Construction method and application of MDCK homozygous cell line lacking ACSL4 gene

Abstract

The invention belongs to the field of biotechnology, and specifically relates to a construction method and application of an MDCK homozygous cell line with ACSL4 gene deletion. In the construction method, specific gRNA is used to efficiently target the ACSL4 gene, and the CRISPR / Cas9 gene editing technology is combined to knock out the ACSL4 gene of canine kidney cell MDCK, which is safe and fast with low off-target effect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a construction method and application of an MDCK homozygous cell line with ACSL4 gene deletion. Background Art

[0002] Acyl-CoA synthetase long chain family member 4 (ACSL4) is a key enzyme regulating lipid composition, which catalyzes the reaction of long-chain fatty acids and coenzyme A to generate acyl-CoA. This step activates long-chain fatty acids for lipid synthesis and energy metabolism, causing lipid peroxidation, which in turn promotes the occurrence of cell ferroptosis.

[0003] Canine kidney cells (MDCK, Madin-Darby Canine) are widely used for the isolation, cultivation and purification of various respiratory and enteric viruses in livestock and poultry. They have the advantages of easy cultivation, fast growth, strong stability and plasticity, and the ability to form a single-layer cell membrane. Gene knockout technology usually uses homologous recombination technology to introduce the constructed gene knockout vector into the recipient cell, and uses the principle of homologous recombination of base sequences to integrate the vector DNA into a certain site on the recipient cell genome, which can eventually make the specific gene function ineffective, thereby shielding some of the functions of this gene regulation, and further analyze and determine its impact on various aspects of the organism.

[0004] Based on the need to study the various cellular activities involved in the ACSL4 gene, such as regulating its mediated cell ferroptosis and further studying it by activating or blocking ferroptosis activities, stable cell lines with ACSL4 gene deletion are expected to be a good research target. At present, there are no reports on the construction of MDCK cells with ACSL4 gene deletion.

[0005] In this study, the ACSL4 gene of MDCK cells was knocked out to obtain homozygous MDCK cells lacking the ACSL4 gene. After three passages and cryopreservation, the cells were able to stably recover and reproduce, and maintain stable physiological characteristics. This is of great significance for studying various cell activities involved in the ACSL4 gene and alleviating or treating a variety of diseases. Summary of the invention

[0006] The purpose of the present invention is to provide a construction method and application of an MDCK homozygous cell line with ACSL4 gene deletion. The construction method uses specific gRNA to efficiently target the ACSL4 gene, combines CRISPR / Cas9 gene editing technology to knock out the ACSL4 gene of canine kidney cell MDCK, is safe and fast, has low off-target effect, and the off-target rate is less than 30%.

[0007] The present invention provides one of the following technical solutions:

[0008] A specific gRNA for targeted knockout of the ACSL4 gene, wherein the targeting site of the gRNA in the ACSL4 gene is located at the 366-344 site of the ACSL4 gene (Genbank No: XM038588058); the nucleotide sequence of the specific gRNA is SEQID NO.1: gRNA-A1:TATCCAGAGTGTCAGCTCCGGGG.

[0009] Further, the CRISPR / Cas9 system of the present invention includes the specific gRNA as described above. The CRISPR / Cas9 system comprises two parts, a CRISPR locus and a Cas gene (CRISPR associated gene). The CRISPR gene sequence is mainly composed of a leader sequence, a repeat sequence, and a spacer sequence. The Cas gene is located near the CRISPR gene or scattered elsewhere in the genome, and the protein encoded by the gene can act together with the CRISPR sequence region. The CRISPR / Cas9 system is a system in which RNA guides the Cas9 protein to modify the target gene. Compared with traditional gene editing technology, it has the advantages of high editing efficiency, more accurate editing sites, low off-target probability, low verification cost, and simple operation.

[0010] The present invention provides the following technical solution:

[0011] The method for constructing MDCK homozygous cells lacking the ACSL4 gene comprises the following steps:

[0012] (1) electroporating the specific gRNA and Cas9 protein prepared in step (1) into MDCK cells at a volume ratio of 1:3;

[0013] (2) Single clones were selected and verified by PCR and sequencing to obtain MDCK homozygous cells with ACSL4 gene knockout.

[0014] Furthermore, the electroporation parameters used in step (2) are: C=25μF, PC=200Ω, V=1.8kV; the primers used in step (3) PCR are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] The present invention provides the following technical solution three:

[0016] A MDCK homozygous cell line is constructed by the above construction method.

