Application of SNP molecular marker rs645505906 related to goat growth traits

Abstract

The present invention belongs to the field of biotechnology, and in particular, relates to an application of a SNP molecular marker rs645505906 related to goat growth traits. The goat SNP molecular marker site is shown in SEQ ID NO.1, and there is a C / A base mutation at the 51st base site of the sequence fragment. The present invention can increase the dominant allele frequency from generation to generation by optimizing the dominant allele of the SNP, improve the weight of goats at 12 months of age, accelerate the progress of goat genetic improvement, and thus effectively improve the economic benefits of goat breeding.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an application of a SNP molecular marker rs645505906 on chromosome 14 of a goat related to growth traits. Background Art

[0002] As one of the earliest domesticated livestock in ancient my country, goats provide people with a variety of livestock products such as meat, milk, and wool. At present, my country needs to import a large amount of frozen bone-in sheep meat and frozen whole sheep meat from New Zealand and Australia every year, and has become the world's largest importer of sheep meat since 2012. Dongbao Blackhead Sheep is a local breed of meat goat. Its meat is delicious and has a light smell. At the same time, it maintains the high reproductive capacity of its parent Macheng Black Goat, but its annual meat production needs to be improved. The growth traits of goats include body weight, body size, daily weight gain, and feed-to-meat ratio, which have an important impact on the meat production ability of goats.

[0003] Single nucleotide polymorphism (SNP) refers to the polymorphism of DNA sequence caused by the variation of single nucleotide (A, T, C and G) at the same position in the genome between individuals, mainly including four forms such as base conversion, transversion, insertion or deletion. SNP has the characteristics of large number, wide distribution, low heterozygosity, good genetic stability, and suitability for high-throughput automated detection. Therefore, SNP can be used as the preferred tool for molecular breeding, gene positioning, population evolution and other research. With the help of modern selective breeding technology, by adding molecular markers with significant effects to molecular marker-assisted selection (marker associated selection, MAS) and genomic selection (genomic selection, GS), the genetic improvement progress of goat growth traits can be significantly improved, thereby increasing the meat production of offspring goats and promoting the efficient development of my country's goat industry. Genome-wide association studies (GWAS) technology helps to efficiently screen out molecular markers that have a significant effect on the phenotype. However, although GWAS technology has made significant progress, there are still some challenges, such as low data standardization quality and high cost of sequencing large populations, which need to be solved in GWAS research. In modern livestock breeding, since livestock and poultry populations are generally large, using high-depth sequencing to obtain base information will incur high costs, thereby reducing economic benefits, and the quality of low-depth sequencing data needs to be investigated. Therefore, in order to meet the requirements of large population sequencing, providing low-cost, high-quality SNP site information for GWAS analysis is an important factor in improving SNP screening efficiency.

[0004] The SNP loci related to goat growth traits that have been reported so far include the c.*454C>G locus in the goat NFAT5 gene, the c.*1103G>A locus in the goat RSAD2 gene, and the g.7919G>A locus in the goat ZBP1 gene. Screening new SNP loci related to goat growth traits provides new molecular marker resources for molecular marker-assisted selection of goats, accelerating the process of breeding and improvement of breeding goats. Summary of the invention

[0005] The purpose of the present invention is to screen out a molecular marker rs645505906 associated with goat growth traits, and use the molecular marker in goat growth trait detection or goat breeding.

[0006] The technical solution of the present invention is as follows:

[0007] The object of the present invention is to provide an application of a goat SNP molecular marker in goat growth trait detection or goat breeding, wherein the SNP molecular marker is rs645505906 on goat chromosome 14, and the nucleotide sequence of 50 bp upstream and downstream of the SNP site is as follows (SEQ ID NO: 1):

[0008] ATATACATACATAAAATATTCAGCGTGGTGCCCAAATCAATCACGTA TATN(C / A)ATTTCTTCAAGAATCATTTTTTGGGTGTTGTTTCTGGGCTAA GTACTAAG.

[0009] The N at the 51st base of the above sequence is an allele mutation of C51-A51, which causes nucleotide polymorphism in the sequence of SEQ ID NO: 1. The molecular marker can be used as a molecular marker for detecting growth traits related to goats, and when the 51st nucleotide on the sequence shown in SEQ ID NO: 1 is A, it is beneficial for goats to have a higher weight at 12 months of age.

[0010] The present invention does not limit the breed of goats, and the goat breeds that can be selected include Dongbao black-headed goats, Macheng black goats, Boer goats, Yichang white goats, and horse-headed goats.

