution include any one or more of micropowder silica gel and distilled water; the corresponding excipients for the capsule include any one or more of starch, sodium hydroxymethyl cellulose, and methyl cellulose; the corresponding excipients for the granule include any one or more of sodium bicarbonate, citric acid, starch, sodium hydroxymethyl cellulose, and methyl cellulose. The carrier includes any one of microspheres, nanoparticles, and liposomes.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a non-small cell lung cancer lncRNA biomarker and application, which is used to solve the problem of the blank of Inc RNA in the treatment of non-small cell lung cancer. The biomarker provided by the present invention is a long non-coding RNA RP11-242D8.1 (also known as AC060780.1), and the nucleotide sequence of its cDNA is shown in SEQ ID NO.1. The research results of the present invention show that lncRNA RP11-242D8.1 is downregulated in non-small cell lung cancer, and low expression of lncRNA RP11-242D8.1 is associated with a shorter overall survival of patients, indicating that lncRNA RP11-242D8.1 may be a potential biomarker for poor prognosis in patients with non-small cell lung cancer. The present invention uses lncRNA RP11-242D8.1 as a molecular intervention target. The results show that reducing the expression of lncRNA RP11-242D8.1 can weaken the effects of metformin in promoting H1299 cell apoptosis and inhibiting the expression of inflammatory factors in H1299 cells, and ultimately enhance the resistance of H1299 cells to metformin. The specific research and its results are as follows:

[0019] 1. The present invention uses lncRNA RP11-242D8.1 as a molecular research target to determine the overall survival of patients with non-small cell lung cancer. Compared with the adjacent normal lung group, the expression of lncRNA RP11-242D8.1 in the tumor group was significantly downregulated, and its low expression was associated with a lower overall survival.

[0020] 2. The present invention detected the expression of lncRNA RP11-242D8.1 in H1299 cells after metformin intervention and found that metformin may exert anti-tumor effects by increasing the expression of lncRNA RP11-242D8.1, which is helpful to evaluate the prognosis of patients with non-small cell lung cancer.

[0021] 3. After the interference fragment of lncRNARP11-242D8.1 was transferred into H1299 cells, the expression level of lncRNA RP11-242D8.1 was significantly inhibited. Immunofluorescence and ELISA results showed that after lncRNA RP11-242D8.1 was downregulated, the inhibitory effect of metformin on multiple inflammatory factors of H1299 cells was significantly weakened, and flow cytometry and immunofluorescence results showed that lncRNARP11-242D8.1 downregulation enhanced the resistance of H1299 cells to metformin-induced apoptosis, promoted Bcl-2 protein expression and inhibited Bax protein expression.

[0022] 4. The lncRNA RP11-242D8.1 of the present invention is a target of metformin in inhibiting non-small cell lung cancer. It can regulate the expression of inflammatory factors and apoptosis response of H1299 cells by metformin, which is helpful to discover new intervention targets for the treatment of non-small cell lung cancer and in-depth understanding of tumor resistance mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The expression difference of lncRNA RP11-242D8.1 in non-small cell lung cancer tissue and normal lung tissue and its relationship with overall survival in the present invention; wherein, Figure 1 A is a diagram showing the expression of lncRNA RP11-242D8.1 in non-small cell lung cancer and normal lung tissues detected by bioinformatics; N is normal lung tissue; T is non-small cell lung cancer tissue; Figure 1 B is a diagram showing the expression of lncRNA RP11-242D8.1 in non-small cell lung cancer and normal lung tissues detected by fluorescence quantitative PCR. Normal is normal lung tissue, and Tumor is non-small cell lung cancer tissue. Figure 1 C is a diagram showing the expression of lncRNA RP11-242D8.1 in H1299 cells and human bronchial normal epithelial cells BEAS-2B detected by fluorescence quantitative PCR; Figure 1 D is the relationship between the expression levels of lncRNA RP11-242D8.1 and the overall survival of patients with non-small cell lung cancer detected by bioinformatics; Figure 1 E is the analysis of the diagnostic efficacy of lncRNA RP11-242D8.1 for non-small cell lung cancer through the TCGA database.