[0017] The present invention provides the following technical solution four:

[0018] Application of the above-mentioned MDCK homozygous cell line in establishing an in vitro cell model of ACSL4 gene knockout.

[0019] The application of the above MDCK homozygous cell line in the isolation, cultivation and purification of respiratory tract and intestinal viruses of livestock and poultry.

[0020] Beneficial effects of the present invention:

[0021] The present invention adopts the Cas9 RNP system method, and knocks out the ACSL4 gene of canine kidney cell MDCK by CRISPR / Cas9 gene editing technology mediated by electroporation, which is safe, fast and has low off-target effect. After electroporation, a single clone is picked and verified by PCR and sequencing, and MDCK homozygous cells with ACSL4 gene knockout are successfully obtained. The MDCK cells after the ACSL4 gene is knocked out of the present invention can still maintain their physiological characteristics, and can be stably propagated and propagated after multiple freezing and thawing, providing a good model for studying various cell activities involved in the ACSL4 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0023] Figure 1 This is the PCR amplification result of the monoclonal 1A3 of the present invention;

[0024] Figure 2 This is the sequencing result of the monoclonal clone 1A3 of the present invention;

[0025] Figure 3 The microscopic morphology picture (100×) of the MDCK 1A3 homozygous cells of the present invention. DETAILED DESCRIPTION

[0026] In order to clearly illustrate the technical features of this solution, the present invention is described in detail below through specific implementation methods and in conjunction with the accompanying drawings. The scope of the present invention is not limited to the following embodiments. Professionals in the field can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.

[0027] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art. The parts, percentages, etc. involved in the following embodiments, unless otherwise specified, are all weight units.

[0028] 1. Materials

[0029] 1.1 Main reagents:

[0030] Neon TM Transfection system 10μL kit (Invitrogen, MPK1096), Hygromycin B (Invitrogen, 10687-010), EnGenTM ​​Spy Cas9 NLS (NEB, M0646T), whole blood / cultured cell DNA kit (Simgen, 3002250), DMEM basal medium (OriCellB, DMF-03011), fetal bovine serum (OZFAN, AF500-P).

[0031] 1.2 Preliminary detection of MDCK cells used in the present invention

[0032] After MDCK cells (provided by Saiye Bio) were revived, 20 μL of cell suspension was extracted for bacterial and mycoplasma detection. The primers for bacterial detection were 16s universal primers:

[0033] F:5'-AGAGTTTGATCMTGGCTCAG-3'(SEQ ID NO.4),

[0034] R:5'-TACGGYTACCTTGTTACGACTT-3'(SEQ ID NO.5);

[0035] The primers for mycoplasma detection are:

[0036] F:5-GAGGCTTATCCGCAGGTAATCACG-3' (SEQ ID NO.6),

[0037] R: 5'-AACAAGGTATCCCTACGAGAACG-3' (SEQ ID NO. 7).

[0038] After PCR reaction, the results of bacteria and mycoplasma tests were negative.

[0039] 1.3 Obtaining the Cell Genome of the Present Invention

[0040] The above MDCK cells were directly subjected to genome extraction, and the steps were as follows:

[0041] Collect ≤5 × 10 6Cultivate cells, add 180μL PBS solution, vortex to fully suspend the cultured cells. Add 20μL proteinase K. Add 200μL Buffer Sl, vortex for about 15 seconds to mix. Place the centrifuge tube in a 56℃ water bath for 10 minutes. Centrifuge at low speed for a few seconds to allow the solution on the tube cap to settle to the bottom of the tube. Add 200mL anhydrous ethanol, vortex for about 15 seconds to mix. Pipette the above solution and add it to the nucleic acid purification column (the purification column is placed in a 2mL centrifuge tube), cover the tube, and centrifuge at 12000rpm for 60 seconds. Discard the filtrate in the 2mL centrifuge tube, return the nucleic acid purification column to the 2mL centrifuge tube, add 500μL wash buffer to the nucleic acid purification column, cover the tube, and centrifuge at 12000rpm for 60 seconds. Discard the filtrate in the centrifuge tube, return the nucleic acid purification column to the 2mL centrifuge tube, add 600μL wash buffer to the nucleic acid purification column, cover the tube, and centrifuge at 12000rpm for 60 seconds. Discard the filtrate in the centrifuge tube, return the nucleic acid purification column to the 2mL centrifuge tube, add 600μL wash buffer to the nucleic acid purification column, cover the tube, and centrifuge at 12000rpm for 60 seconds. Discard the filtrate in the 2mL centrifuge tube, place the nucleic acid purification column back into the 2mL centrifuge tube, cover the tube, and centrifuge at 14000rpm for 1 minute. Discard the 2mL centrifuge tube, place the nucleic acid purification column in a clean 1.5mL centrifuge tube, add 100μL of elution solution incubated at 56℃ to the center of the membrane of the purification column, cover the tube, let stand at room temperature for 1 minute, and centrifuge at 12000rpm for 60 seconds. Discard the purification column, and the eluted DNA can be used immediately in the following experiments or stored at -20℃ for later use.