[0011] Another object of the present invention is to provide a reagent or kit, including primers for detecting the above-mentioned SNP molecular markers. A person skilled in the art can design primers that can amplify the sequence shown in SEQ ID NO: 1 according to the primer design principle to detect the genotype of the SNP marker associated with goat growth traits of the present invention, thereby predicting goat growth traits, especially 12-month-old body weight.

[0012] The reagent or kit of the present invention can be used for the detection of goat growth traits or goat breeding. The goat growth trait is the weight of the goat at 12 months of age.

[0013] Another object of the present invention is to provide a method for detecting goat growth traits, which detects whether the single nucleotide labeled by N in the above SEQ ID NO: 1 sequence of the goat is C or A. The goat growth trait is the weight of the goat at 12 months of age.

[0014] As an embodiment, the genotyping of the goat material to be tested is performed using primers that amplify the sequence shown in SEQ ID NO: 1, and the weight of AA goats at 12 months of age is better than that of CC goats. Preferably, the above reagent or kit is used for detection.

[0015] Another object of the present invention is to provide a method for screening the above-mentioned SNP molecular markers, comprising the following steps:

[0016] ① Extract goat genomic DNA and perform low-depth and high-depth resequencing of the whole genome to obtain original sequencing data;

[0017] ②Quality control of the original sequencing data was performed, and the data were aligned to the goat reference genome. The Sentieon+Beagle strategy was used to detect genetic variations and fill in genotypes on all autosomes of the sample to obtain high-quality SNP site data;

[0018] ③ Using the FarmCPU model with rMVP software, GWAS analysis was performed on the SNP loci and the weight of goats at 12 months of age to obtain SNP molecular markers related to the growth traits of the goats.

[0019] As an implementation mode, the low depth is 1-2X, and the high depth is 15-20X; preferably, the number of low depths is higher than that of high depths, and fewer high-depth sequencing results are used to fill genotypes for more low-depth sequencing results, thereby reducing sequencing costs.

[0020] Another object of the present invention is to provide a genetic breeding method for improving the growth traits of goats, determine the above-mentioned SNP molecular markers of breeding sheep in the core group of goats, and make corresponding selections based on the goat SNP molecular markers: for the successive breeding of breeding sheep, select individuals whose 51st base in the SNP marker is CA type and / or AA type, and eliminate CC type individuals, so as to increase the frequency of gene A at this site from generation to generation, thereby improving the 12-month-old weight performance of the offspring goats.

[0021] Beneficial effects of the present invention:

[0022] The present invention combines low-depth resequencing with genotype filling, and uses the GWAS analysis strategy to screen out significant SNP molecular markers that affect goat growth traits, and uses them in molecular marker-assisted selection and genomic selection to select genotypes that are beneficial to improving goat growth traits for seed retention, thereby increasing the gene frequency of the dominant allele from generation to generation, which can accelerate the process of breeding and improvement of breeding goats and bring huge economic benefits to goat farming.

[0023] The present invention verifies the effect of the SNP molecular marker on the body weight of goats at 12 months of age, and can be applied to the genetic improvement of breeding goats to increase their body weight at 12 months of age, thereby increasing the body weight of offspring at 12 months of age, and further increasing the market competitiveness of breeding enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 : Manhattan plot of goat growth traits (weight at 12 months of age), the black circle and the arrow point to the molecular marker screened by the present invention, and the marker is located on chromosome 14 of the goat. DETAILED DESCRIPTION

[0025] The embodiment of the present invention performs whole genome resequencing on 500 Dongbao black-headed sheep, of which 466 are sequenced at a low depth of 1X and 34 are sequenced at a high depth of 15X, with the purpose of filling genotypes with low depth sequencing results (more) using high depth sequencing results (less), thereby reducing sequencing costs. Then, the resequencing data is aligned to the goat reference genome (genome version ARS1.2), and the Sentieon+Beagle strategy is used to perform genetic variation detection and genotype filling on all autosomes of the 500 samples, and SNP site data is obtained to carry out GWAS research related to the weight of goats at 12 months of age, and finally a SNP (rs645505906) related to the weight of goats at 12 months of age is screened, and the site of the SNP marker is the 77526027th nucleotide site on chromosome 14 of the goat reference genome Capra hircus ARS1.2 version, and the base of the site is C or A. Referring to Ensembl, the nucleotide sequence of 50 bp upstream and downstream of the SNP site was obtained. The nucleotide sequence of the fragment is shown in SEQ ID NO: 1, wherein the A at the 51st base is the nucleotide after the allele mutation. The specific nucleotide sequence is:

