Ipomoea batatas root rot pathogen dx94, molecular marker gene, primer pair and identification method and application

By developing the molecular marker gene FfIdnDH and its primer pair for the sweet potato root rot pathogen DX94, the problem of insufficient identification accuracy of Fusarium foetens in the existing technology has been solved, achieving a 100% improvement in accuracy and identification efficiency, and supporting the research and control of sweet potato root rot.

CN117264782BActive Publication Date: 2025-11-21CHINA AGRI UNIV SANYA RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311420194.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-30
Publication Date
2025-11-21
Estimated Expiration
2043-10-30

AI Technical Summary

Technical Problem

Existing technologies suffer from insufficient accuracy and phylogenetic resolution in identifying Fusarium foetens, the pathogen causing sweet potato root rot. In particular, the alignment of ITS sequences is susceptible to Indel-induced problems, leading to low identification efficiency.

Method used

A molecular marker gene FfIdnDH and its primer pair for the root rot pathogen DX94 of sweet potato were developed. Fusarium foetens were identified by PCR amplification and agarose gel electrophoresis. The 459bp fragment was specifically amplified using primers FfIdnDH-F and FfIdnDH-R with 100% accuracy.

Benefits of technology

This method enables stable and accurate identification of Fusarium foetens, avoids the limitations of ITS identification, improves identification efficiency, and provides a foundation for the study of the pathogenesis of sweet potato root rot and the screening of biocontrol bacteria.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117264782B_ABST
    Figure CN117264782B_ABST
Patent Text Reader

Abstract

The present application relates to the field of plant disease pathogen identification method, and specifically discloses a sweet potato root rot pathogen DX94, a molecular marker gene, a primer pair, an identification method and application.The DX94 strain is preserved in the China Center for Type Culture Collection on September 4, 2023, and the preservation number is CCTCC NO: M20231589, and the classification name is Fusarium sp.DX94.The molecular marker gene FfIdnDH and the primer provided by the present application can identify the sweet potato root rot pathogen Fusarium foetens, and the accuracy reaches 100%.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant disease pathogen identification method, and particularly relates to a sweet potato root rot pathogen DX94, a molecular marker gene, a primer pair, an identification method and application. BACKGROUND

[0002] Sweet potato (Ipomoea batatas (L.) Lam.) is an important food, feed and industrial fuel crop, and has health care and medicinal value. In production, sweet potato has the characteristics of drought tolerance, poor tolerance and high yield, so it is widely planted in the world, and is the main economic crop in the world. In China, the planting area of sweet potato is mainly in the southwest and east China, which accounts for 50% of the total value of sweet potato production in China.

[0003] In recent years, with the vigorous development of sweet potato industry, due to the need for frequent transportation of seed potatoes, seedlings and other diseases, especially viral diseases and fungal diseases, the occurrence and expansion of sweet potato diseases have been aggravated, which has hindered the development of sweet potato industry. Sweet potato root rot is one of the three important diseases that restrict the production of sweet potato in China, and is an important fungal disease in the northern sweet potato production area of China. It occurs in sweet potato seedbed and field, and is called the "cancer" of sweet potato. Root rot disease can cause 20-80% reduction in sweet potato yield, cause variety degradation and quality decline, and seriously affect the income of sweet potato farmers and the enthusiasm of planting. Therefore, root rot has become one of the important diseases that need to be solved in sweet potato production.

[0004] Fusarium foetens belongs to the group of imperfect fungi (Xmperfeetifungi), Moniliales, Tubereulariaeeae and Fusarium, which can cause root rot of sweet potato and cause serious economic losses. Therefore, it is necessary to develop effective fungal identification molecular markers to identify F. foetens. ITS sequence evolves rapidly and has certain specificity between different species, and is often widely used in systematic studies between or within different strains, species and genera. However, ITS also has certain limitations due to the problems of alignment induced by Indel and potential insufficient phylogenetic resolution. Therefore, it is very important to develop a marker gene that can stably and accurately identify the pathogen of sweet potato root rot. SUMMARY

[0005] In order to develop a marker gene capable of stably and accurately identifying the pathogenic bacteria of sweet potato root rot, the application provides a sweet potato root rot pathogenic bacteria DX94, a molecular marker gene, a primer pair and an identification method and application, and the molecular marker gene FfIdnDH and the primer provided by the application can identify the sweet potato root rot pathogenic bacteria Fusarium foetens (abbreviated as F. foetens), and the accuracy reaches 100%.