[0042] 2 Experimental methods

[0043] 2.1 Obtaining gRNA

[0044] According to the gRNA target sequence design principle, the target sequence was designed at the 366-344 site of the ACSL4 gene (Genbank No: XM038588058). During the design process, the gRNA target site was close to the protein-coding N-terminus, thereby increasing the possibility of gene disruption, and there were PAM (NGG) sequences before and after the target site. A total of 3 gRNAs were designed and constructed, and the best gRNA-A1 with specificity for mediating localization was optimized and screened, as shown in SEQ ID NO.1, with a length of 23 nucleotides, which is easy to operate.

[0045] The gRNA targeting position of the ACSL4 gene and the genomic sequence nearby were amplified. The reaction system and procedure for the amplification of the target sequence gRNA-A1: 5'TATCCAGAGTGTCAGCTCCGGGG 3' were optimized as follows: template 100-200ng, upstream primer F (10μM) 0.6μL, downstream primer R (10μM) 0.6μL, dNTPs (2.5mM) 1.8μL, 5X LongAmpTaq Reaction 3μL, LongAmp Taq DNA Polymerase 1μL, sterile water to adjust the total system to 15.0μL. Pre-denaturation at 94℃ for 3min, denaturation at 94℃ for 30s, annealing at 62℃ for 35s, extension at 65℃ for 50s, 35 cycles, and final extension at 72℃ for 10min. The PCR product was electrophoresed using agarose gel and the gel was cut and then sent to the sequencing company for sequencing, and the sequencing identification was correct.

[0046] Upstream primer (SKO705-F2): 5'GCTGCTTCCGTTATTGCCTT 3' (SEQ ID NO. 2)

[0047] Downstream primer (SKO705-R2): 5'GTGCAGTGAGTCCACTACCAA 3' (SEQ ID NO. 3).

[0048] 2.2 Construction of MDCK cell line with ACSL4 gene deletion

[0049] 2.2.1 Electroporation

[0050] The Cas9 RNP method is used to directly transfect the Cas9 protein and gRNA into cells through electrical stimulation transfection. Since the Cas9 protein is uncharged and the gRNA is charged, the combination of the two can be efficiently transfected into MDCK cells. Moreover, the Cas9-gRNA complex will gradually degrade in the cell and will not last long, so the operation is simplified and the probability of off-target is very low. The specific steps are as follows:

[0051] S1. Take out gRNA, Cas9 protein, etc. and equilibrate them to room temperature before use. Prepare the electroporator according to the required final concentration and turn on the power to preheat. Take out a clean electroporator cup, add 3mL E2 Buffer, and insert it into the pipette stand of the electroporator for use.

[0052] S2. Collect MDCK cells, wash once with 1×PBS, and count them.

[0053] S3, set up three groups, namely negative control group, formal group, and positive control group. Take 1*10 6Prepare 3 sets of fresh ready-to-use culture medium DMEM in advance and mark them for inoculation of cells after electroporation.

[0054] Negative control group: resuspend cells with R / T Buffer. Then install a 100uL pipette tip on the electroporator, aspirate the cell suspension, transfer it to the electroporation cup and lock it firmly. No bubbles can be generated in the tip. Set the electroporation parameters C=25μF, PC=200Ω, V=1.8kV and then electroporate. After the electroporation is completed, remove the pipette from the electroporation cup, inoculate the cells into the prepared culture medium, and mix well. Finally, take out about 20uL of the cell suspension for survival rate calculation.

[0055] Formal group: resuspend cells in R / T Buffer, add gRNA and Cas9 protein (the ratio of the two is 1:3), add 2μg of dsDNA, control the total volume to 113uL, and mix well. Electroporate under the same parameters, inoculate into the prepared culture medium, and mix well. Finally, take out about 20uL of cell suspension for survival rate calculation.