[0026] ATATACATACATAAAATATTCAGCGTGGTGCCCAAATCAATCACGTA TATN(C / A)ATTTCTTCAAGAATCATTTTTTGGGTGTTGTTTCTGGGCTAA GTACTAAG,

[0027] The N at the 51st base of the above sequence is an allele mutation of C51-A51, which causes a nucleotide polymorphism in the SEQ ID NO:1 sequence. The GWAS analysis results show that rs645505906 is significantly correlated with goat growth traits (weight at 12 months of age), and the 12-month-old weight of individuals with genotypes of AA or CA is significantly higher than that of CC individuals, indicating that A is an allele that is conducive to improving growth traits. The molecular marker can be used as a molecular marker for detecting goat growth traits, and when the 51st nucleotide on the sequence shown in SEQ ID NO:1 is A, it is conducive to goats having a higher 12-month-old weight, which is of great significance to goat breeding.

[0028] The molecular markers screened by the present invention can be applied to the genotype of genes related to goat growth traits or the association analysis related to goat growth traits, and provide a new molecular marker resource for molecular marker-assisted selection of goat growth traits.

[0029] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1

[0031] Whole genome resequencing

[0032] 1. Blood sample collection and leukocyte separation

[0033] Use a veterinary blood collection needle to collect 5 mL of blood sample from the jugular vein of the goat into an EDTA anticoagulant tube. Place the anticoagulant tube in an ice box with a large number of ice packs and bring it back to the laboratory. Store these samples in a refrigerator at 4°C for white blood cell extraction. The specific steps are as follows:

[0034] (1) Take 2-3 mL of blood sample and place it in a 10 mL EP tube.

[0035] (2) Add ultrapure water to EP to make the total liquid volume 9 mL.

[0036] (3) Slowly turn the EP tube upside down 20 times and let it stand for 10 minutes.

[0037] (4) Place the EP tube into a centrifuge and centrifuge at 5000 rpm for 10 min.

[0038] (5) Slowly pour out the supernatant from the EP tube.

[0039] (6) Add ultrapure water again to make the total liquid volume 9 mL.

[0040] (7) Repeat steps (3), (4), and (5).

[0041] (8) The separated white blood cells are numbered and placed in a -80°C refrigerator.

[0042] 2. Genomic DNA extraction and whole genome resequencing

[0043] The DNA of leukocytes was extracted using Tianmo Bio's genomic DNA mini-extraction kit (Cat. No.: d3024). For specific methods, see the instructions. The genomic DNA that passed the quality inspection was sent to Beijing Novogene Technology Co., Ltd. for secondary quality inspection and library construction, and the whole genome resequencing of PE150 was performed on the BGI platform. The original data was obtained in FASTQ format. 34 samples were subjected to high-depth whole genome resequencing, with an average sequencing depth of approximately 19.72X and a total data size of 1.4T; 466 samples were subjected to low-depth whole genome resequencing, with an average sequencing depth of approximately 1.65X and a total data size of 1.6T.

[0044] Example 2

[0045] Genome alignment, genetic variation detection, and genotype filling

[0046] 1. Raw sequencing data analysis and genome alignment

[0047] The high-depth sequencing data and low-depth sequencing data were quality controlled using the same process.

[0048] (1) The raw data were filtered using Fastp software. The filtering criteria were as follows: reads with a base quality value lower than 20 and a ratio of more than 30% were removed; reads with an n base greater than 5% were removed. Clean reads were obtained after quality control in the above steps.

[0049] (2) Use BWA software to align clean reads to the goat reference genome (Capra_hircus.ARS1.2).

[0050] (3) Use Samtools software to sort the aligned BAM files.

[0051] (4) Use Picard to mark duplicate reads.

[0052] (5)Samtools software builds the index.

[0053] 2. Detection of variant sites and genotype filling

[0054] (1) GATKHaploytypeCaller generates a gvcf file for each sample according to the autosome number.

[0055] (2) GATKCombineGVCFs merges the gvcf files of each sample of a single chromosome.

[0056] (3) GATKGenotypeGVCFs performs population SNP calling by chromosome.

[0057] (4) GATKMergeVcfs merges autosomal population vcf files.

[0058] (5) GATKSelectVariants screens SNPs in population vcf files.

[0059] (6) GATKVariantFiltration marks false positive SNP sites.