[0006] The application provides a sweet potato root rot pathogenic bacteria DX94, which is preserved in the China Center for Type Culture Collection on September 4, 2023, and the preservation number is CCTCC NO: M20231589, and the classification name is Fusarium sp. DX94.

[0007] The application further provides a specific fragment for identifying the sweet potato root rot pathogenic bacteria DX94, and the specific fragment has a length of 459 bp, and the nucleotide sequence is shown as SEQ ID NO. 5.

[0008] The application further provides a molecular marker gene FfIdnDH containing the specific fragment, the nucleotide sequence of the molecular marker gene FfIdnDH is shown as SEQ ID NO. 1, and the nucleotide sequence of the protein encoded by the molecular marker gene FfIdnDH is shown as SEQ ID NO. 2.

[0009] The application further provides a primer pair for amplifying the molecular marker gene FfIdnDH, and the primer pair comprises FfIdnDH-F and FfIdnDH-R.

[0010] The nucleotide sequence of the FfIdnDH-F primer is shown as SEQ ID NO. 3.

[0011] The nucleotide sequence of the FfIdnDH-R primer is shown as SEQ ID NO. 4.

[0012] The application further provides a method for identifying the sweet potato root rot pathogenic bacteria Fusarium foetens by using the primer pair, and the method comprises the following steps:

[0013] DNA of a to-be-tested strain is extracted as a template, and the FfIdnDH-F primer shown as SEQ ID NO. 3 and the FfIdnDH-R primer shown as SEQ ID NO. 4 are used for PCR amplification.

[0014] The PCR amplification product is subjected to agarose gel electrophoresis, and a 459 bp band is amplified, and the to-be-tested strain is F. foetens.

[0015] Further, the PCR amplification reaction system is: 25 muL 2x Es Taq MasterMix, 2 muL FfIdnDH-F 10 muM, 2 muL FfIdnDH-R 10 muM, template DNA <0.5 muG, and ddH2O is supplemented to 50 muL.

[0016] Further, the PCR amplification procedure is: 94 DEG C pre-denaturation 2 min; 94 DEG C denaturation 30 s, 57 DEG C annealing 30 s, 72 DEG C extension 30 s, a total of 35 cycles; 72 DEG C extension 2 min.

[0017] The application also provides application of the sweet potato root rot pathogen DX94 in screening of a sweet potato root rot biocontrol bacterium.

[0018] The application also provides application of the molecular marker gene FfIdnDH in identification of the sweet potato root rot pathogen Fusarium foetens.

[0019] The application also provides application of the primer pair in molecular marker assisted identification of the sweet potato root rot pathogen.

[0020] Further, the sweet potato root rot pathogen is Fusarium foetens.

[0021] Compared with the prior art, the application has the beneficial effects that:

[0022] 1. The application provides a sweet potato root rot pathogen molecular marker gene FfIdnDH, a primer pair, a detection method and application, the molecular marker gene FfIdnDH and the primer provided by the application can identify the sweet potato root rot pathogen Fusarium foetens, and the accuracy rate reaches 100%.

[0023] 2. The sweet potato root rot pathogen molecular marker gene FfIdnDH in the application exists specifically in F. foetens, and thus identification of the fungus F. foetens is facilitated. Meanwhile, laboratory detection by using the molecular marker can avoid problems such as Indel induction comparison and potential insufficient phylogenetic resolution caused by traditional ITS identification. The molecular marker FfIdnDH provided by the application exists specifically in F. foetens, and greatly improves the identification efficiency of F. foetens.

[0024] 3. The application also provides a sweet potato root rot pathogen DX94, which is identified as Fusarium foetens, and provides a strain basis for research on the occurrence mechanism of the sweet potato root rot and screening of a biocontrol bacterium.

