Pepper fruit shape gene CaFS1 and its linked KASP molecular marker and primers, acquisition method and application

Abstract

The invention belongs to the technical field of pepper planting, and discloses a pepper fruit shape gene CaFS1, a KASP molecular marker linked to the gene and corresponding primers, wherein the KASP molecular marker is a single nucleotide polymorphism at the 14853470th base on pepper chromosome 10, where a base C to T substitution occurs. Also disclosed is a method of using whole genome association analysis and mixed pool separation analysis population positioning to obtain a chromosome region closely linked to pepper fruit shape, and developing a molecular marker within the candidate interval to determine the candidate gene CaFS1, and screening a KASP molecular marker based on the base mutation of the candidate gene, and using the marker to perform genotype identification on 90 randomly sampled individual plants of the F2 population, with a compliance rate of 100%. The result is not only helpful for pepper fruit shape identification and auxiliary breeding, but also lays a foundation for map-based cloning of fruit shape genes and analysis of the molecular mechanism of pepper fruit shape changes.

Description

Technical Field

[0001] The invention belongs to the field of pepper breeding and molecular biology, and more specifically relates to a pepper fruit shape gene CaFS1, and SNP molecular markers and primers (KASP) closely related to the gene, and also relates to their applications in predicting pepper fruit shape changes and molecular assisted breeding. Background Art

[0002] Pepper (Capsicum annuum L.) belongs to the genus Capsicum in the Solanaceae family and is one of the most important vegetable crops in China. The fruit is the most important economic output of pepper. It has become an important crop in my country because of its rich nutrition, long industrial chain and high economic added value. Fruit shape is one of the most important selective traits in the process of crop cultivation and domestication selection. The fruit of wild pepper is very small, but in the process of domestication and improvement, the fruit of modern cultivated pepper has gradually become larger and evolved into a rich and diverse shape. For vegetable crops such as peppers whose fresh fruits are edible organs, fruit shape is an even more important commodity trait, because the shape and size of the fruit not only affect the yield and quality of the crop, but also affect consumers' consumption preferences, packaging requirements and market value. At present, fruit shape is still an important trait that Chinese breeders pay great attention to in pepper breeding programs.

[0003] Pepper fruit shape traits are regulated by quantitative trait loci (QTLs) and are the main targets of molecular marker-assisted breeding (MAS). Although pepper has problems such as large genome, low molecular marker saturation of genetic linkage map, and time-consuming and labor-intensive QTL gene mining, the improvement of pepper genome information and the development of molecular marker technology have greatly promoted QTL cloning and functional analysis. Researchers have identified many pepper fruit-related QTLs loci through natural populations or hybrid populations. For example, 16 SNP loci were identified to be associated with fruit weight, of which 7 SNPs were located on known fruit weight genes, such as STYLOSA, FASCIATED, WUSCHEL, and CLAVATA1. In terms of flesh thickness, QTLs loci such as Qpt.iivr-2.1, Qpt.iivr-3.1, and ftd2.1 were identified, and QTL NloLG25.1 was found to be associated with the number of ovaries. CaBRX, a gene related to the control of pepper ventricles, was identified at lcn1.1. Silencing CaBRX can significantly reduce the number of ventricles and affect the expression of flower and ventricle-related genes. fs3.1 and fs10.12 were found to be the strongest major QTLs for fruit length, explaining 67% and 44% of the genetic effects, respectively. Although some related gene QTLs have been found in pepper fruit trait research, the mode of action of these regulatory factors is still poorly understood, and their application is still limited and inefficient.