[0024] Figure 2 The inhibitory effect of metformin on H1299 cells in the present invention; wherein, Figure 2 A is the inhibitory effect of different concentrations of metformin on H1299 cells at different action times; Figure 2 B is the inhibitory effect of different concentrations of metformin on H1299 cells after 48 hours of action; Figure 2 C is the effect of 15 mmol / L metformin intervention on the expression of lncRNA RP11-242D8.1 in H1299 cells after 48 hours of intervention.

[0025] Figure 3 This is the inhibitory effect of different interference fragments in the present invention on lncRNA RP11-242D8.1.

[0026] Figure 4 The present invention relates to the role of lncRNA RP11-242D8.1 in the inhibition of H1299 cell inflammatory factor expression by metformin; wherein, Figure 4 A is the regulation of metformin on the expression of IL-1β, IL-6 and TNF-α mRNA in H1299 cells after treatment with si-lncRNA RP11-242D8.1, detected by fluorescence quantitative PCR; Figure 4 B: After treatment with si-lncRNA RP11-242D8.1, ELISA was used to detect the regulation of metformin on the secretion of IL-1β, IL-6 and TNF-α proteins in H1299 cells.

[0027] Figure 5 The present invention relates to the role of lncRNA RP11-242D8.1 in the apoptosis response of H1299 promoted by metformin; wherein, Figure 5 A is a flow cytometric graph of the effect of metformin on apoptosis of H1299 cells after treatment with si-lncRNA RP11-242D8.1. Figure 5 B is a statistical graph showing the effect of metformin on apoptosis of H1299 cells after treatment with si-lncRNA RP11-242D8.1, using flow cytometry to detect the effect; Figure 5 C is a fluorescence image of the effect of metformin on the expression of Bcl-2 and Bax proteins in H1299 cells after treatment with si-lncRNA RP11-242D8.1, detected by immunofluorescence; Figure 5 D is the statistical analysis of the effect of metformin on Bcl-2 and Bax protein expression in H1299 cells after treatment with si-lncRNA RP11-242D8.1 using immunofluorescence. DETAILED DESCRIPTION

[0028] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0029] Example 1 lncRNA RP11-242D8.1 as a biomarker for non-small cell lung cancer

[0030] 1. Experimental subjects:

[0031] Lung cancer tissues and adjacent normal lung tissues were collected from 10 patients who underwent surgical resection in the Department of General Thoracic Surgery, General Hospital of Ningxia Medical University from 2021 to 2022. The adjacent normal lung tissues were located within 3 cm of the cancer.

[0032] Inclusion criteria: (1) patients diagnosed with non-small cell lung cancer; (2) patients who had not received intervention measures such as radiotherapy and chemotherapy.

[0033] Exclusion criteria: (1) patients with a history of other tumors; (2) patients whose clinical data, laboratory data, and plasma specimens were unqualified.

[0034] The patients and their families signed informed consent forms, and this study was approved by the Ethics Committee of Ningxia Medical University with approval number: KYLL-2021-965.

[0035] 2. Instruments, materials and reagents

[0036] 2.1 Main instruments:

[0037] Laser confocal microscope: ZEISS; fluorescence quantitative PCR instrument: Analytik JenaAG; microplate reader: Bio-TEK; clean bench: Antai; 5415D microcentrifuge: Eppendorf; BS110S precision balance: Sartorius; flow cytometer: Agilent NovoCyte flow cytometer.

[0038] 2.2 Main reagents:

[0039] H1299 cells and BEAS-2B cells: (Punosai); total RNA extraction kit: Axygen; reverse transcription and fluorescence quantitative PCR kit: TaKaRa; Bcl-2 antibody, Bax antibody and TNF-α antibody: Abcam; β-actin antibody and IL-1β antibody: Biosun; Alexflour488, cy3-labeled goat anti-rabbit secondary antibody and metformin: Biotech; IL-1β, IL-6 and TNF-α ELISA kits: enzyme-immunoassay; primers synthesized by Shanghai Biotechnology Co., Ltd.; lncRNA RP11-242D8.1 interference fragment and overexpression plasmid: Genema; RNA extraction reagent (AP-MN-MS-RNA-50 reagent); Axygen; reverse transcription reagents and real-time fluorescence quantitative PCR reagents (RR820A and RR037A): Takara.

