A lycopene preparation and its preparation method

Abstract

This invention provides a method for preparing a lycopene preparation, comprising: A) mixing a lycopene solution and milk exosomes, incubating, centrifuging, and obtaining a supernatant; B) ultracentrifuging the supernatant, resuspending the precipitate, and centrifuging again to obtain exosomes encapsulating lycopene. This invention employs a combination of tangential flow membrane filtration and size exclusion chromatography to separate and purify milk exosomes, resulting in good stability of the lycopene-loaded exosomes. This invention discloses the use of milk exosomes to load lycopene for use as an oral nutritional supplement or health food, overcoming the problems of lycopene's insolubility in water, low bioavailability, poor stability, and degradation by gastric acid and intestinal enzymes. It can be used for anti-oxidation, prevention and treatment of cerebrovascular diseases, metabolic diseases, etc.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to a lycopene preparation and its preparation method. Background Technology

[0002] Lycopene (LYC) is a natural pigment found in plants, belonging to the non-oxygenated carotenoid family. The molecular formula of lycopene is C2. 40 H 56 Lycopene has a molecular weight of 536.85 Da. Its molecular structure is a straight-chain hydrocarbon composed of 11 conjugated double bonds and 2 non-conjugated double bonds. Lycopene is one of the strongest antioxidants in nature, with an antioxidant capacity 3.2 times that of carotene and 100 times that of vitamin E. It has antioxidant, cardioprotective, lipid-lowering, anti-tumor, photoprotective, antibacterial, and anti-diabetic effects. Lycopene is classified as a Group A nutrient by the World Health Organization and is widely used in many fields such as food coloring, health foods, pharmaceuticals, and cosmetics, and is even called "plant gold."

[0003] Lycopene plays an important role in human physiological and pathological processes and is widely present in the human body, such as in blood, adrenal glands, liver, testes, prostate, breasts, ovaries, uterus, and digestive tract. However, the human body cannot produce lycopene and must obtain it from the diet.

[0004] Lycopene is found in fruits and vegetables such as tomatoes, carrots, watermelons, and guavas, with tomatoes having the highest content. Lycopene is insoluble in water and poorly soluble in highly polar organic solvents such as methanol and ethanol. It is chemically very reactive and easily oxidized and decomposed by factors such as oxidation, ultraviolet light, temperature, and humidity, which affects its bioavailability and nutritional efficacy.

[0005] Currently, various processes and dosage forms exist to enhance the solubility and stability of lycopene. Nanoparticle formulations are considered the most promising method, including nanoemulsions (NE), liposomes, niosomes (NI), nanostructured lipid carriers (NLC), and solid lipid nanoparticles (SLN). Nanoparticle technology increases the solubility of lycopene, improves stability, and masks unpleasant odors. However, nanoparticle technology also suffers from low loading capacity, complex preparation processes, poor stability and reproducibility, high cost, and low yield. Furthermore, the preparation process requires surfactants, which pose potential toxicity and food safety concerns; surfactants may also affect the bioactivity of lycopene. Therefore, more efficient and safer loading methods are needed.

[0006] Exosomes (Exo) are nanoscale (30-150 nm) lipid vesicles generated by living cells. They can be used not only to load proteins, nucleic acids, metabolites, and small molecule drugs, but also, by modifying the proteins or lipids on their membrane surface, endow them with characteristics such as targeting, immune blocking, evasion of reticuloendothelial phagocytosis, and cellular uptake. Following viruses and liposomes, exosomes are considered the "third-generation carrier," possessing advantages such as low immunogenicity, high bioavailability, high drug loading efficiency, and the ability to cross biological barriers (including the intestinal mucosal barrier). Exosomes have become one of the most promising drug carriers.

[0007] Currently, the vast majority of lycopene dosage forms on the market are capsules. Stable formulations mainly include inclusion complexes and microcapsules prepared with various dextrins, proteins, and starches as excipients, as well as microemulsions and liposomes prepared with small molecule lipids and phospholipids as carriers. Although physical protection through capsules can prevent oxidation, it is still subject to degradation by gastrointestinal chemistry (gastric acid) and biology (intestinal enzymes) in vivo, resulting in low bioavailability. New microencapsulation technologies, including the aforementioned nanoemulsions, liposomes, lipid vesicles, nanostructured lipid carriers, and solid lipid nanoparticles, all involve chemical synthesis methods and pose potential toxicity issues. They also face challenges such as high cost and complex operation.