[0004] Therefore, exploring the key genes or QTL functions of important agronomic traits of pepper, such as fruit shape, and developing molecular markers related to fruit shape are of great significance for the establishment of a molecular breeding technology system for pepper. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a SNP molecular marker (KASP marker) linked to the pepper fruit shape gene CaFS1, so as to provide a new way for the screening, identification and auxiliary screening of pepper oblong fruits, as well as the breeding of pepper fruit shape.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is:

[0007] In the first aspect, the present invention provides a KASP molecular marker linked to the pepper fruit shape gene CaFS1, taking the pepper zunla-1 gene as the reference gene, and the single nucleotide polymorphism at the 14853470th base on pepper chromosome 10, where a substitution from base C to T occurs.

[0008] The above-mentioned KASP molecular marker linked to the pepper fruit shape gene CaFS1 preferably has a nucleotide sequence as shown in SEQ ID NO:2.

[0009] In a second aspect, the present invention provides a primer for identifying the KASP molecular marker, comprising:

[0010] Forward primer 1: GAAGGTGACCAAGTTCATGCTTGTTTTAACAGAAACTGGTGTTTTC;

[0011] Forward primer 2: GAAGGTCGGAGTCAACGGATTTGTTTTAACAGAAACTGGTGTTTTT;

[0012] Reverse primer: AAAAAGTGCTAACAGGACATCACG.

[0013] The two forward primers are connected to different fluorescent linker sequences respectively. The linker sequence matching the FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT, and the linker sequence matching the HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT.

[0014] In a third aspect, the present invention provides a method for screening the KASP molecular marker, comprising the following steps:

[0015] (1) Resequencing of pepper materials was performed, and genome-wide association analysis of pepper fruit shape traits was performed based on the resequencing results. On this basis, a high-generation inbred line of pepper with long fruits was used as the male parent, and a high-generation inbred line of pepper with round fruits was used as the female parent to construct an F2 population through hybridization;

[0016] (2) performing fruit shape phenotype identification on the F2 population, using a mixed pool separation analysis population positioning method to obtain a long fruit mixed pool and a round fruit mixed pool, and performing RNA-seq sequencing. After performing bioinformatics analysis on the sequencing results, a candidate chromosome region linked to the fruit shape of pepper fruit was obtained;

[0017] (3) Develop molecular marker technology for single base substitution / insertion / deletion in the candidate region of the chromosome to narrow the candidate interval, and finally obtain the KASP molecular marker that is closely linked to the fruit shape gene CaFS1.

[0018] In a fourth aspect, the present invention provides an application of the KASP molecular marker or the primer in identifying the types of long and round fruits of pepper or in molecular assisted breeding. This is beneficial to the rapid identification and breeding of pepper fruit shape genes, and to cloning the main effect genes controlling fruit shape, laying a foundation for studying the regulatory mechanism of fruit shape changes.

[0019] The above application, preferably, the application method is as follows:

[0020] S1: Extract the DNA of pepper sample to be tested as template;

[0021] S2: adding the primers to perform PCR amplification;

[0022] S3: Use KASP reagent for typing and read the typing results. Blue is the dominant FAM with round fruit, green is the recessive HEX with long fruit, and red is the heterozygous Heterozygote with intermediate fruit.

[0023] Preferably, a quantitative PCR device is used for PARMS PCR amplification; when the fluorescent group and the corresponding fluorescent quenching group are close to each other, the fluorescence emitted by the fluorescent group will be absorbed by the quenching group, emitting fluorescence with a longer wavelength, or releasing heat. At this time, the fluorescent signal of the group cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescent signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, the corresponding fluorescent signal will appear.

[0024] Preferably, the PCR amplification program is: Preincubation 94°C 900S; 94°C 20S, 78°C 10S, TD 62°C, 0Cyc->57(-0°C), 10 cycles; 94°C 20S, 57°C 60S, 35 cycles; Cooling 37°C 30S.

[0025] In a fifth aspect, the present invention provides a pepper fruit shape gene CaFS1, the CDS nucleotide sequence of the coding region of which is shown in SEQ ID NO:1.

[0026] In a sixth aspect, the present invention provides an application of a pepper fruit shape gene CaFS1 in regulating pepper or tomato fruit shape.