[0040] 3. Methods

[0041] 3.1 Bioinformatics analysis of lncRNA RP11-242D8.1 expression differences

[0042] The gene expression profile interactive analysis (GEPIA) database (http: / / gepia2.cancer-pku.cn) was used to analyze the expression difference of lncRNA RP11-242D8.1 in non-small cell lung cancer tissues and normal lung tissues. The starbase (ENCORI) database (https: / / rnasysu.com / encori / index.php) was used to analyze the relationship between different lncRNA RP11-242D8.1 expression levels and overall survival (OS) of patients with non-small cell lung cancer. The gene expression data of patients with non-small cell lung cancer were downloaded from the TCGA database to analyze the diagnostic efficacy of lncRNA RP11-242D8.1 for non-small cell lung cancer.

[0043] The nucleotide sequence of the cDNA of lncRNA RP11-242D8.1 is shown in SEQ ID NO.1:

[0044] gcccttcctc tgactgtgtc ttgatttcct attctgagag gctattgctc agcggtttcc

[0045] gtggcaacag taaagcgtgg gaattacagataaattaaaa ctgtggaacc cctttcctcg

[0046] gctgccgcca aggtgttcgg tccttccgag gaagctaagg ccgcgttggg gtgagaccct

[0047] cacttcatcc gctctaaaac cagctccatc acttgaaatg gcaaaataa tcatgaatga

[0048] ggccggggggc tgtggctcac acctgtaatc ccagcactct ggggggccga ggcaggcaga

[0049] tcacgaggtc aggagatcga gaccatcctg gctaacatgg tgtaagggag gagaccaccc

[0050] ctcatattgt cttatgccca atttctgcct ccaagaaag aaaaaagtaaa aactaaaggg

[0051] cagaatgac atccacaagc agacacccca ggtgccacac cctgggcctg gtagttaaaa

[0052] atcaacccct gacctgattg gtatgttatc fathers agacattgta tagaaaagca

[0053] ctgtgacaat gccttttcctg ttttgttccg atctagttac tggtgcatgc agccccgt

[0054] cacgtacccc ctgcttgctc aattgatcac gaccctctca cgtgcacccc cttaggttg

[0055] tgagccctta aaagggacag gaattgctca ctcggggagc ttggctcttg agaccggagt

[0056] cttgccgatg cccctggcct aataaacccc ttccttcttt aactcggtgt ctgataagtt

[0057] ttgtctgcag ctcgatttct tggttccctg actgggaagc gaggtgaatg gcggatggtc

[0058] aaggcagctc cttaggcggc ttaaacctgc cctgtggaac atccctgcag gggactccaa

[0059] ccagcccgag caacacggat cctgagggcg ctcctggtta ggcatttgcc ccactgggac

[0060] gcctcgccag agcactgtat ggcaggcccc catggaggat caacgcagtg gctgaacacc

[0061] gggaaggaac gggcacttgg agtctggaca tctaaaactt ggcagaggac cctgcggcct

[0062] tccgcagtgt ttgtgtccct gggtacttga gattagggag tggtgatgac tcttaacgag

[0063] catgctgcct tcaagtatct gtgatgtgag gagcgcctct gcccggccgc gaccccgtct

[0064] gggaggtgag gagcatctct gcccggccgc cccgtctgag aagtgaggag accctctacc

[0065] tggcaaccgc cccgtctgag aagtgaggag cccctccgcc tggcagccac cccgtctggg

[0066] aagtgaggag cgtctcagcc cggcagccac cccgtccggg agggagagtc attcttatag

[0067] aagagcatca gaggaagata aaaaagaatc ctcaatgtca ggcccctgag cccaagctaa

[0068] gccatcataa ccctgtgacc tgcacatata catccagatg gcctgaagca actgaagaac

[0069] cataaacgtg aaatagccag ttcctgcctt aactgatgac attccaccat tgtgatttgt

[0070] tcctgctcca ccctaactga tcaattgatc ttgtgacatt ccttctcctg gacaatgagt

[0071] ctcaggagct cctcaccaag caccttgtta cccccacccc tgcccacaag agaaaacgca

[0072] cgttaactgt aatttttcca ctacctaccc aaatcctata aaactgcccc accccatctc

[0073] cttttgctga ctccaggtga ttaaaaaact attgctcaca ca

[0074] 3.2CCK8 detection of cell proliferation activity

[0075] 2×10 3 H1299 cells were inoculated in 96-well plates, and each group of experimental wells was repeated 3 times. 0, 1, 5, 10, 20, 40, and 80 mmol / L metformin were used for treatment. After culturing for 24, 48, and 72 hours, 20 μl CCK8 solution was added to each well and incubated for 1.5 hours. The absorbance value (OD value) at a wavelength of 450 nm was detected by an ELISA reader, and the proliferation activity of H1299 cells at each concentration was calculated, and the IC50 value of metformin was calculated. Among them, CCK8 (Cell Counting Kit-8) is a cell counting reagent purchased from abmole.