[0056] Positive control group: resuspend the cells in R / T Buffer and add the positive control AGO2 knockout BHK plasmid (established and verified by the research group before), and follow the same steps as above.

[0057] The three groups of cells were cultured in an incubator. Trypan blue was used to stain the small samples of the three groups of cells, and the survival rates were calculated and recorded. After 24 hours, the fluorescence expression of the positive control group and the formal experimental group was observed, and the fluorescence rates of the positive control group and the formal experimental group were obtained and recorded by counting under a microscope. If the cell state is normal, drug screening was performed after 48 hours. If the cell state is poor, the cells can be allowed to recover before drug screening.

[0058] 2.2.2 Monoclonal culture

[0059] The limiting dilution method was used for monoclonal plating. During the period of monoclonal culture of cells in 96-well plates (i.e. before the cell confluence reached 60%), the culture medium was replaced once a week.

[0060] Regularly observe the monoclonal clones in culture, and count the wells within 2 weeks of inoculating the 96-well plate; mark the wells without monoclonal growth with "×" on the plate cover; record the number of wells and the well rate. If the number of wells is less than 200, it is necessary to revive the cells after drug screening and then re-plate the monoclonal clones; if the well rate of the 96-well plate is less than 50%, it is necessary to perform a confluence operation before preparing the plate. When the confluence of the cell monoclonal clones in the 96-well plate generally reaches 60-70%, the plate preparation operation is performed.

[0061] 2.2.3 Cell monoclonal screening and detection

[0062] (1) PCR primers:

[0063] Upstream primer (SKO705-F2): 5'GCTGCTTCCGTTATTGCCTT 3' (SEQ ID NO. 2)

[0064] Downstream primer (SKO705-R2): 5'GTGCAGTGAGTCCACTACCAA 3' (SEQ ID NO.3)

[0065] (2) Reaction system: template 1.5uL, upstream primer F (10μM) 1.0uL, downstream primer R (10μM) 1.0uL, 2× polymerase PCR Mix 12.5uL, and sterile water to adjust the total system to 25.0uL.

[0066] Reaction conditions: pre-denaturation at 94℃ for 3min, denaturation at 94℃ for 30s, annealing at 62℃ for 35s, extension at 72℃ for 35s, 35 cycles, final extension at 72℃ for 5min. Electrophoresis results. The wild-type PCR band size was 773bp. Figure 1 shown.

[0067] The sequencing primer was the upstream primer (SKO705-F2): 5'GCTGCTTCCGTTATTGCCTT 3'.

[0068] The sequencing results are as follows Figure 2 The results of monoclonal key site sequencing are as follows:

[0069] CACGCACTTCGACTCACTAGCTGTCATAGACATCCCCGGA--insert1bp--A--GCTGACACTCTGGATAAGTTATTTGATCATGCCGTGTCCA.

[0070] (3) Results: MDCK monoclonal clone 1A3 was identified as a homozygous knockout gene by PCR and sequencing.

[0071] 3. Stability study of ACSL4-deficient MDCK homozygous cells

[0072] 3.1 Passaging of homozygous cells

[0073] The basic culture system determined in this study is: DMEM + 10% FBS, and the subculture ratio is 1:3 for the best effect. The results of bacterial detection are sterile and mycoplasma detection is negative. Figure 3 As shown, it can be seen that the homozygous cells of the present invention can still maintain their physiological characteristics after multiple passages, and have significant stability.

[0074] The specific steps are as follows:

[0075] Preheat complete culture medium, sterile PBS, and trypsin to 37°C. Carefully remove the culture medium from the culture container. Wash the cells once with PBS (e.g., add about 6 mL to a T25 culture flask). Be gentle and wash thoroughly. Remove the PBS.

[0076] Add pancreatin (about 3 mL for T25 culture flask) and spread evenly quickly to ensure full contact with the cell surface. Place in an incubator for digestion observation. Observe the digestion status under a microscope. When about 70% to 80% of the cells shrink and become round, tap the outer wall of the culture container and observe the cells detaching from the culture surface.

[0077] Immediately add 2 times the volume of trypsin in complete culture medium (about 6 mL for a T25 culture flask), and then gently shake the culture container to quickly mix the culture medium and trypsin. Use a pipette to aspirate the cell suspension and blow the bottom of the culture container several times to blow down as many cells as possible. The blowing action should not be violent to avoid generating a large number of bubbles, damaging and losing cells.