[0008] Exosomes are natural carriers with advantages such as low immunogenicity, good biocompatibility, and high stability. However, most current methods utilize stem cell secretion of exosomes, which presents challenges due to complex preparation and high costs. Ultracentrifugation is the most common method for exosome isolation and purification, but it is insufficient because oral nutrient administration requires large doses of exosomes.

[0009] Therefore, it is essential to develop a new carrier to prepare more stable lycopene formulations. Summary of the Invention

[0010] In view of this, the technical problem to be solved by the present invention is to provide a method for preparing a lycopene preparation, wherein the lycopene preparation prepared by the present invention has good stability.

[0011] This invention provides a method for preparing a lycopene preparation, comprising:

[0012] A) Mix lycopene solution and milk exosomes, incubate, centrifuge, and obtain the supernatant;

[0013] B) Centrifuge the supernatant at high speed, resuspend the precipitate, and centrifuge again to obtain exosomes containing lycopene.

[0014] The method for preparing lycopene preparations provided by this invention first involves preparing milk exosomes.

[0015] The method for preparing milk exosomes according to the present invention is as follows:

[0016] a) After milk pretreatment, it is filtered through a tangential flow membrane to obtain a concentrated sample after tangential flow membrane filtration;

[0017] b) After tangential flow membrane filtration and concentration, the sample was separated and purified by chromatography column to obtain milk exosomes.

[0018] This invention does not limit the type of milk used; any milk well-known to those skilled in the art is acceptable. The exosomes used as lycopene carriers in this invention are derived from milk, which can be untreated raw milk or pasteurized milk. Fresh raw milk is preferred. Besides cow's milk, the milk raw materials used for exosome extraction can also be bovine colostrum, yak milk, goat milk, camel milk, or even human milk.

[0019] The accurate description of "milk exosomes" should be "milk-derivedexosome-like nano-vesicles." Their size ranges from 30 to 1000 nm, and different separation and purification methods can result in different particle size ranges, such as 80-200 nm or 100-150 nm. Exosome size is measured using methods such as nanoparticle tracking analysis (NTA) or dynamic light scattering (DLS).

[0020] The milk first undergoes pretreatment. Specifically, the pretreatment involves centrifugation to remove the upper layer of lipids and cell debris, resulting in a supernatant. The supernatant is then adjusted to pH and incubated, followed by another centrifugation, and finally filtered through a membrane.

[0021] First, the milk is stored at 4℃, centrifuged at 1500g for 30 minutes, and the supernatant is removed by pouring or filtering with filter paper. The precipitate is discarded, and the supernatant is transferred to a new centrifuge tube. The above steps are repeated to completely remove fat, cells, and cell debris from the milk. After defatting, 10% citric acid solution is added to the milk supernatant until the pH reaches 4.6, and the mixture is incubated at room temperature for 10 minutes. The mixture is then centrifuged at 10000g for 15 minutes, the precipitate is discarded, and the supernatant is filtered through a membrane. The membrane is a mixed cellulose (MCE) microporous membrane with a pore size of 0.22–1 μm. Membranes of 1.0 μm, 0.45 μm, and 0.22 μm are also used. These membranes can remove larger protein aggregates and cell debris.

[0022] The milk pretreatment methods described in this invention include, but are not limited to, acidification, enzymes, and chelating agents. Acidification can be achieved using acetic acid, hydrochloric acid, citric acid, etc., with citric acid being preferred. Enzymatic treatment includes lactogenases such as papain, pepsin, lipase, etc., with papain being preferred. Ca2+ chelating agents include ethylenediaminetetraacetic acid (EDTA), ethylene glycol ditetraacetic acid (EGTA), etc. One or more of these methods can be used in combination.

[0023] The pretreated milk was filtered through a tangential flow membrane to obtain a concentrated sample after tangential flow membrane filtration.

[0024] First, drain the system's storage solution, rinse with deionized water, then rinse the hollow fiber column with equilibration buffer before loading the pretreated milk sample. The hollow fiber column has a specification of 750 kDa.