[0076] 3.3 Real-time fluorescence quantitative PCR detection of mRNA expression levels of lncRNA RP11-242D8.1, IL-1β, IL-6 and TNF-α

[0077] (1) NSCLC (non-small cell lung cancer) tissues and adjacent normal lung tissues were divided into three groups: metformin group, metformin-NC group, and metformin + lncRNA RP11-242D8.1 interference group. RNA was extracted using Axygen's AP-MN-MS-RNA-50 kit. The metformin group was treated with 15mmol / LMet for 48 hours; the metformin-NC group was treated with 15mmol / LMet + NC-siRNA for 48 hours after transfection with lncRNA-NC interference fragment; the metformin + lncRNA RP11-242D8.1 interference group was treated with 15mmol / LMet + lncRNA RP11-242D8.1 siRNA for 48 hours after transfection with lncRNA interference fragment.

[0078] The specific steps for RNA extraction are as follows:

[0079] a Take 500 mg of tissue, transfer it to a pre-cooled mortar, and grind it into powder with liquid nitrogen.

[0080] b. Add 400 μl Buffer R-Ⅰ, aspirate repeatedly 9 times using a syringe equipped with a 23-gauge needle, and transfer to a 1.5 mL centrifuge tube.

[0081] c. Add 150 μl of Buffer R-Ⅱ, vortex for 25 seconds, and centrifuge at 12,000 × g for 5 minutes at 4°C.

[0082] d. Take the supernatant to a 1.5 mL centrifuge tube, add 250 μl of isopropanol, and mix well.

[0083] e. Place the preparation tube in a 2 mL centrifuge tube (provided in the kit), transfer the mixed solution in step d to the preparation tube, and centrifuge at 6,000 × g for 1 min. Centrifuge at 4°C.

[0084] f. Discard the filtrate, place the preparation tube back into a 2 mL centrifuge tube, add 500 μl Buffer W1A into the preparation tube, and centrifuge at 12,000 × g for 1 min.

[0085] Discard the filtrate, place the preparation tube back into a 2 mL centrifuge tube, add 700 μl Buffer W2 into the preparation tube, and centrifuge at 12,000×g for 1 min; wash once more with 700 μl Buffer W2 in the same way.

[0086] hDiscard the filtrate, place the preparation tube back into a 2 mL centrifuge tube, and centrifuge at 12,000 × g for 1 min.

[0087] l Place the preparation tube into a clean 1.5 mL centrifuge tube and add 85 μl of Buffer TE or RNase-free water to the center of the preparation tube membrane. The 1.5 mL centrifuge tube is provided in the kit.

[0088] m was allowed to stand at room temperature for 1 min, and then centrifuged at 12,000×g for 1 min to elute the RNA.

[0089] The extracted RNA was measured for concentration using a micro-spectrophotometer, and the RNA was reverse transcribed into cDNA. The specific steps of reverse transcription were: prepare the reaction solution according to the 20μl system (5X PrimeScript Buffer (for Real Time) 4μl; PrimeScript RT Enzyme Mix I 1μl, Oligo dT Primer (50μM) 1μl, Random 6mers (100μM) 1μl, Total RNA (1μg), add enzyme-free water to 13μl), vortex and mix, reverse transcription conditions: 37℃15min, 85℃5sec, 4℃ storage, and the reverse transcribed cDNA was detected by real-time fluorescence quantitative PCR.

[0090] Among them, the specific steps of real-time fluorescence quantitative PCR detection are as follows: prepare the reaction solution according to the 20 μl system (TB Green Premix Ex Taq II (Tli RNaseH Plus) (2X) 10 μl, PCR Forward Primer (10 μM) 0.8 μl, PCR Reverse Primer (10 μM) 0.8 μl, DNA template 2 μl, enzyme-free water 6.4 μl), the primer sequence is shown in Table 1, vortex to mix, and the expansion conditions are detailed in Table 2 lncRNA RP11-242D8.1 expression level.