[0025] Biological material preservation information description

[0026] DX94, referred to as sweet potato root rot pathogen DX94 in the present application, has been preserved in the China Center for Type Culture Collection on September 4, 2023, with a preservation number of CCTCC NO: M 20231589, and the address of the preservation unit is Wuhan University, Luojia Hill Road 16, Wuchang District, Wuhan City, Hubei Province, China, with a postcode of 430072, and is classified as Fusarium sp. DX94. BRIEF DESCRIPTION OF DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0028] Figure 1 It is a Venn diagram of shared and unique homologous gene clusters of 14 F. oxysporum species complexes in the present application; the central value represents the number of conserved families in the 14 F. oxysporum species complexes, and the value of the tip represents the number of conserved unique families in each species.

[0029] Figure 2 It is the sequence structure of FfIdnDH and the multiple sequence alignment of IdnDH in DX94 and other Fusarium.

[0030] In the figure, A is the sequence structure of FfIdnDH in the present application;

[0031] B is the multiple sequence alignment of IdnDH in DX94 and other Fusarium; F: forward specific marker primer of FfIdnDH; R: reverse specific marker primer of FfIdnDH.

[0032] Figure 3 It is a phylogenetic tree of the strains isolated in the present application.

[0033] Figure 4 It is the verification result of the identification of F. foetens;

[0034] Ffb1, DX94, Ffb2 belong to F. foetens; Fsb1 and Fsb2 belong to F. solani; Fib belongs to F. incarnatum-equiseti; Fcb belongs to F. chlamydosporum; Atb belongs to Aspergillus terreus; Rsb belongs to Rhizopus stolonifera. DETAILED DESCRIPTION

[0035] The specific embodiments of the present application are described in detail below, but it should be understood that the scope of protection of the present application is not limited by the specific embodiments. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application. The experimental methods described in the embodiments of the present application are conventional methods, and the materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0036] Example 1: A sweet potato root rot pathogen Dx94 and screening of a molecular marker gene FfIdnDH thereof.

[0037] I. Experimental materials

[0038] 1. Test plants: Beijing Daxing sweet potato root rot disease Longshu 9 plants;

[0039] II. Experimental methods

[0040] 1. Isolation and screening of sweet potato root rot pathogen strains

[0041] The sweet potatoes used in the present application were collected from the sweet potato research base in Daxing District, Beijing, in 2020. Plants with typical root rot symptoms (Longshu 9 plants with sweet potato root rot) and healthy plants were collected at the seedling stage, together with soil, and brought back to the laboratory for storage in a 4℃ refrigerator. The diseased plants were washed clean, and small pieces of about 2cm were cut from the root diseased tissue area with a sterile knife. The pieces were soaked in 75% alcohol for 10 minutes to kill the surface saprophytic bacteria, then the epidermis was removed, and the pieces were cut into small pieces of about 0.5cm in size. The pieces were gently brushed over an alcohol lamp flame and placed in a pre-prepared plate, 4-5 pieces per plate. The plates were then placed in a 25℃ incubator. After the colonies grew, the fungal bodies were picked and examined under a microscope. The fungus was transferred to a new PDA plate and purified several times. During the purification process, appropriate antibiotics such as chloramphenicol were added to the culture medium to prevent bacterial contamination during the culture process.

[0042] Through the above screening and isolation steps, 6 strains of pathogenic fungi Ffb1, Dx94, Ffb2, Fsb1, Fib and Fsb2 were finally isolated.

[0043] 2. Identification of sweet potato root rot pathogen

[0044] The ITS molecular identification of the isolated strains Ffb1, Dx94, Ffb2, Fsb1, Fib and Fsb2 respectively found that Ffb1, Dx94 and Ffb2 were Fusarium foetens; Fsb1 and Fsb2 were F. solani; and Fib was F. incarnatum-equiseti. The Dx94 strain was preserved.