[0025] In one preferred embodiment of the present invention: continuous fluid replacement is performed using a equilibration buffer (the replacement volume is set at 500 ml, and replenishment is performed when the volume is less than 500 ml). The filtration flow rate is 10 ml / min. This continues until the permeated protein concentration reaches 0.00 mg / ml. After the permeated protein concentration reaches 0.00 mg / ml, the 500 ml solution in the cup is further concentrated to 1 / 20 of its original volume.

[0026] The tangential flow membrane filtration parameters described in this invention are specifically as follows:

[0027] TMP maximum pressure 2 bar, alarm pressure 2 bar, minimum volume 200 ml, alarm volume 200 ml;

[0028] After tangential flow membrane filtration and concentration, the sample was separated and purified by size exclusion chromatography to obtain milk exosomes.

[0029] The chromatography column separation and purification method described in this invention specifically involves: column equilibration, elution, and collection of each component, wherein the eluent is sterile PBS buffer; the elution flow rate is 15 ml / min; and the components containing mEV are identified by combining BCA protein quantification and Western blotting.

[0030] In a preferred embodiment of the present invention: the AKTA Pure chromatography system is connected to a Sephacryl S-500-HR column to purify the concentrated sample after tangential flow membrane filtration. The operation steps are as follows:

[0031] Rinse the AKTA chromatography system: Filter with ultrapure water and degas ultrasonically, then rinse with ultrapure water at a flow rate of 2 ml / min. Rinse with ultrapure water for three column volumes after each column. The column used was a Sephacryl S-500-HR column.

[0032] Equilibrate three column volumes (CV) with equilibration buffer (1×PBS). Column loading, elution, and collection: Collect the eluted sample and each fraction using sterile PBS buffer at a flow rate of 15 ml / min. Perform BCA protein quantification and Western blotting to identify fractions containing mevalonous volatile organic compounds (mEVs). Mix and concentrate the mEV-containing fractions for subsequent experiments. After collection, wash the system with ultrapure water at a flow rate of 2 ml / min for all three column volumes. Wash the three column volumes sequentially with elution buffer (30% ethanol + 1M NaOH), pure water, and 20% ethanol. Afterward, remove the column and store at 4°C.

[0033] Milk exosomes can be separated using methods not limited to: ultracentrifugation, density gradient centrifugation, chemical reagent precipitation, ultrafiltration, tangential flow membrane filtration, size exclusion chromatography, magnetic bead immunoaffinity separation, microfluidics, etc. Large-scale separation and purification methods, such as tangential flow membrane filtration and size exclusion chromatography, are preferred. A combination of tandem tangential flow membrane filtration and size exclusion chromatography is also preferred. The exosome separation technology described in this invention can obtain high yields of exosomes, extracting g-level exosomes per liter of milk, with a specific yield exceeding 2 g / L.

[0034] After obtaining milk exosomes, lycopene solution and milk exosomes were mixed, incubated, and centrifuged to obtain supernatant.

[0035] The lycopene solution of this invention is lycopene dissolved in ethanol; the concentration of the ethanol is 20%. The concentration of lycopene in the lycopene solution is 6-10 mg / mL; preferably 10 mg / mL.

[0036] The above-mentioned lycopene alcohol solution was added to the milk exosome solution and mixed thoroughly. The concentration of the milk exosome solution was 12 mg protein / mL. The volume ratio of the lycopene solution to the milk exosomes was 1:1.

[0037] Incubate at room temperature for 15 min. Centrifuge at 10000g for 10 min to remove unbound lycopene and aspirate the supernatant. Centrifuge the supernatant at 135000g for 90 min, discard the supernatant, separate the lycopene-loaded exosomes, and remove the alcohol. Resuspend the precipitate in PBS buffer, centrifuge at 10000g for 10 min, and aspirate the supernatant.

[0038] The supernatant was filtered through a 0.22μm membrane to remove bacteria, and exosomes encapsulating lycopene were obtained, which are mExo-LYC.

[0039] The present invention provides methods for loading lycopene into milk exosomes, including but not limited to: co-incubation, electroporation, ultrasound, repeated freeze-thaw cycles, saponin reagent method, and extrusion method. The preferred method is co-incubation with an alcohol solution, using food-grade alcohol at a concentration not exceeding 10%. The loading rate can reach 10-55%.