[0091] (2) The metformin group, metformin + interference control group, and metformin + lncRNA RP11-242D8.1 interference group were collected to extract RNA, which was reverse transcribed into cDNA and then subjected to real-time fluorescence quantitative PCR to detect the mRNA expression levels of lncRNA RP11-242D8.1, IL-β, IL-6, and TNF-α.

[0092] GAPDH was used as an internal reference and analyzed according to the formula 2-ΔΔCt = [Ct (target gene) (test sample) - Ct (GAPDH) (test sample)] - [Ct (target gene) (calibration sample) Ct (GAPDH) (calibration sample)]. The gene primer sequences in the real-time fluorescence quantitative PCR detection are shown in Table 1, and the amplification conditions are shown in Table 2.

[0093] Table 1 Real-time fluorescence quantitative PCR primer sequences

[0094]

[0095] Table 2 Real-time fluorescence quantitative PCR amplification conditions

[0096] Gene name Pre-denaturation transsexual Annealing and extension LncRNA RP11-242D8.1 95℃30s 95℃5s 59.8℃34s IL-1β 95℃30s 95℃5s 56.6℃34s IL-6 95℃30s 95℃5s 53.6℃34s TNF-α 95℃30s 95℃5s 56.6℃34s GAPDH 95℃30s 95℃5s 55.6℃34s

[0097] Table 3 lncRNA RP11-242D8.1 interference fragment sequence

[0098]

[0099] 3.4 Flow cytometry detection of cell apoptosis

[0100] 1×10 6 / mL H1299 cells were seeded into T25 culture flasks, and intervention was performed when the cells were fused to 70%: 15mmol / LMet drug action and transfection of lncRNARP11-242D8.1 interference fragment. After 48 hours of intervention, the culture medium was discarded, washed twice with PBS, and the H1299 cells were digested with trypsin without EDTA (disodium ethylenediaminetetraacetic acid) and phenol red and transferred to a 1.5mL centrifuge tube. Centrifuged at 1000r / min and 4℃ for 5min, the supernatant was discarded, and the above steps were repeated twice. In the dark, 500μL 1×Binding buffer was added to each tube to resuspend the cells, and then 5μL 7-AAD and 5μL AnnexinV-PE were added in sequence. After gently shaking and mixing, it was kept in the dark for 15min, and then gently shaken and mixed, filtered with a 200-mesh filter membrane, and immediately detected by flow cytometry. Among them, the sequence of the lncRNARP11-242D8.1 interference fragment is shown in Table 3. Among them, T25 culture flasks were purchased from Beaver Nano; T25 culture flasks contained RPMI-1640 medium + 10% serum + 1% double antibody; RPMI-1640 medium and 10% serum were purchased from Gibco; 1% double antibody was purchased from Solebao. 7-AAD (7-aminoactinomycin) was purchased from MultiSciences. AnnexinV-PE (Ca-dependent phospholipid binding protein V-phycoerythrin) was purchased from MultiSciences.

[0101] 3.5ELISA detection of IL-1β, IL-6, and TNF-α secretion in culture medium supernatant

[0102] H1299 cells in the logarithmic growth phase were collected and prepared with complete culture medium to a cell density of 1×10 6 / mL single cell suspension, fully mixed and inoculated into 25T culture bottles with 3mL per bottle, and placed in an incubator for routine culture: 37℃, 5% carbon dioxide. After group intervention, the cell culture supernatants of the metformin group, metformin-NC group and metformin-si-lncRNA RP11-242D8.1 group were collected respectively, and the secretion of IL-1β, IL-6 and TNF-α in the culture supernatant was detected by enzyme-linked immunosorbent assay (ELISA). Among them, the formula of complete culture medium is: RPMI-1640 culture medium + 10% serum + 1% double antibody. 25T culture bottles were purchased from Beaver Nano Company. Human interleukin 1β (IL-1β), human interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α) enzyme-linked immunosorbent assay kits were purchased from Jiangsu Enzyme Immunity Company, and the experimental steps were the same as the kit instructions.