[0027] The above application is preferably used to silence the CaFS1 gene in peppers and cultivate pepper varieties with short fruit shapes.

[0028] Preferably, the CaFS1 gene is overexpressed in tomatoes to cultivate long-fruit tomato varieties.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The present invention screens a KASP molecular marker that can be directly used for the identification of pepper fruit shape, and then relies on the molecular marker for assisted breeding, which can effectively solve the problems of long conventional breeding cycle and susceptibility to environmental influences, and is of great significance in the pepper fruit shape breeding practice and the study of fruit shape change and regulatory mechanism; the marker is used to perform genotype identification on 90 randomly sampled individual plants of the F2 population, and the coincidence rate reaches 100%. This result is not only helpful for pepper fruit shape identification and assisted breeding, but also lays a foundation for the map-based cloning of fruit shape genes and the analysis of the molecular mechanism of pepper fruit shape change.

[0031] 2. By using this molecular marker at an early stage, satisfactory plants can be quickly screened, which effectively reduces the planting scale, reduces the workload of later identification, improves the efficiency and accuracy of selection, and is of great significance for studying the mechanism of fruit color formation. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 This is a preliminary genome-wide association study (GWAS);

[0034] Figure 2 The phenotypes of 90 individual plants of the parents, F1 and run markers;

[0035] Figure 3 Some results of genotyping of KASP148 marker in F2 population;

[0036] Figure 4 The identification of TRV virus-mediated CaFS1 gene silencing in D40 fruit growth, including: (A) pTRV2-CK: phenotype of pepper plants infected with TRV empty vector, pTRV2-CaPDS: phenotype of pepper plants infected with TRV-PDS, pTRV-CaFS1: phenotype of D40 plants infected with TRV-CaFS1; (B) TRV-induced CaFS1 gene silencing in D40 by real-time fluorescence quantitative PCR detection; (C) fruit phenotype of TRV virus-mediated CaFS1 gene silencing strains;

[0037] Figure 5 Identification and phenotypic observation of CaFS1 OE lines. (A) PCR positive detection of transformed plants, M represents DL2000 marker, B represents blank control, N represents negative control, and P represents positive control; (B) Tomato fruit shape phenotype of CaFS1 OE lines. DETAILED DESCRIPTION

[0038] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0039] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0040] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0041] Example:

[0042] The present invention constructs an F2 population using two highly homozygous materials. A chromosome region closely linked to the fruit shape (long round fruit) of pepper fruit is obtained by using the methods of genome-wide association analysis (GWAS) and pooled segregation analysis (BSA) population positioning, and a molecular marker is developed within the candidate interval to determine the candidate gene CaFS1, and the nucleotide sequence is shown in SEQ ID NO: 1. A KASP molecular marker is screened based on the base mutation of the candidate gene, which can be directly used for the identification of the fruit shape of pepper fruit, and then the molecular marker is relied on for auxiliary breeding, which can effectively solve the problem that the conventional breeding cycle is long and is easily affected by the environment. By using the molecular marker at an early stage, satisfactory plants can be quickly screened, which effectively reduces the planting scale, reduces the workload of later identification, and improves the efficiency and accuracy of selection.

[0043] The method for obtaining the molecular marker KASP linked to the pepper oblong fruit shape gene CaFS1 is as follows:

[0044] 1. Construction of genetic population

[0045] In the early stage of the present invention, 10X resequencing was performed on 383 pepper materials. Based on the resequencing results, a genome-wide association study (GWAS) was performed on the pepper fruit shape traits. It was found that there was a very strong GWAS signal on chromosome 10. Figure 1 Subsequently, two high-generation homozygous inbred pepper materials, long-fruit "D40" and round-fruit "D39", were selected as parents to construct F1 and F2 populations. By investigating the target traits of the populations, genetic analysis of pepper fruit shape traits was conducted.

