Oil fermentation method for improving skin-friendly feeling of vegetable oil

Abstract

The present invention provides a method for oil fermentation for improving the skin-friendly feeling of plant oils and fats, and belongs to the technical field of plant oil fermentation. The oil fermentation method is obtained by fermenting a strain that co-expresses lipase, oleate hydratase, alcohol dehydrogenase, and Baeyer-Villiger monooxygenase in a host microorganism; the host microorganism includes but is not limited to: Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, baker's yeast, Saccharomyces cerevisiae, and Pichia pastoris; the gene sequences of the lipase, oleate hydratase, alcohol dehydrogenase, and Baeyer-Villiger monooxygenase are shown in SEQ ID No.1-SEQ ID No.4, respectively. The oil fermentation method of the present invention can decompose plant oils and fats into free fatty acids, and further crack long-chain free fatty acids into short-chain free fatty acids.

Description

Technical Field

[0001] The invention relates to the field of plant oil fermentation, and in particular to an oil fermentation method for improving the skin-friendliness of plant oil. Background Art

[0002] Oils and fats are widely used as matrix materials in cosmetics, such as face creams, skin care oils, and essential oils. The use of oils and fats can reduce skin moisture loss, protect the skin barrier, improve skin dryness, and play a role in moisturizing, anti-wrinkle, and improving skin elasticity. However, due to the viscous nature of the oil itself, it will give users an unpleasant skin feel during use. More importantly, plant oils and fats have a large molecular weight and are difficult to be absorbed by the skin.

[0003] Patents CN106619231A, CN109010140A, CN116286414A, etc. disclose some methods for preparing fermented vegetable oils. Through fermentation of yeast, lactic acid bacteria or Mucor convoluta, macromolecules in the oils are decomposed into small molecules or free fatty acids. However, these technologies have common problems. First, the catalytic performance of these original bacteria is weak, so most of the oils are not decomposed after fermentation. Secondly, these fermentation processes mainly decompose oils into free fatty acids. Although the skin feel is improved, the improvement performance is limited. Based on this, it is urgent to develop a new method that can improve the skin-friendly feel of vegetable oils. Summary of the invention

[0004] In view of the above problems existing in the prior art, the present invention provides a fat fermentation method for improving the skin-friendly feel of vegetable fats. The method of the present invention can decompose vegetable fats into free fatty acids, and further crack long-chain free fatty acids into short-chain free fatty acids.

[0005] The technical solution of the present invention is as follows:

[0006] A method for fermenting vegetable oils to improve the skin-friendliness of vegetable oils, wherein a strain obtained by co-expressing lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase in a host microorganism is used to ferment the vegetable oils to be treated, thereby improving the skin-friendliness of the vegetable oils.

[0007] Preferably, the host microorganism includes, but is not limited to, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, baker's yeast, Saccharomyces cerevisiae, and Pichia pastoris.

[0008] Preferably, the source of the lipase includes, but is not limited to, Aspergillus niger, Rhodococcus, Escherichia coli, Pseudomonas, and Mycobacterium.

[0009] Preferably, the source of the oleate hydratase includes, but is not limited to, Stenotrophomonas maltophilia, Lactobacillus plantarum, and Lactobacillus paracasei.

[0010] Preferably, the source of the alcohol dehydrogenase includes, but is not limited to, Micrococcus flavus and Corynebacterium.

[0011] Preferably, the source of the Baeyer-Villiger monooxygenase includes but is not limited to: Pseudomonas putida, Pseudomonas fluorescens, and Pseudomonas aeruginosa.

[0012] Furthermore, the gene sequences of the lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase are shown in SEQ ID No.1-SEQ ID No.4 respectively.

[0013] Furthermore, the protein sequences corresponding to the lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase are shown in SEQ ID No.5 to SEQ ID No.8, respectively.

[0014] Furthermore, the oil fermentation process comprises the following steps:

[0015] S1. Seed liquid culture:

[0016] Inoculating the strain obtained by co-expressing lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase in the host microorganism into a seed culture medium for seed liquid culture;

[0017] S2. Fermentation culture:

[0018] When the seed liquid in S1 is cultured to the middle and late logarithmic stage of fermentation, it is inoculated into the fermentation medium for fermentation culture and the strain is allowed to express lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase; in the middle or late logarithmic stage of fermentation, the vegetable oil to be treated is added and the fermentation culture is continued;

[0019] S3, separation of vegetable oil after fermentation:

[0020] The sample obtained by S2 fermentation is separated into water phase and oil phase by centrifugation, filtration or extraction to obtain oil with enhanced skin-friendly feel.

[0021] Preferably, the seed culture medium includes but is not limited to LB culture medium and YPD culture medium; the fermentation culture medium includes but is not limited to LB culture medium and YPD culture medium.