[0103] 3.6 Immunofluorescence detection of Bax and Bcl-2 expression

[0104] After group intervention, the cells were washed with pre-cooled PBS for 3 times, 5 min each time, permeabilized with 0.2% Triton-100X at room temperature for 10 min, washed with PBS 3 times, blocked with 100 μl goat serum at room temperature for 1 h, washed with PBS 3 times, 5 min each time, added with Bax and Bcl-2 antibodies, and incubated at 4°C overnight (≥12 h); after rewarming on the second day, washed with PBS 3 times, 5 min each time, added with Cy3 and Alexflour488 labeled secondary antibodies, incubated at room temperature for 2 h, washed with PBS 3 times, 5 min each time, and added with anti-fluorescence quenching sealing agent. Images were collected using a German Zeiss confocal microscope LSM800. Image J analysis software was used to calculate the average fluorescence values ​​of different proteins in the samples of each group of metformin group, metformin-NC group and metformin-si-lncRNA RP11-242D8.1 group.

[0105] 4. Statistical processing

[0106] The experimental results were all quantitative data. The experimental data were statistically analyzed using Prism 8.0 statistical software. The quantitative data experimental results were expressed as mean ± standard deviation. The t-test was used for comparison between the two groups, and one-way analysis of variance was used for comparison between the three groups. P < 0.05 indicated that the difference was statistically significant.

[0107] 5. Results

[0108] (1) Differential expression of lncRNA RP11-242D8.1 in non-small cell lung cancer and its relationship with overall survival

[0109] The GEPIA database and the starbase database were used to analyze the expression differences of lncRNARP11-242D8.1 in different tumor tissues and corresponding normal tissues, and the relationship between its expression level and the overall survival of patients with non-small cell lung cancer. Real-time fluorescence quantitative PCR was used to detect the expression of lncRNARP11-2428.1 in each group, and statistical analysis was performed. Figure 1 A and Figure 1 As shown in B: Compared with normal lung tissue, the expression level of lncRNA RP11-242D8.1 in non-small cell lung cancer tissue was significantly decreased (P<0.05, P<0.001); Figure 1 As shown in C: Compared with BEAS-2B cells, the expression level of lncRNA RP11-242D8.1 in H1299 cells was significantly downregulated (P<0.001); Figure 1 As shown in D: The overall survival of patients with non-small cell lung cancer with low expression of lncRNA RP11-242D8.1 was shorter (P<0.05), and the difference was statistically significant. Figure 1 As shown in E: lncRNA RP11-242D8.1 can well predict the occurrence of non-small cell lung cancer (AUC: 0.686 (95% confidence interval: 0.641–0.731)).

[0110] (2) Effects of metformin on H1299 cells

[0111] The CCK8 assay was used to detect the inhibitory effect of metformin on H1299 activity. Figure 2 As shown in A: With the increase of drug concentration and the extension of action time, the inhibitory effect of metformin on H1299 cells also increased accordingly (P<0.001); Figure 2 As shown in Figure B: At 48 hours, with the increase in drug concentration, the inhibitory effect of metformin on H1299 cells increased, and the IC50 at 48 hours was calculated to be 15mmol / L (P<0.001); Fluorescence quantitative PCR was used to detect the effect of metformin on lncRNA RP11-242D8.1 in H1299 cells, as shown in Figure 2 Figure 2 As shown in C: Metformin can significantly enhance the expression of lncRNA RP11-242D8.1 (P<0.001), and the difference is statistically significant.

[0112] (3) Interference effects of different interference fragments on lncRNA RP11-242D8.1

[0113] Fluorescence quantitative PCR was used to detect the expression level of lncRNA RP11-242D8.1 in each group (si-lncRNA RP11-242D8.1-1744, si-lncRNA RP11-242D8.1-1355, si-lncRNA RP11-242D8.1-75). Figure 3 As shown: The three interference fragments all have interference effects on lncRNARP11-242D8.1. At the same interference fragment concentration, si-lncRNARP11-242D8.1-1355 has the strongest interference effect (P<0.001), so si-lncRNARP11-242D8.1-1355 was selected for subsequent experimental studies. The difference is statistically significant.