[0045] 3. A screening method of a molecular marker gene FfIdnDH of a sweet potato root rot pathogen Fusarium foetens

[0046] (1) The Dx94 strain of the present application was aligned with the genomes of 13 Fusarium species in Table 1 (NCBI). According to the assembly data of these genomes, OrthoFinder based on sequence similarity alignment principle was used to identify the homologous gene clusters of DX94 in 13 genome sequenced FOSC species, and self-written scripts were used to process and statistics the core and specific orthologous gene clusters of the identified 14 species. Ten individual-specific gene clusters of DX94 were screened, and the results are shown in Figure 1

[0047] Table 1 13 kinds of fusarium related information (NCBI)

[0048] Number Name in NCBI Accession number 1 Fusarium odoratissimum GCA_026745425.1 2 Fusarium oxysporum Fo47 GCA_013085055.1 3 Fusarium oxysporum NRRL 32931 GCF_000271745.1 4 Fusarium oxysporum f.sp.albedinis GCA_026229875.1 5 Fusarium oxysporum f.sp.cepae GCA_003615095.1 6 Fusarium oxysporum f.sp.conglutinans GCA_018894095.1 7 Fusarium oxysporum f.sp.matthiolae GCA_020796175.1 8 Fusarium oxysporum f.sp.narcissi GCA_004141715.1 9 Fusarium oxysporum f.sp.pisi HDV247 GCA_000260075.2 10 Fusarium oxysporum f.sp.radicis-cucumerinum GCA_001702695.2 11 Fusarium oxysporum f.sp.radicis-lycopersici 26381 GCA_000260155.3 12 Fusarium oxysporum f.sp.rapae GCA_019157295.1 13 Fusarium oxysporum f.sp.raphani GCA_019157275.1

[0049] Among the 10 individual-specific genomes, there are almost no homologous genes with other F. oxysporum (Fusarium oxysporum) species complexes, including FfIdnDH, as shown in Figure 2 A and B of;

[0050] Figure 2 A of shows the gene structure of FfIdnDH. As can be seen from the figure, FfIdnDH has a PRK09880 super family domain at 628-762 bases;

[0051] Figure 2 B of shows the homologous sequence alignment of FfIdnDH in other F. oxysporum. As can be seen from the figure, the homology with other F. oxysporum is low at 415-873 bases, with a length of 459 bp, which is recorded as SEQ ID NO. 5. The sequence shown in SEQ ID NO. 5 is selected to design primers.

[0052] The nucleotide sequence of the screened gene FfIdnDH is shown in SEQ ID NO. 1;

[0053] SEQ ID NO. 1:​

[0054] ATGGATTTCACTCTTCTTGCTATCGAGTACAAGAACTTTTTCGTCTGGCAGCAGGGCCTTAAAGTGGTCACGTATTCGATCAAGCTGAAGTTTGAATTTGCCGTGCTCGGTGAATTCGTTGACTTTATTCGTCATCACGGAGGAGCCCAGTCAGGTTCTTACCGTGACTATTGTAACACAGCTGCTTTTGTGGAGCTCTCTGCTGTTGGCAATGGTGACAACAAGGGTTCCAGCAACAAGATGTATCCTGCGCAGCGAAAAGACACTCAGAATAATACGGCCATTGTTGCTTCAAAAGCGAAGCCAGATGATGCTGCGAGTGATGAGATCCGTGTTATTTCCAGGGTTGATGTGGAAAGCTTGTCCGCCTTTCCTCGGGAAGATCAGAGCACTGATGAGTTAATGTTGCACATTAATGACATCTGGGACCGTACCGAGAAGGTGCTCTATCTGTTAATGGACCTTGCCCTGAATTCAGCTTTTCTCCACAAGGTCAGGCGCGAACTGATAGCCGAAGGCCTGACAAAATATAAGCTGCTCTTTAACTTCAACGTCAGCGTCGTTGTCATCTCTCTATCCATGGACATCCTAATAATAGTCATGATGTCGTTGCCGAACCCTTTCCTCTACGCCGTTTTCCATCCAGTGGCCTATAGTGTCAAACTTATCATTGAAATCATAATGGCCGATCTAATTGCGAAGATCGTCCAGAGCCAGAACGAGCTAAAAAGTTACCGGAGCGCCGCCAATACCAACAGCAACACGGTTCCTGAGCTGCGCATGTGGGATCACACTGCCAACGACAGTGAGATCTGCAAGGCAGAAGCGTCGACTGCCCACTGTACAACGGAAGTGGTGTTGAGACAAGCTTAG