[0040] The nutrients loaded into the aforementioned milk exosomes, besides lycopene, can also be other types of phytochemicals, including but not limited to curcumin, demethoxycurcumin, cyanidin, delphinidin, bilberry antocyanidins, resveratrol, tanshinone, gallate, epigallocatechin, quercetin, myricetin, kaempferol, icariin, triptolide, cucurbitacin, and celastrol. It can also be loaded with chemotherapy drugs, such as doxorubicin, paclitaxel, docetaxel, camptothecin, and vincristine. The loaded drug or nutrient can be a single substance, or two or more molecules can be loaded simultaneously, such as lycopene and vitamin E.

[0041] The present invention also provides a lycopene preparation, which is prepared by any one of the preparation methods described in the above technical solutions.

[0042] This invention employs a combination of tangential flow membrane filtration and size exclusion chromatography to separate and purify milk exosomes, thereby achieving good stability in loading lycopene.

[0043] This invention discloses the use of milk exosomes to load lycopene for oral nutritional supplements or health foods, overcoming the problems of lycopene's insolubility in water, low bioavailability, poor stability, and degradation by gastric acid and intestinal enzymes. It can be used for anti-oxidation, prevention and treatment of cerebrovascular diseases, metabolic diseases, etc. Attached Figure Description

[0044] Figure 1 To observe milk exosomes using a transmission electron microscope;

[0045] Figure 2 To determine the particle size of milk exosomes using NTA;

[0046] Figure 3 These are the results of an in vitro release experiment;

[0047] Figure 4Number of mExo-LYC particles in mouse peripheral blood: nanoFCM was used to detect the number of fluorescently labeled microparticles in blood samples;

[0048] Figure 5 HE staining image of colitis tissue;

[0049] Figure 6 This describes changes in gene expression levels in mouse colon tissue. Detailed Implementation

[0050] This invention provides a lycopene preparation and its preparation method. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and fall within the scope of protection of this invention. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the method and application described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0051] To further illustrate the present invention, the following describes in detail, with reference to embodiments, a lycopene preparation and its preparation method provided by the present invention.

[0052] Example 1: Preparation of milk exosomes

[0053] 1.1 Fresh milk pretreatment (skimming and casein removal):

[0054] 1) Fresh milk should be stored at 4℃;

[0055] 2) Centrifuge at 1500g for 30 minutes, then pour off the upper layer of lipids [or filter with filter paper];

[0056] 3) Discard the precipitate and transfer the supernatant to a new centrifuge tube.

[0057] 4) Repeat steps 2) and 3) a total of three times to completely remove fat, cells, and cell debris from the milk;

[0058] 5) After defatting, add 10% citric acid solution to the supernatant of the milk until the pH reaches 4.6, and incubate at room temperature for 10 minutes;

[0059] 6) Centrifuge at 10000g for 15 minutes, then discard the precipitate;

[0060] 7) The supernatant was filtered through mixed cellulose (MCE) microporous membranes with diameters of 1.0 μm, 0.45 μm and 0.22 μm, respectively.

[0061] 2.2 Preliminary purification of milk exosomes (tangential flow membrane filtration)

[0062] 1) Set the AKTA Flux system parameters: TMP maximum pressure 2 bar, alarm pressure 2 bar, minimum volume 200 ml, alarm volume 200 ml.

[0063] 2) First, drain the system's preservation solution, rinse with deionized water (ddH2O), then rinse the hollow fiber column (750kDa Dros FloFiltor, Repligen) with equilibration buffer (1×PBS solution), and then load the pretreated milk sample.

[0064] 3) Perform continuous fluid replacement with equilibration buffer (set replacement volume to 500 ml, replenish fluid if it falls below 500 ml), filtration flow rate 10 ml / min. Continue until the protein concentration is reduced to 0.00 mg / ml.

[0065] 4) After the permeate protein reaches 0.00 mg / ml, continue to concentrate the 500 ml solution in the cup to 1 / 20 of the original volume.