[0114] (4) Role of lncRNA RP11-242D8.1 in metformin inhibiting the expression of inflammatory factors in H1299 cells

[0115] Fluorescence quantitative PCR and ELISA were used to detect the role of lncRNA RP11-242D8.1 in metformin inhibiting inflammatory factors in H1299 cells. Figure 4 As shown in A: Compared with the metformin group and metformin-NC group, the mRNA expressions of IL-1β, IL-6 and TNF-α were upregulated in the metformin-si-lncRNA RP11-242D8.1 group (P<0.01, P<0.01, P<0.001); Figure 4 As shown in B: Compared with the metformin group and the metformin-NC group, the secretion levels of IL-1β, IL-6 and TNF-α proteins in the metformin-si-lncRNA RP11-242D8.1 group were increased (P<0.001, P<0.001, P<0.05), and the differences were statistically significant.

[0116] (5) Role of lncRNA RP11-242D8.1 in metformin-induced apoptosis in H1299 cells

[0117] Flow cytometry and immunofluorescence were used to detect the role of lncRNA RP11-242D8.1 in metformin-induced apoptosis in H1299 cells. Figure 5 As shown in A: Compared with the metformin group and metformin-NC group, the apoptosis level in the si-lncRNA RP11-242D8.1 group was significantly reduced (P<0.001); Figure 5 B and Figure 5As shown in C, compared with the metformin group and metformin-NC group, the expression of Bcl-2 protein was increased, and the expression of Bax protein and the ratio of Bax / Bcl-2 were decreased in the metformin-si-lncRNA RP11-242D8.1 group (P<0.001), and the differences were statistically significant.

[0118] In summary, lncRNA RP11-242D8.1 expression is downregulated in non-small cell lung cancer (NSCLC) tissues, and low expression of lncRNA RP11-242D8.1 is associated with shorter OS in patients with non-small cell lung cancer (NSCLC); lncRNA RP11-242D8.1 may be the target of metformin in inhibiting non-small cell lung cancer. Knocking down lncRNA RP11-242D8.1 can weaken the effect of metformin in inhibiting the expression of inflammatory factors in H1299 cells and enhance the resistance of H1299 cells to metformin-induced apoptosis.

[0119] The present invention provides a biomarker for non-small cell lung cancer and its application, which is used to solve the problem of the blank of Inc RNA in the treatment of non-small cell lung cancer. The biomarker provided by the present invention is a long non-coding RNA RP11-242D8.1, and the nucleotide sequence of its cDNA is shown in SEQ ID NO.1. The research results of the present invention show that lncRNA RP11-242D8.1 is downregulated in non-small cell lung cancer, and low expression of lncRNA RP11-242D8.1 is associated with a shorter overall survival of patients, indicating that lncRNA RP11-242D8.1 may be a potential biomarker for poor prognosis in patients with non-small cell lung cancer. The present invention uses lncRNA RP11-242D8.1 as a molecular intervention target, and the results show that after reducing the expression of lncRNA RP11-242D8.1, the effect of metformin on promoting H1299 cell apoptosis and inhibiting the expression of inflammatory factors in H1299 cells can be weakened, and finally the resistance of H1299 cells to metformin is enhanced.

[0120] On this basis, the present invention provides the use of the non-small cell lung cancer lncRNA biomarker in the preparation of a kit for early screening and auxiliary diagnosis of lung cancer, and the kit includes a detection reagent for the non-small cell lung cancer lncRNA biomarker: lncRNARP11-242D8.1.

[0121] Among them, the detection reagents include RNA extraction reagents, reverse transcription reagents and real-time fluorescence quantitative PCR reagents, lncRNA primers, and GAPDH primers. The RNA extraction reagent uses Axygen's AP-MN-MS-RNA-50 reagent, which includes: Buffer R-Ⅰ, Buffer R-Ⅱ, isopropanol, Buffer W1A, Buffer W2, Buffer TE or RNase-free water. The reverse transcription reagent and real-time fluorescence quantitative PCR reagent use Takara's RR820A and RR037A (RR037A includes: 5X PrimeScript Buffer (for Real Time), PrimeScript RT Enzyme Mix I, Oligo dT Primer (50μM), Random 6mers (100μM), RNase-free water; RR820A includes: TB Green Premix Ex Taq II (Tli RNaseH Plus) (2X), PCR Forward Primer (10μM), PCR Reverse Primer (10μM), RNase-free water). The lncRNA primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3. The GAPDH primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.16, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.17.