[0046] 2. Phenotypic identification of fruit shape

[0047] The phenotype of each individual plant in F1 and F2 was identified. Three fruits on the "four-door bucket" of each plant at the green and ripe stage were harvested, photographed with a digital camera, and the length and width of the fruit were measured using a digital vernier caliper to complete the phenotypic identification of the fruit shape traits.

[0048] 3. QTL analysis of fruit shape

[0049] Plant the F2 segregation population, select the longest and roundest 20 plants, extract leaf DNA, and mix the sample DNA in equal amounts to construct the round fruit pool and the long fruit pool DNA after quality inspection. Use the Illumina sequencing platform to perform whole genome resequencing of the two mixed pools (sequencing depth of 30x) and the two parents (sequencing depth of 10x). The reads obtained by DNA-seq sequencing of the two mixed pools were aligned to the pepper zunla-1 reference gene (http: / / peppersequence.genomics.cn), and bwa was used for mapping, samtools for SNP calling, and SNP-Index was calculated. The SNP-Index of the two extreme mixed pools was subtracted to obtain Δ(SNP-Index), and the Δ(SNP-Index) of each region on the chromosome was calculated by the sliding window method.

[0050] 4. Fine positioning of major QTLs for fruit shape

[0051] The chromosome region of the QTL controlling fruit shape was obtained through step 3. In order to further narrow down the candidate region of the gene controlling fruit shape, the DNA sequence variation within the QTL segment was analyzed, the SNPs sites that met the fine positioning interval were screened, and the KASP markers were developed to perform genotyping on the individual plants of the F2 population to determine the exchange plants. The screening criteria mainly included: (1) base changes from C to T or G to A; (2) SNP-index in the mutation pool = 0.9-1. Analyze whether these SNPs will cause structural changes in the genes in which they are located, such as premature termination, amino acid changes, etc. After narrowing down the candidate interval through KASP genotyping technology, combined with the genetic linkage map, the candidate gene was successfully located within the 0.7Mb interval of chromosome 10.

[0052] 5. Development of molecular markers linked to oblong fruit shape

[0053] The annotation information of genes in the fine-mapped interval was analyzed to find functionally related genes. Total RNA from different tissues of the parental round fruit and long fruit was extracted and reverse transcribed into cDNA. Real-time fluorescence quantitative PCR (RT-qPCR) was used to determine the expression levels of all genes in the fine-mapped interval in the two parents, and genes related to gene expression characteristics were screened. Based on the above information, IQ-DOMAIN1, which connects the calcium signaling pathway and gene expression regulation, was selected as a candidate gene and named CaFS1. The CDS nucleotide sequence of the CaFS1 coding region is shown in SEQ ID NO: 1. The sequence of the gene was further cloned. Sequencing revealed that there were 4 base mutations in the gene, and two mutations at the loci were also sequenced in the BSA sequencing annotation. KASP marker primers were designed for the two markers, and it was found that they could well distinguish the parental round fruit, long fruit and F1. Finally, the marker KASP148 with the best typing effect was selected to perform genotyping on 90 random plants in the F2 population. Marker KASP148 is a single nucleotide polymorphism at the 14853470th base on chromosome 10 of pepper, where a base substitution from C to T occurs. The nucleotide sequence of marker KASP148 is shown in SEQ ID NO: 2, and a base substitution from C to T occurs at the 201st base in SEQ ID NO: 2.