[0060] (7) grep command to filter the marked SNP sites

[0061] (8) Plink software was used to filter SNP sites (geno0.1--maf0.05--hwe1e-06).

[0062] (9) Beagle software was used to fill in the missing sites.

[0063] (10) Use Sentieon Haplotyper and GVCFtyper modules to detect and genotype genetic variations in population genomes.

[0064] (11) Beagle was used for genotype filling, and finally 26,131,221 high-quality SNPs were obtained.

[0065] Example 3

[0066] Application of rs645505906 molecular marker typing method in association analysis of growth traits in goats

[0067] Association analysis between rs645505906 molecular marker and goat growth traits (weight at 12 months of age):

[0068] (1) The phenotypes used for the association analysis between genotypes and growth traits were measured by professional technicians in strict accordance with the measurement specifications. The age of the sheep was 360±15 days. The live weight was measured after fasting for 12-16 hours and drinking for 2 hours, expressed in kilograms (kg). A total of 304 samples were measured.

[0069] (2) GWAS analysis was performed on the SNP loci and body weight at 12 months of age using the FarmCPU model using rMVP software.

[0070] The FarmCPU model uses fixed effect models and random effect models for iteration. The fixed effect analysis model is as follows:

[0071] y=Xb+Z t u t +S i d i +e

[0072] Where y is the observer vector of the trait; b is the individual fixed effect vector, including the first three principal components of SNP, birth season, birth parity and birth weight; u t is the nucleotide genotype matrix of t pseudo quantitative traits as fixed effects; X and Z t b and u respectively t The correlation matrix of S i is the ith SNP marker, d i is the corresponding effect value; e is the random residual effect vector, which conforms to the normal distribution e~N(0,Iσ e 2 ).

[0073] The results of GWAS analysis showed that rs645505906 was significantly correlated with goat growth traits (weight at 12 months of age). The effects of different genotypes of this marker on goat growth traits are shown in Table 1, and the differences in weight at 12 months of age among individuals with three genotypes within the group are shown in Table 2.

[0074] Table 1 Effects of different genotypes of rs645505906 on growth traits of goats

[0075]

[0076] Note: When the P value of the marker is <0.05 / 26131221≈1.91E-09 (Bonferroni correction), it is a significant marker.

[0077] Table 2 Analysis of body weight differences of goats with different rs645505906 genotypes at 12 months of age

[0078]

[0079] Note: *P<0.05, ***P<0.001.

[0080] As shown in Tables 1 and 2, for the weight trait of goats at 12 months of age, the weight of individuals with genotype CA or AA at 12 months of age was significantly higher than that of individuals with CC genotype, indicating that A is an allele that is beneficial to the improvement of growth traits.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent or kit for detecting SNP molecular markers in goats for use in weight detection of 12-month-old goats or in breeding to improve the weight of 12-month-old goats, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO:

1. The 51st base in the sequence is C or A. The base A is beneficial to increasing the weight of goats at 12 months of age. The goats are Dongbao black-headed sheep.

2. The use according to claim 1, characterized in that: The reagent or kit includes PCR primers for amplifying the sequence shown in SEQ ID NO:

1.

3. A method for detecting the weight of Dongbao black-headed sheep at 12 months of age, characterized in that: In the sequence shown in SEQ ID NO: 1 of Dongbao black-headed sheep, the 51st base is C or A. A is an allele that is beneficial to the increase of body weight of Dongbao black-headed sheep at 12 months of age.

4. The method according to claim 3, characterized in that The genotyping of the materials of Dongbao black-headed sheep to be tested was carried out using primers with the amplification sequence SEQ ID NO:

1. The weight of AA type Dongbao black-headed sheep at 12 months of age was better than that of CC type.

5. The method according to claim 3 or 4, characterized in that: The detection is performed using a reagent or kit containing PCR primers for amplifying the sequence shown in SEQ ID NO:

1.

6. A genetic breeding method for improving the growth traits of Dongbao black-headed sheep, characterized in that: Determine the SNP molecular markers described in claim 1 of the breeding sheep in the core group of Dongbao black-headed sheep, and make corresponding selections based on the goat SNP molecular markers: for the successive breeding of breeding sheep, select individuals whose 51st base in the SNP marker is CA type and / or AA type, and eliminate CC type individuals, so as to increase the frequency of gene A at this site from generation to generation, thereby improving the 12-month-old body weight performance of the offspring Dongbao black-headed sheep.

Images