[0122] By collecting tumor and adjacent tissue specimens from clinical non-small cell lung cancer patients, extracting RNA, and then detecting it through real-time fluorescence quantitative PCR, it was found that the expression of lncRNA RP11-242D8.1 in tumor tissue was significantly reduced, and only 1 out of 10 patients had increased lncRNA expression in tumor tissue.

[0123] The present invention provides the use of the non-small cell lung cancer lncRNA biomarker in the preparation of a drug for screening and / or treating non-small cell lung cancer tumors. The drug includes the expression inhibitor of the lncRNA RP11-242D8.1.

[0124] The expression inhibitor of the lncRNA RP11-242D8.1 includes si-lncRNA RP11-242D8.1-1744, si-lncRNARP11-242D8.1-1358, and si-lncRNARP11-242D8.1-75; the sense chain sequence of the si-lncRNARP11-242D8.1-1744 is shown in SEQ ID NO.4, and the antisense chain sequence is shown in SEQ ID NO.5; the sense chain sequence of the si-lncRNARP11-242D8.1-1358 is shown in SEQ ID NO.6, and the antisense chain sequence is shown in SEQ ID NO.7; the sense chain sequence of the si-lncRNA RP11-242D8.1-75 is shown in SEQ ID NO.8, and the antisense chain sequence is shown in SEQ ID NO.9.

[0125] The drug uses the lncRNA RP11-242D8.1 expression inhibitor as an active ingredient and is supplemented with a pharmaceutically acceptable excipient or carrier.

[0126] The above-mentioned lncRNA RP11-242D8.1 expression inhibitor of the present invention can be prepared into an oral drug, wherein the dosage form of the drug includes a solution, a capsule and a granule. The drug is prepared by adding different excipients to the above-mentioned lncRNA RP11-242D8.1 expression inhibitor according to different dosage forms, and processing it into a dosage form that can be used by animals through the preparation process of the corresponding dosage form. The corresponding excipients for the solution include micropowder silica gel and distilled water; the corresponding excipients for the capsule include starch, sodium hydroxymethyl cellulose, and methyl cellulose; the corresponding excipients for the granule include sodium bicarbonate, citric acid, starch, sodium hydroxymethyl cellulose, and methyl cellulose.

[0127] Let's take the solution as an example to illustrate its effect. The specific research is as follows:

[0128] A solution with an interference fragment for inhibiting the expression of lncRNA RP11-242D8.1 as an active ingredient, which is composed of the following raw materials: 330 ng of the interference fragment of lncRNA RP11-242D8.1 and 1 mL of RPMI 1640 culture medium.

[0129] The preparation method of the solution comprises the following steps:

[0130] 330 ng of the expression inhibitor of lncRNA RP11-242D8.1 was taken, and 1 mL of RPMI 1640 medium was added to dissolve it to prepare a solution.

[0131] After applying the above-prepared solution to H1299 cells, we found that the resistance of H1299 cells to metformin was enhanced, and the effect of metformin in inhibiting the secretion of inflammatory factors and promoting apoptosis of H1299 cells was weakened.

[0132] From the above results, it can be seen that the solution provided by the present invention with the expression inhibitor of lncRNA RP11-242D8.1 as the active ingredient has an antagonistic effect on metformin in the treatment of non-small cell lung cancer. It shows that the non-small cell lung cancer lncRNA biomarker provided by the present invention can be used to prepare drugs for screening and / or treating non-small cell lung cancer tumors.

[0133] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0134] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0135] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of a detection reagent for a lncRNA biomarker of non-small cell lung cancer in the preparation of a kit for early screening and auxiliary diagnosis of non-small cell lung cancer, It is characterized in that The marker is lncRNA RP11-242D8.1, and the nucleotide sequence of its cDNA is shown in SEQ ID NO.1; The detection reagent includes an upstream primer of the lncRNA RP11-242D8.1 and a downstream primer of the lncRNA RP11-242D8.1, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

2. The use according to claim 1, It is characterized in that The detection reagent also includes an RNA extraction reagent and a GAPDH primer.

3. The use according to claim 2, It is characterized in that The GAPDH primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.16, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.17.

Images