[0054] SEQ ID NO: 1:

[0055] ATGGGTTCTGATTGGCTTAAAAATGTAATCAGTTTGAGAAAAGCAAAAGATGGCAGTTCGAAAAGAATAAAGGGAACTTCTATTGGACGCAAGGGGGATGCCCACTCTCAGAAAGAGCCTTCAAGAAGAAGTGGTGCTTCTGTCAAAAAGCACAGAGAAATGGGAGTTCTTTCTGAGGATAACGCAGCCATAAGGATTCAGACAGCTTTCCGTGCATATATGGCAAGAAAAACTTTGCGTCGCTTAAAAGGAATATCAAGGTTACATTCCATGACACAACGCCCTTCTGTGAGAAAACAGGCTTCGACAACCTTGAGTGCTCTTCATTCATGGAACAGGATACAATCTGATATTAGAGCTCGCCGTGTTCGTATGGTCATAGAGGGACGTCTTAAGCAGAAGAAGCTGGAGAATCAACTGAAGCTAGAGGCAAAGCTTCATAACTTTGAGGCAGAGTGGAATGGTGGCCCTGAAACAATGGAAGTTGTTCTATCAAGGATACATCAGAGAGAAGCAGCAGCAGTGAAGCGGGAACGAACTATGGCAATCATCATCGCTCGGAATATTTTGTCACAGTGGAGAGCCAATTCCAACCCAATAGTCGGATCAAGTAACCATGAATTAGGCAAAGCTCATTGGGGCTGGAGCTGGACAGATCGCTGGATCGCTGCACGGCCATGGGAAAGTCGAATTCCTGTTCAATCAAGTCCAAAAAGTGCTAACAGGACATCACGGAAAACTCCTACGAGTAATAAAACTCAAACAACGAAAACACCAGTTTCTGTTAAAACAACTTCAGCCAATTGGAAACGTGCTATGAAGCCTAGAAAGCTATCATACGAAGCAGCAGATAAACTAACTGCACAGAAAGGAATCAACAAAGTTGAGACAAGCATTGACAAACAGGAAGCGGTATCTTAA。

[0056] SEQ ID NO: 2: GTAGAAACACATCTAAGGTTGAACATATTACCTTCTTTCAGTTGCTTTTAAGATACCGCTTCCTGTTTGTCAATGCTTGTCTCAACTTTGTTGATTCCTTTCTGTGCAGTTAGTTTATCTGCTGCTTCGTATGATAGCTTTCTAGGCTTCATAGCACGTTTCCAATTGGCTGAAGTTGTTTTAACAGAAACTGGTGTT TTCGTTGTTTGAGTTTTATTACTCGTAGGAGTTTTCCGTGATGTCCTGTTAGCACTTTTTGGACTTGATTGAACAGGAATTCGACTTTCCCATGGCCGTGCAGCGATCCAGCGATCTGTCCAGCTCCAGCCCCAATGAGCTTTGCCTAATTCATGGTTACTTGATCCGACTATTGGGTTGGAATTGGCTCTCCACTGTGACAA.

[0057] 6. Application of molecular markers linked to oblong fruit shape

[0058] (1) CTAB method was used to extract DNA from 90 individual plants in the F2 population

[0059] a. Add dithiothreitol (DTT, 0.2%) to the CTAB extract;

[0060] b. Add 2 fresh leaves the size of the centrifuge tube cap into a 2.0 ml centrifuge tube; grind them into powder with liquid nitrogen, add 800-900 μL CTAAB buffer and mix well;

[0061] c. 65℃ water bath for 30min-1h, gently shake 1-3 times during the period, and cool to 4℃ or room temperature to below 15℃ after water bath;

[0062] d. Add 500 chloroform / isoamyl alcohol (24:1) and mix up and down for 2-5 minutes to ensure that the sample and chloroform are fully mixed;

[0063] e. Centrifuge at 12,000 rpm for 10 min. Take 500 μL of the supernatant and add it to a 1.5 ml centrifuge tube pre-added with 500 μL of isopropanol. Gently invert upside down to mix; let stand in a 4°C or -20°C refrigerator for more than 30 min;

[0064] f. Centrifuge at 12,000 rpm for 10-20 min, discard the supernatant; wash the precipitate with 500 ul of 75% alcohol, centrifuge at 12,000 rpm for 5 min, and discard the supernatant;

[0065] g. Ultra-clean air-dried DNA to allow the alcohol to evaporate completely; add 100 μL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA;

[0066] h. Remove RNA in a 37℃ water bath or at room temperature for 1 hour; take DNA for electrophoresis. After the band is confirmed to be intact, use a micro-spectrophotometer to measure the DNA concentration. The ratios of 260 / 280 and 260 / 230 must be greater than 1.8. Dilute the DNA to 100 ng and place at -20℃ for later use.