[0055] SEQ ID NO.5:

[0056] AATGACATCTGGGACCGTACCGAGAAGGTGCTCTATCTGTTAATGGACCTTGCCCTGAATTCAGCTTTTCTCCACAAGGTCAGGCGCGAACTGATAGCCGAAGGCCTGACAAAATATAAGCTGCTCTTTAACTTCAACGTCAGCGTCGTTGTCATCTCTCTATCCATGGACATCCTAATAATAGTCATGATGTCGTTGCCGAACCCTTTCCTCTACGCCGTTTTCCATCCAGTGGCCTATAGTGTCAAACTTATCATTGAAATCATAATGGCCGATCTAATTGCGAAGATCGTCCAGAGCCAGAACGAGCTAAAAAGTTACCGGAGCGCCGCCAATACCAACAGCAACACGGTTCCTGAGCTGCGCATGTGGGATCACACTGCCAACGACAGTGAGATCTGCAAGGCAGAAGCGTCGACTGCCCACTGTACAACGGAAGTGGTGTTGAGACAAGCTTAG

[0057] The nucleotide sequence of the protein encoded by the molecular marker gene FfIdnDH is shown as SEQ ID NO. 2.

[0058] SEQ ID NO. 2:

[0059] MDFTLLAIEYKNFFVWQQGLKVVTYSIKLKFEFAVLGEFVDFIRHHGGAQSGSYRDYCNTAAFVELSAVGNGDNKGSSNKMYPAQRKDTQNNTAIVASKAKPDDAASDEIRVISRVDVESLSAFPREDQSTDELMLHINDIWDRTEKVLYLLMDLALNSAFLHKVRRELIAEGLTKYKLLFNFNVSVVVISLSMDILIIVMMSLPNPFLYAVFHPVAYSVKLIIEIIMADLIAKIVQSQNELKSYRSAANTNSNTVPELRMWDHTANDSEICKAEASTAHCTTEVVLRQA

[0060] 4. Designing primers according to the FfIdnDH gene screened

[0061] Based on the 415-873bp sequence (SEQ ID NO.5) of the obtained FfIdnDH gene, upstream primer FfIdnDH-F and downstream primer FfIdnDH-R were designed;

[0062] The upstream FfIdnDH-F nucleotide sequence is shown in SEQ ID NO.3;

[0063] SEQ ID NO.3: 5'-AATGACATCTGGGACCGTACC-3';

[0064] The nucleotide sequence of the downstream primer FfIdnDH-R is shown in SEQ ID NO.4;

[0065] SEQ ID NO. 4: 5'-CTAAGCTTGTCTCAACACCACTTC-3'.

[0066] Example 2: Identification of the strain Fusarium foetens using primers containing the molecular marker gene FfIdnDH for sweet potato root rot pathogen.

[0067] I. Experimental Materials

[0068] 1. Test strains

[0069] a. The strains isolated in this invention: Ffb1, Dx94 and Ffb2 all belong to Fusarium foeten (abbreviated as F. foetens); Fsb1 and Fsb2 are both Fusarium solani; Fib belongs to Fusarium incarnatum-equiseti.

[0070] b. Purchased strains:

[0071] Fusarium chlamydosporum was purchased from Shanghai Fusheng Industrial Co., Ltd. (item number FS-J4262), and is referred to as Fcb in this invention;

[0072] Aspergillus terreus 1394, purchased from the China Center for Type Culture Collection, accession number CCTCC AF 2017011, is referred to as Atb in this invention;

[0073] Rhizopus stolonifera was purchased from Beijing Bio-Bio Biotechnology Co., Ltd. (Platform No.: Bio-66635), and is referred to as Rsb in this invention.

[0074] II. Experimental Methods

[0075] 1. Phylogenetic tree construction

[0076] The ITS sequences of strains Ffb1, Dx94, Ffb2, Fsb1, Fib and Fsb2 isolated in Example 1 were amplified by PCR using universal primers ITS1 and ITS4 as primers, and the phylogenetic tree was constructed after sequencing.