[0066] 2.3 Purification of milk exosomes (size exclusion chromatography)

[0067] The AKTA Pure chromatography system was connected to a Sephacryl S-500-HR column. The sample was purified by tangential flow membrane filtration and concentration, and the steps are as follows:

[0068] 1) Rinse the AKTA chromatography system: Filter with ultrapure water and degas using sonication, then rinse with ultrapure water at a flow rate of 2 ml / min. After installing the SephacrylS-500-HR column, rinse with ultrapure water for 3 column volumes.

[0069] 2) Equilibrate 3 column volumes (CV) with equilibration buffer (1×PBS).

[0070] 3) Column elution and collection process: Elute with sterile PBS buffer at a flow rate of 15 ml / min, and collect the eluted sample.

[0071] 4) Collect all components, perform BCA protein quantification and Western blotting to identify components containing mExo. Mix and concentrate the components containing mExo for subsequent experiments.

[0072] 5) After collection, wash the system with ultrapure water at a flow rate of 2 ml / min for three column volumes. Then, wash with eluent (30% ethanol + 1M NaOH), pure water, and 20% ethanol for three column volumes each. After completion, remove the column and store it at 4°C.

[0073] The exosomes purified in Example 1 of this invention were isolated and their morphology was observed using transmission electron microscopy (TEM), and their particle size and distribution were determined using a particle size analyzer (NTA). High-performance liquid chromatography (HPLC) was used to determine the content of impurity proteins (exosome purity), and Western blot was used to detect surface protein markers. The results are as follows: Figure 1 The above, Figure 1 For observation of milk exosomes under transmission electron microscopy: the milk exosomes (arrows) are shown to be "tray-shaped" or "cup-shaped", with few particulate impurities in the field of view, indicating that the exosomes obtained by this method with TFF+SEC have good purity. Figure 2 Milk exosomes were measured for NTA: the average particle size was 66.8 nm, and the yield of milk exosomes was calculated to be 2.2 × 10⁻⁶. 13 Particles / L [Compared to ultracentrifugation + density gradient centrifugation, exosome yield is 2.5 × 10⁻⁶] 12 Particles / L

[0074] Example 2: Lycopene loaded onto milk exosomes

[0075] 1) Dissolve lycopene in 20% alcohol (food grade) to prepare a lycopene solution of 10 mg / ml.

[0076] 2) Add the above lycopene alcohol solution to an equal volume of milk exosome solution (12 mg protein / ml) and mix well. Incubate at room temperature for 15 min.

[0077] 3) Centrifuge at 10000g for 10 minutes [to remove unbound lycopene], and aspirate the supernatant.

[0078] 4) Centrifuge the supernatant at 135,000g for 90 minutes, then discard the supernatant [to separate the exosomes loaded with lycopene and remove alcohol].

[0079] 5) Resuspend the precipitate in PBS buffer, centrifuge at 10000g for 10 min, and aspirate the supernatant.

[0080] 6) The supernatant was sterilized by filtration through a 0.22 μm membrane to obtain exosomes encapsulating lycopene [mExo-LYC].

[0081] Stability analysis of Example 1

[0082] Stability analysis of lycopene-loaded milk exosomes prepared in Example 2

[0083] 1) Lycopene milk exosomes (mExo-LYC) were diluted to 1 mg / ml with Fed-State Simulated Gastric Fluid (FeSSGF) and incubated at 37°C for 2 h.

[0084] 2) Dilute mExo-LYC to 1 mg / ml with Fed-State Simulated Intestinal Fluid (FeSSIF) and incubate at 37°C for 4 hours.

[0085] 3) The particle size analyzer (NTA) was used to measure the changes in mExo-LYC particle size and PDI before and after treatment. The results are shown in Table 1.

[0086] Table 1. Stability of mExo-LYC in simulated gastric and intestinal fluids

[0087]

[0088] Verification Example 2

[0089] Example 2: In vitro release experiment of lycopene milk exosomes prepared

[0090] 1) Dilute mExo-LYC to 1 mg / ml with FeSSGF (Femal Postprandial Gastric Stimulant), and incubate at 37°C for 2 h. Collect 50 μl of sample every 0.5 hours for HPLC analysis.

[0091] 2) Dilute mExo-LYC to 1 mg / ml with FeSSIF (Feed-Style Intestinal Stimulant Fluid), incubate at 37°C for 4 hours, and collect 50 μl of sample every 1.0 hour for HPLC analysis.