[0022] The beneficial technical effects of the present invention are:

[0023] 1. The fermentation method of the present invention can achieve the change of plant oil components, thereby improving the performance of plant oils. The present invention can improve the skin-friendly feel of plant oils by fermenting and culturing plant oils using the fermentation method, and can improve the moisturizing and permeability of plant oils.

[0024] 2. The innovation of the present invention is that it can convert plant oils into short-chain fatty acids, and further apply them in plant oil fermentation, thereby improving the skin-friendly feel of plant oils. To achieve this goal, the present invention emphasizes that the conversion into short-chain fatty acids requires the tandem action of four enzymes, specifically Figure 1 As shown, lipase can convert oils into free fatty acids; oleate hydratase can undergo hydration reaction at the double bond site of fatty acids to introduce hydroxyl groups; alcohol dehydrogenase can oxidize hydroxyl groups to carbonyl groups; Baeyer-Villiger monooxygenase can oxidize the carbonyl part to produce esters. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a schematic diagram of the process of catalytic reaction of vegetable oil by the strain of the present invention. DETAILED DESCRIPTION

[0026] The present invention is described in detail below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1: Strain construction

[0028] A1. First, select lipase from Aspergillus niger, oleate hydratase from Lactobacillus plantarum, alcohol dehydrogenase from Micrococcus fischeri, and Baeyer-Villiger monooxygenase from Pseudomonas putida;

[0029] A2. The coding genes of several enzymes in A1 were synthesized by Shanghai Sangon Biotechnology Co., Ltd. after codon optimization based on the codon preference of Escherichia coli. The sequences of the synthesized lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase are shown in SEQ ID No.1-SEQ ID No.4, respectively, and the corresponding protein sequences are shown in SEQ ID No.5-SEQ ID No.8.

[0030] A3, lipase encoding gene was amplified using primers 1 and 2, oleate hydratase encoding gene was amplified using primers 3 and 4, plasmid pETDuet was digested using NcoI and BamHI, the three fragments were purified, connected using Gibson seamless cloning kit, transformed into E. coli DH5α competent cells, positive clones were screened using LB solid plates containing 100 μg / mL ampicillin, and the correctness of gene cloning was further identified by sequencing. The correct plasmid obtained was named pJJL-23-13-1.

[0031] The sequences of the primers are as follows:

[0032] Primer 1: CTTTAAGAAGGAGATATACCATGTTTTCAGGGAGGTTCGG

[0033] Primer 2: GTGGACTCCCTTTCTCTTATTTACAACAGGCACTCGCTAAT

[0034] Primer 3: ATAAGAGAAAGGGAGTCCACATGGGAGCTCTATTTATGGTAA Primer 4: CGAGCTCGAATTCGGATCCTTAGTCAAACATCTTTTTGG

[0035] A4, alcohol dehydrogenase encoding gene was amplified using primers 5 and 6, Baeyer-Villiger monooxygenase encoding gene was amplified using primers 7 and 8, plasmid pJJL-23-13-1 was digested with NdeI and KpnI, the three fragments were purified, connected using Gibson seamless cloning kit, transformed into E. coli DH5α competent cells, and the positive clones were screened using LB solid plates containing 100 μg / mL ampicillin, and the correctness of gene cloning was further identified by sequencing. The correct plasmid obtained was named pJJL-23-13-2.

[0036] The sequences of the primers are as follows:

[0037] Primer 5: ATAAGAGAAAGGGAGTCCACATGTCAGAATTTACAAGGTTC

[0038] Primer 6: TTACCAGACTCGAGGGTACCTTAACCCAGCGGGGTATCTT

[0039] Primer 7: GTATAAGAAGGAGATATACATATGTCAAGTCACACAGCTC Primer 8: GTGGACTCCCTTTCTCTTATTTAACGACGGCTGCCTTGTTG

[0040] A5. Transform pJJL-23-13-2 into E. coli BL21 (DE3) competent cells. Use LB solid plates containing 100 mg / mL ampicillin to screen positive clones, and verify the correct transformants obtained by PCR and name them JJL-23-13, which is the strain for improving the skin-friendly feel of vegetable oils provided by the present invention.

[0041] Example 2: Fermentation of vegetable oils and fats

[0042] S1. Inoculate a single colony of the strain JJL-23-13 obtained in Example 1 into 10 mL of LB medium (with ampicillin added at a final concentration of 100 μg / mL), and culture at 37° C. and 220 rpm for 12-16 h to mid-logarithmic phase to obtain a seed solution.

[0043] S2. Transfer 2 mL of seed solution to a 500 mL shake flask containing 100 mL of LB medium (with ampicillin added at a final concentration of 100 μg / mL) and culture at 37°C and 220 rpm until OD 600 Reach 0.6-0.8.