[0067] (2) KASP148 marker typing of F2 population individual plants

[0068] a. KASP primer reagent is generally composed of 3 primers, 2 of which are allele-specific forward primers; 1 is a universal reverse primer; the 2 allele-specific forward primers only differ in the 3' end base, corresponding to different alleles. Allele-specific forward primers will produce different fluorescent signals through competitive PCR reaction. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT;

[0069] KASP148 primers were designed by SNPWay ( http: / / www.snpway.com / ):

[0070] 148-5F: 5'-GAAGGTGACCAAGTTCATGCTTGTTTTAACAGAAACTGGTGTTTTC-3' (as shown in SEQ IDNO: 3);

[0071] 148-5R: 5'-GAAGGTCGGAGTCAACGGATTTGTTTTAACAGAAACTGGTGTTTT-3' (as shown in SEQ IDNO: 4);

[0072] 148-5C: 5'-AAAAAGTGCTAACAGGACATCACG-3' (as shown in SEQ ID NO: 5);

[0073] b. KASP148 primer synthesis was from Qingke Biotechnology (PAGE purification);

[0074] c. The typing system is shown in Table 1 below:

[0075] Table 1: Classification system

[0076] Element Addition amount Final concentration 2×PARMS 5ul 1X Primer F (10uM) 0.15ul 150nM Primer R (10uM) 0.15ul 150nM Primer C (10uM) 0.4ul 400nM DNA template 10-100ng 10-100ng Ultrapure water Add water to 10ul -

[0077] Amplification Procedure:

[0078] Preincubation 94℃900s; 94℃20s, 78℃10s, TD 62℃, 0Cyc->57(-0℃), 10 cycles; 94℃20s, 57℃60s, 35 cycles; Cooling 37℃30s.

[0079] (3) Typing results

[0080] The fruit shape of individual plants in the F2 population was phenotypically identified using the KASP148 marker. The fruit shapes and genotypes of 90 individual plants in the F2 population constructed by KASP148 marker D40 and D39 are shown in Table 2. The phenotypes of the 90 individual plants of the parents, F1 and run markers are shown in Figure 2 , the identification results of some F2 plants are as follows Figure 3 As shown, the genotyping results were 100% consistent with the phenotyping results.

[0081] Table 2: Fruit shape and genotype of 90 individual plants in the F2 population constructed by D40 and D39 using KASP148 marker

[0082]

[0083]

[0084]

[0085]

[0086] 7. VIGS verifies that CaFS1 regulates the shape of long fruit “D40”

[0087] In order to preliminarily understand whether CaFS1 has an effect on pepper fruit shape, the function of CaFS1 was further evaluated by VIGS.

[0088] The full-length CDS of CaFS1 was used to obtain the most effective silencing region on the Solanaceae VIGS webpage (https: / / vigs.solgenomics.net / ). According to the primer specificity design principle, the CaFS1 silencing fragment primers were designed using Geneious Prime software to amplify the silencing target fragment and recover the product.

[0089] The pTRV2 vector was treated with EcoRI and BamHI double enzyme digestion and recovered, the purified product of the target fragment was recombined with the TRV2 vector, and the recombinant product was transformed into Escherichia coli DH5α, a Kan-resistant plate was coated, and a single clone was selected for PCR identification and TRV2 universal primer sequencing verification.