[0092] 3) Dilute mExo-LYC to 1 mg / ml with phosphate buffer and incubate at 37°C for 48 hours. Collect 50 μl samples at 0.5, 1, 2, 4, 8, 16, 24, 32, and 48 hours for HPLC analysis.

[0093] 4) Load 10 μl of the collected sample into UPLC. The column used was an Agilent Eclipse XDB-C18 (4.6 mm × 250 mm, 5 μm); the detection wavelength was 475 nm, the column temperature was 25 ℃, the flow rate was 1.0 mL / min, and the injection volume was 10 μL.

[0094] Figure 3 In vitro release assay results: UPLC was used to determine the LYC concentration in samples at each time point, and the percentage of lycopene released from mExo-LYC was calculated. Results description: Table 1 and... Figure 3 The results demonstrate the stability of mExo-LYC. Figure 1 The results showed that after incubation in simulated gastric and intestinal fluids for 2 hours and 4 hours, respectively, there were no significant changes in the size and dispersion index (PDI) of exosomes before and after treatment, indicating that the morphology and structure of exosomes were stable. Figure 3The results showed no significant difference in lycopene release in simulated gastric and intestinal fluids compared to the control PBS solution, indicating that neither simulated gastric nor intestinal fluids caused premature detachment or release of lycopene loaded onto exosomes. This demonstrates that oral administration of lycopene loaded onto milk exosomes exhibits good stability in the digestive tract.

[0095] Verification Example 3: In vivo absorption experiment of lycopene from milk exosomes

[0096] 1) Incubate PKH-67 dye with mExo-LYC at room temperature for 30 minutes [avoid light], then remove unbound PKH-67 dye using an SEC column.

[0097] 2) Mice were administered PKH-67-stained mExo-LYC via gavage, with each mouse receiving 4.0 × 10⁻⁶ mg. 10 Particles / g body weight.

[0098] 3) Blood samples were collected from the eyeballs at 1h, 4h, 12h, 24h, 48h, 72h and 96h after oral administration.

[0099] 4) Collect blood samples and centrifuge at 12,000 rpm for 30 minutes at 4°C, then collect the upper serum layer.

[0100] 5) Use NanoFCM to detect PKH-67-stained mExo-LYC in serum samples at each time point and calculate the number of fluorescent positive particles in the blood (to calculate the amount of mExo absorbed into the blood). Figure 4 Number of mExo-LYC particles in mouse peripheral blood: The number of fluorescently labeled particles in blood samples was detected by nanoFCM. Results showed that orally administered milk exosomes were absorbed into the bloodstream, peaking at 24 hours and then gradually decreasing. Fluorescently labeled exosome particles were still detectable up to 96 hours. Surface milk exosomes maintained in the bloodstream for a relatively long time and exhibited good bioavailability.

[0101] Example 4: Animal experiment to verify the treatment of enteritis with mExo-Lyc

[0102] 1. Forty healthy C57BL / 6 mice aged 6–8 weeks were housed in a relatively stable environment: temperature 23±2℃, humidity 50±20%, and a 12 / 12-h diurnal cycle.

[0103] 2. The subjects were randomly divided into 4 groups: 1) Control group: healthy controls; 2) DSS induction group: 4% dextran sodium sulfate (DSS) was added to the drinking water from day 3 to day 9 to induce an enteritis model [the DSS water was changed daily]; 3) mExo-LYC treatment group: mExo-LYC, 25mg / kg, was administered by gavage on days 1, 3, 5, 7 and 9.

[0104] 3. Observe the symptoms of the mice, including changes in weight, stool viscosity, and blood in the stool.

[0105] 4. At the end of the observation period, the patient was euthanized by intravenous administration of an overdose of pentobarbital (500 mg / kg).

[0106] 5. Collect mouse organ tissues, section them, and perform H&E staining.

[0107] 6. RT-PCR detection of gene expression related to oxidative stress and inflammation in intestinal mucosal cells: Total RNA extracted from tissue cells using a commercial TRIzol kit was used as a template. The following forward and reverse primers were used to detect iNOS, TNF-α, IL-β, and COX2 genes, with GAPDH as an internal control gene. RT-PCR reaction conditions: 95℃ pre-denaturation for 15 min, followed by 35 cycles: 94℃×15 sec, 60℃×30 sec, and 72℃×30 sec. mRNA levels were measured using 2... -ΔΔCq The method is used for calculation.