[0044] S3. Lower the culture temperature to 25°C, add IPTG at a final concentration of 1 mM, and continue culturing for 2 h.

[0045] S4. Add 100 mL of peony seed oil and continue culturing for 12 h to obtain fermentation liquid.

[0046] Example 3: Extraction and separation of vegetable oils after fermentation

[0047] The fermentation liquid obtained in Example 2 was sterilized under ultraviolet light for more than 2 hours, and then 100 mL of ethyl acetate was added to adjust the pH to 2-3, stirred at room temperature for 2 hours, and then centrifuged to obtain the upper organic phase. After the solvent was removed at 50°C to obtain the crude fermentation oil, the crude fermentation oil was further centrifuged to remove part of the oil-insoluble precipitate to obtain a clarified fermented oil sample.

[0048] Example 4: Determination of vegetable oil components after fermentation

[0049] Liquid chromatography was used to detect the content of each fatty acid in the fermented oil sample obtained in Example 3 and the original peony seed oil sample. The liquid chromatography column used was a Yuexu XB-C18 high-efficiency chromatography column (4.6×250 mm, 5 μm), the mobile phase was acetonitrile-0.1% phosphoric acid aqueous solution (volume ratio 85:15), the flow rate was 1 mL / min, the column temperature was 35° C., the detection wavelength was 203 nm, and the injection volume was 20 μL.

[0050] Liquid chromatography showed that the free fatty acid content below C12 in the fermented oil sample was 87g / L, while in the original sample, the free fatty acid content below C12 was only 0.5g / L. At the same time, after fermentation, the free fatty acid content above C12 also increased from 54g / L to 126g / L.

[0051] Example 5: Evaluation of fermented vegetable oils and fats

[0052] A total of 16 trained sensory assessors, 8 males and 8 females, were recruited to evaluate and score the skin feel and odor of the fermented oil sample obtained in Example 3, including fluidity, absorption capacity, freshness, etc., and the average value was taken (10 is the full score. 0-2: poor; 3-5: ordinary; 6-8: good; 9-10: very good).

[0053] The test results are shown in Table 1: Through sensory evaluation, it was found that after the peony seed oil was fermented, its fluidity, absorption capacity, and freshness were significantly improved, but the odor evaluation was slightly reduced. Therefore, the results show that plant oils can significantly improve their skin feel and improve the viscosity of oils after fermentation.

[0054] Table 1 Test results of peony seed oil after fermentation

[0055] Evaluation indicators Peony seed crude oil Fermented Peony Seed Oil Liquidity 6.4 8.9 Absorption capacity 7.9 8.5 Freshness 7.5 9.2 odor 8.9 8.7

[0056] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and implementation modes, and can be fully applicable to various fields suitable for the present invention. For those familiar with the art, for those of ordinary skill in the art, various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principle and spirit of the present invention. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.

Claims

1. A method for fermenting vegetable oil to improve its skin-friendliness, characterized in that: The oil fermentation method comprises fermenting the vegetable oil to be treated by using a strain obtained by co-expressing lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase in a host microorganism, thereby improving the skin-friendliness of the vegetable oil; The method comprises the following steps: S1. Seed liquid culture: inoculating the strain into a seed culture medium to perform seed liquid culture; S2. Fermentation culture: When the seed liquid in S1 is cultured to the middle and late logarithmic stage of fermentation, it is inoculated into the fermentation medium for fermentation culture and the strain is allowed to express lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase; in the middle or late logarithmic stage of fermentation, the vegetable oil to be treated is added and the fermentation culture is continued; S3, separation of vegetable oil after fermentation: The sample obtained by S2 fermentation is separated into an aqueous phase and an oil phase by centrifugation, filtration or extraction, thereby obtaining a vegetable oil with enhanced skin-friendliness; The host microorganism is Escherichia coli; the source of the lipase is Aspergillus niger; the source of the oleate hydratase is Lactobacillus plantarum; the source of the alcohol dehydrogenase is Micrococcus fischeri; the source of the Baeyer-Villiger monooxygenase is Pseudomonas putida; The gene sequences of the lipase, oleate hydratase, alcohol dehydrogenase, and Baeyer-Villiger monooxygenase are shown in SEQ ID No. 1 to SEQ ID No. 4, respectively; The protein sequences corresponding to the lipase, oleate hydratase, alcohol dehydrogenase and Baeyer-Villiger monooxygenase are shown in SEQ ID No.5 to SEQ ID No.8 respectively.

2. The oil fermentation method according to claim 1, characterized in that: The seed culture medium includes but is not limited to LB culture medium and YPD culture medium; the fermentation culture medium includes but is not limited to LB culture medium and YPD culture medium.

Images