[0077] 2. Identification of Fusarium foetens using primer pair FfIdnDH-F and FfIdnDH-R

[0078] (1) The strains to be identified were Ffb1, Dx94, Ffb2, Fsb1, Fsb2, Fib, Fcb, Atb and Rsb.

[0079] (2) The specific steps are as follows:

[0080] a. DNA extraction: The DNA of the 9 strains was extracted by CTAB method;

[0081] The 9 strains were Ffb1, Dx94, Ffb2, Fsb1, Fsb2, Fib, Fcb, Atb and Rsb.

[0082] b. The DNA of the above 9 strains was used as a template, and the upstream primer FfIdnDH-F and the downstream primer FfIdnDH-R were used for PCR amplification, respectively.

[0083] PCR amplification reaction system: 25 μL 2x Es Taq MasterMix (Dye), 2 μL FfIdnDH-F 10 μM, 2 μL FfIdnDH-R 10 μM, Template DNA <0.5 μg, ddH2O to 50 μL.

[0084] PCR program: 94°C pre-denaturation for 2 min; 94°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles; 72°C extension for 2 min.

[0085] PCR product detection: prepare 1% agarose gel, add appropriate amount of EB, add 10 μL 6x Loading buffer to the PCR product, stir and add to the pores of the agarose gel, electrophorese at 120 V for 20 min, and analyze the result band with gel imaging.

[0086] III. Experimental results

[0087] 1. Phylogenetic tree construction

[0088] The results are as follows Figure 3As shown in the phylogenetic tree, the phylogenetic relationships among the strains isolated in this invention are as follows: Ffb1, DX94, and Ffb2 belong to Fusarium foeten; Fsb1 and Fsb2 belong to Fusarium solani; and Fib belongs to Fusarium incarnatum-equiseti.

[0089] 2. Identification results of strains using primer pairs FfIdnDH-F and FfIdnDH-R

[0090] The results are as follows Figure 4 As shown, only the agarose gel electrophoresis results using DNA from strains Ffb1, DX94, and Ffb2 as templates showed a band at 459 bp, while the others did not amplify any fragments. This indicates that the specific fragment of FfIdnDH (SEQ ID NO. 5) is specifically present in Fusarium foeten. Therefore, the FfIdnDH gene can be used as a marker gene for Fusarium foeten.

[0091] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0092] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A method for identifying the pathogen of root rot of sweet potato, characterized by, Fusarium foetens comprising the steps of: ​​ DNA of the test strain isolated from sweet potato plants having symptoms of root rot was extracted as a template, and PCR amplification was performed using a nucleotide sequence as shown in SEQ ID NO. 3 Ff IdnDH a -F primer, and a nucleotide sequence as shown in SEQ ID NO. 4 Ff IdnDH a -R primer PCR amplification products were subjected to agarose gel electrophoresis, showing that a 459 bp band was amplified, i.e. the strain to be tested was Fusarium foetens .

2. The method for identifying the pathogen of sweet potato root rot according to claim 1, characterized in that, Fusarium foetens PCR amplification reaction system: 25 μL 2x Es Taq MasterMix, 2 μL Ff IdnDH - F 10 μM, 2 μL Ff IdnDH - R 10 μM, Template DNA <0.5 μg, ddH2O supplemented to 50 μL. ​ 3. The use of a primer pair in the identification of the pathogen of sweet potato root rot in molecular marker assisted selection, characterized in that, The primer pair comprises the -F primer and the -R primer shown in SEQ ID NO. 4 Ff IdnDH The -F primer and the -R primer shown in SEQ ID NO. 4 Ff IdnDH The -F primer and the -R primer shown in SEQ ID NO. 4 The application is: extracting DNA of the test strain separated from sweet potato plants with root rot symptoms as a template, using the nucleotide sequence as shown in SEQ ID NO. 3 Ff IdnDH -F primer and the sequence as shown in SEQ ID NO. 4 Ff IdnDH -R primer for PCR amplification; PCR amplification products were subjected to agarose gel electrophoresis, showing that a 459 bp band was amplified, i.e. the strain to be tested was Fusarium foetens ; The sweet potato root rot pathogen is Fusarium foetens .