[0108] The results are as follows Figure 5 , Figure 5 HE staining of colitis tissue: normal tissue control (Ctrl), DSS-induced colitis (DSS), and milk exosome-treated DSS-induced colitis (DSS+mExo-LYC). Results showed goblet cell necrosis and crypt structure destruction in the colonic mucosa of the DSS-induced group. The mExo-LYC treatment group showed morphological similarities to the normal control, indicating a clear therapeutic effect. Results also showed that mExo-LYC significantly improved the DSS-induced colonic pathological changes.

[0109] Figure 6 Changes in gene expression levels in mouse colon tissue: mRNA expression levels were calculated using GAPDH as a reference, with the mean of the negative control group (Ctrl) as the baseline (relative expression level = 1.0).

[0110] The results showed that DSS induced increased expression of inflammatory cytokines in the intestinal mucosa, while mExo-LYC reduced gene expression (mRNA level) of inflammatory cytokines.

[0111] Table 2 RT-PCR primer sequences

[0112] Primer sequence iNOS-F GGGCTGACCTGTTTCCTACT iNOS-R GGAGGTTGAGACCCAATGGA TNF-α-F CCCTCACACTCAGATCATCTTCT TNF-α-R CTACGACGTGGGCTACAG IL-β-F TGACGGACCCCAAAAGATGA IL-β-R TCTCCACAGCCACAATGAGT Cox-2-F CCCATTAGCAGCCAGTTGTC Cox-2-R CAGGATGCAGTGCTGAGTTC GAPDH-F TGGAGAAACCTGCCAAGTATGA GAPDH-R TGGAAGAATGGGAGTTGCTGT

[0113] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing a lycopene preparation, characterized in that, include: A) Mix lycopene solution and milk exosomes, incubate, centrifuge, and obtain the supernatant; The lycopene solution is lycopene dissolved in ethanol; The concentration of lycopene in the lycopene solution is 6~10 mg / mL; The concentration of the milk exosome solution is 12 mg protein / mL; the volume ratio of the lycopene solution to the milk exosomes is 1:1; the incubation is carried out at 20-30℃ for 10-15 min; and the centrifugation is carried out at 10000g for 10 min. B) The supernatant was ultracentrifuged, the precipitate was resuspended, and centrifuged again to obtain exosomes encapsulating lycopene; the ultracentrifugation was performed at 135000g for 90 min; the resuspension was performed with PBS buffer; the second centrifugation was performed at 10000g for 10 min; the centrifugation process also included filtration through a 0.22μm membrane. The specific method for preparing the milk exosomes is as follows: a) After milk pretreatment, it is filtered through a tangential flow membrane to obtain a concentrated sample after tangential flow membrane filtration; the specific parameters of the tangential flow membrane filtration are: maximum TMP pressure 2 bar, alarm pressure 2 bar, minimum volume 200 ml, alarm volume 200 ml; hollow fiber column, the specification of the hollow fiber column is 750 kDa; filtration flow rate is 10 ml / min; b) After tangential flow membrane filtration and concentration, the sample was purified by column chromatography to obtain milk exosomes. The column chromatography purification process specifically involved: column equilibration, loading onto the column, elution, and collection of each component. The eluent was sterile PBS buffer. The elution flow rate was 15 ml / min. BCA protein quantification and Western blotting were combined to identify components containing mEVs. The column used was a Sephacryl S-500-HR column. Equilibration was performed using PBS buffer. The elution flow rate was 15 mL / min.

2. The preparation method according to claim 1, characterized in that, The preprocessing in step a) specifically includes: Centrifuge to remove cell debris and particulate matter precipitate, and obtain supernatant; adjust the pH of supernatant and incubate, centrifuge again, and filter supernatant through membrane; The incubation pH was 4.6 and the time was 10 min; the centrifugation was performed at 1500g for 30 min; the second centrifugation was performed at 10000g for 15 min; the membrane was a mixed cellulose MCE microporous filter membrane; the membrane pore size was 0.22~1 μm.

3. A lycopene preparation, characterized in that, It is prepared by the preparation method according to any one of claims 1 to 2.

Images