[0090] The correct viral recombinant plasmid DNA was extracted and identified and transformed into Agrobacterium strain GV3101 to obtain Agrobacterium containing the recombinant vector. The Agrobacterium single clone was identified by PCR using target gene-specific primers. The infection solution (10mMMgCl2, 10mM MES, 200uM AS) was prepared and the plants were infected by leaf injection method, with empty vector and reporter gene (phytoene desaturase, PDS) as controls.

[0091] After the pepper plants were inoculated with the bacterial solution, they were placed in the dark for 24 h, and then the inoculated plants were transferred to a room with 16 h of light (200 umol / m 2 / s, 22±2℃) / 8h dark (20±2℃) photoperiod and 70% relative humidity in an artificial climate incubator for about three weeks. About three weeks after virus inoculation, we used the photobleaching phenomenon of the leaves of the positive control plants as a signal of effective inoculation. PCR detection of new leaves of PTRV2-CaFS1 was performed using TRV virus detection primers to obtain positive strains, and the silencing efficiency of positive plants was evaluated by real-time fluorescence quantitative PCR.

[0092] Finally, the phenotypic observations of relevant traits were carried out on the positive lines.

[0093] The results showed that compared with the control, the fruit shape of the strain with CaFS1 silenced showed significant changes, with the fruits of the plants becoming shorter and smaller (4).

[0094] 8. Overexpression of CaFS1 causes tomato fruit to become longer

[0095] To further study the effect of CaFS1 on tomato fruit shape development, we constructed a CaFS1 overexpression line.

[0096] According to the CDS of CaFS1, full-length primers were designed and restriction linkers were added. The target fragment was amplified from the parent and the product was purified. The overexpression vector Gate8 was treated with XhoI and XbaI and recovered. After homologous recombination, the recombinant product was transformed into Escherichia coli and coated with spec resistance plates. The recombinant clones were selected for shaking, and the colonies were PCR verified for positive clones using universal primers 35SF and Gate8R, and then sequenced to verify the transformation into Agrobacterium.

[0097] The transformed regenerated plants were obtained through seed germination, cotyledon pre-culture, Agrobacterium-mediated genetic transformation, screening culture and differentiation, and resistance bud rooting. Subsequently, the leaves of the regenerated plants after genetic transformation were cut from the CaFS1 overexpression lines, and DNA was extracted using the CTAB method. PCR detection was performed using screening marker gene-specific primers to determine the positive plants, and then the overexpression efficiency of the positive plants was evaluated and the phenotype was observed by real-time fluorescence quantification. The lines with significant CaFS1 expression and obvious fruit shape changes were selected and propagated to the T3 generation for phenotypic observation.

[0098] The results showed that overexpression of pepper CaFS1 in round-fruited tomatoes would make the fruit longer, indicating that CaFS1 plays a regulatory role in fruit shape ( Figure 5 ).

Claims

1. A gene related to pepper fruit shape CaFS1 The linked KASP molecular marker is characterized by: The nucleotide sequence is shown in SEQ ID NO: 2, and the polymorphism of the 201st base in SEQ ID NO: 2 is C or T.

2. A primer for identifying the KASP molecular marker according to claim 1, characterized in that: The primer sequences are: Forward primer 1: GAAGGTGACCAAGTTCATGCTTGTTTTAACAGAAACTGGTGTTTTC; Forward primer 2: GAAGGTCGGAGTCAACGGATTTGTTTTAACAGAAACTGGTGTTTTT; Reverse primer: AAAAAGTGCTAACAGGACATCACG.

3. Use of the KASP molecular marker according to claim 1 or the primer according to claim 2 in identifying the long fruit and round fruit types of pepper.

4. The use according to claim 3, characterized in that: The method of application is as follows: S1: Extract the DNA of pepper sample to be tested as template; S2: adding the primers as described in claim 2 to perform PCR amplification; S3: Use KASP reagent for typing and read the typing results. Blue is the dominant FAM with round fruit, green is the recessive HEX with long fruit, and red is the heterozygous Heterozygote with intermediate fruit.

Images