[0078] Transfer the cell suspension to a centrifuge tube. Wash the container once with PBS (add about 3 mL to a T25 culture flask) to collect the remaining cells. Centrifuge all the collected cell suspension at 1100 rpm for 4 minutes. Remove the supernatant after centrifugation. Add 1 mL of complete culture medium and gently blow the cell pellet to fully disperse and mix.

[0079] The cells are subcultured at a certain ratio. The first subculture is 1:3. If the cells grow to full size within two days, the subculture ratio can be increased. If the cells have not grown to full size after 72 hours of growth, the subculture ratio can be appropriately reduced. The subculture ratio can be adjusted according to the actual growth of the cells. Shake the cells and place them in an incubator at 37°C and 5% CO2 with saturated humidity.

[0080] The day after subculturing, observe the cell status. If a large number of dead cells are found, change the medium. After that, replace the complete medium every 2 days and observe the cells. When the confluence reaches more than 80%, subculturing or freezing is required.

[0081] 4. Cryopreservation and thawing of homozygous MDCK cells lacking ACSL4

[0082] Before operation, place the cooling box and cryopreservation solution in a 4℃ refrigerator to pre-cool. When the cells grow to a confluence of more than 80%, they can be frozen. After centrifugation, remove the supernatant and evenly resuspend the cells with an appropriate amount of cryopreservation solution to a concentration of 10 7 / ml. The cells were divided into cryopreservation tubes according to the proportion (50-70%).

[0083] Place the cell cryopreservation tube into a pre-cooled programmed cooling box, then place the programmed cooling box into a -80°C refrigerator, and transfer the cell cryopreservation tube into liquid nitrogen for long-term storage the next day.

[0084] Preparation before recovery: Preheat the water bath to 37℃. Warm the complete culture medium to 37℃.

[0085] Add 6 mL of complete culture medium to a 15 mL centrifuge tube and set aside.

[0086] Remove the cells from the liquid nitrogen, place them in a 37°C water bath, and shake them to quickly melt the cryopreserved suspension. Use an alcohol cotton ball to wipe the outer surface of the cryopreserved tube for disinfection in the clean bench. Open the cryopreserved tube in the clean bench, use a pipette to aspirate the cell cryopreserved suspension, and transfer it to the prepared centrifuge tube with complete culture medium.

[0087] Wash the cryovial once with 1 mL of complete culture medium to collect the residual cells and reduce the loss. Centrifuge the cell suspension at 1100 rpm for 4 minutes. Remove the supernatant after centrifugation. Add 1 mL of complete culture medium and gently blow the cell pellet to fully disperse and mix. Inoculate the cells evenly into 1 T25 culture flask or a culture container with equivalent bottom area. Add enough complete culture medium, and the total amount of culture medium in 1 T25 culture flask should not be less than 6 mL.

[0088] Shake the cells and place them in an incubator at 37°C and 5% CO2 saturated humidity. Try not to move or observe the cells within 2 hours of inoculation, as this will affect cell adhesion and cause poor cell status, cell aggregation, and uneven adhesion.

[0089] On the second day after recovery, observe the cell status. If the cells are well attached to the wall, replace with fresh complete medium. If the cells are round and bright but not attached to the wall, continue to culture the cells for 24 hours before changing the medium. After that, replace the complete medium every 2 days and observe the cells. When the cells grow to a confluence of more than 80%, they can be passaged.

[0090] The above is only the embodiment of the present application, and the protection scope of the present application is not limited by these specific embodiments, but is determined by the claims of the present application. For those skilled in the art, the present application can have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the technical ideas and principles of the present application should be included in the protection scope of the present application.

Claims

1. A method for constructing an MDCK homozygous cell line lacking the ACSL4 gene, characterized in that: The steps are as follows: (1) Electroporate specific gRNA and Cas9 protein into MDCK cells at a volume ratio of 1:3; (2) Single clones were selected and verified by PCR and sequencing to obtain MDCK homozygous cells with ACSL4 gene knockout; The nucleotide sequence of the specific gRNA is gRNA-A1: TATCCAGAGTGTCAGCTCCGGGG, as shown in SEQ ID NO.

1.

2. The method for constructing the MDCK homozygous cell line with ACSL4 gene deletion according to claim 1, characterized in that: The primers used in step (2) PCR are shown in SEQ ID NO.2 and SEQ ID NO.3.

Images