Application of Glycine soja GsALDH7B2 Gene in Improving Salt Tolerance and Antioxidant Capacity of Soybean

Abstract

The present invention provides a wild soybean GsALDH7B2 gene, a recombinant vector, a transformant and their application in improving the salt tolerance and antioxidant capacity of soybeans. The present application discovers that the ALDH family member GsALDH7B2 has an important function in the salt stress response of wild soybeans, and its expression level increases significantly stronger and earlier under salt stress than its homologous gene in soybeans. Overexpressing the wild soybean GsALDH7B2 gene in cultivated soybeans can significantly improve the salt tolerance of soybeans.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a wild soybean GsALDH7B2 gene, a recombinant vector, a transformant, and their application in improving the salt tolerance and antioxidant capacity of soybeans. Background Art

[0002] Wild soybean (Glycine soja L.) is a herbaceous plant of the class Dicotyledoneae, the family Leguminosae, and the genus Glycine. It is mostly distributed in the north-central region of East Asia and has excellent traits such as salt tolerance, drought tolerance, barren tolerance, pest and disease resistance, large biomass, and high protein content. At the same time, there are rich genetic variations and genetic diversities. Wild soybean is a wild relative of cultivated soybean (Glycine max L.), and there is no reproductive isolation between them. The excellent traits and genetic diversity of wild soybean can provide important parental materials and gene resources for the germplasm innovation of cultivated soybean.

[0003] At present, the supply and demand of soybeans in China are extremely unbalanced, and improving soybean yield has become an urgent problem to be solved. Some lands in the main production areas of cultivated soybeans are saline-alkali damaged to varying degrees, which seriously restricts the growth and yield of soybeans. At the same time, planting soybeans on marginal lands such as saline-alkali land has also become an important method to increase soybean yield, and cultivating new soybean varieties with stress resistance has become an urgent need. Therefore, the excavation, evaluation, and utilization of excellent gene resources of wild soybean are of great significance for solving the technical bottlenecks in soybean breeding efficiency and precise improvement in China.

[0004] Therefore, it is necessary to develop a method for improving the salt tolerance and antioxidant capacity of soybeans. Summary of the Invention

[0005] The object of the present invention is to provide a wild soybean GsALDH7B2 gene, a recombinant vector, a transformant, and their application in improving the salt tolerance and antioxidant capacity of soybeans. Overexpressing the wild soybean GsALDH7B2 gene in cultivated soybeans can significantly improve its salt tolerance.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, a wild soybean GsALDH7B2 gene is provided, and the CDS sequence of the gene is shown in SEQ ID NO.1.

[0008] In the second aspect of the present invention, a recombinant vector containing the wild soybean GsALDH7B2 gene is provided.

[0009] In the third aspect of the present invention, a transformant containing the recombinant vector is provided.

[0010] Further, the transformant includes one of Escherichia coli cells, Agrobacterium cells, and plant cells.

[0011] In the fourth aspect of the present invention, a method for preparing a transformant is provided, and the method includes:

[0012] Using wild soybean leaf cDNA as a template, performing PCR amplification with the primer pair shown in SEQ ID NO. 3-4 to obtain a PCR product;

[0013] Connecting the PCR product into the pCAMBIA3300 vector by enzymatic digestion and ligation methods to obtain a recombinant vector;

[0014] Transferring the recombinant vector into Agrobacterium and then infecting soybeans to obtain a transformant.

[0015] In the fifth aspect of the present invention, there is provided the application of the wild soybean GsALDH7B2 gene and / or the recombinant vector and / or the transformant in improving the salt tolerance and antioxidant capacity of soybeans.

[0016] In the sixth aspect of the present invention, a method for improving the salt tolerance and antioxidant capacity of soybeans is provided, and the method includes: overexpressing the wild soybean GsALDH7B2 gene in cultivated soybeans.

[0017] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0018] The present invention provides a wild soybean GsALDH7B2 gene, a recombinant vector, a transformant, and their application in improving the salt tolerance and antioxidant capacity of soybeans. It is found that the ALDH family member GsALDH7B2 has an important function in the salt stress response of wild soybeans, and its expression level increases significantly stronger and earlier than the homologous gene in soybeans under salt stress. Overexpressing the wild soybean GsALDH7B2 gene in cultivated soybeans can significantly improve its salt tolerance. Description of the Drawings

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0020] Figure 1 Analysis of the evolutionary relationship of ALDHs family members in wild soybeans and Arabidopsis thaliana.

[0021] Figure 2Results of stress expression analysis of wild soybean GsALDH7B2 and its homologous gene GmALDH7B2 in soybean.

[0022] Figure 3 Results showing that GsALDH7B2 can significantly improve the salt tolerance and antioxidant capacity of soybean. Among them, A shows the salt tolerance phenotypes of soybean overexpressing the GsALDH7B2 gene and the wild type; B shows the statistics of plant height and root length before and after stress; C shows the aldehyde catalytic capacity of the overexpressing material and the wild type leaves. Detailed implementation manners

[0023] The present invention will be specifically described below in combination with the detailed implementation manners and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these detailed implementation manners and examples are used to illustrate the present invention, rather than to limit the present invention.

[0024] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In case of contradiction, this specification shall prevail.

[0025] Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present invention can be obtained through market purchase or by existing methods.

[0026] The following will combine examples and experimental data to elaborate in detail on a soybean GsALDH7B2 gene, recombinant vector, transformant of the present application and their applications in improving the salt tolerance and antioxidant capacity of soybean.

[0027] Example 1. Discovery of soybean GsALDH7B2 gene

[0028] The present application discovered the wild soybean GsALDH7B2 gene and preliminarily identified that aldehyde dehydrogenase GsALDH7B2 is involved in the salt stress response of wild soybean. The specific process is as follows:

[0029] 1. In previous research, the applicant transplanted wild soybeans and cultivated soybeans after 4 days of germination into normal soil and soil containing 0.3% sodium chloride, planted them for 14 days, and sampled them for high-throughput sequencing and analysis. The metabolome results showed that there were hundreds of differential metabolites between wild soybeans and cultivated soybeans. These metabolites were divided into 5 groups according to their changes. Among them, the differential metabolites in Group 5 were specifically increased in wild soybeans. After performing a correlation network analysis on these metabolites and the differentially expressed genes in the transcriptome, it was found that the Gs15g041262 gene was located at the center of the interaction network, indicating that this gene might have an important function in the salt stress response of wild soybeans. Therefore, this gene became one of the key research focuses in the later stage.

[0030] 2. After genomic annotation analysis and sequence alignment, it was found that the Gs15g041262 gene encoded a member of the aldehyde dehydrogenase (ALDHs, Aldehyde dehydrogenases) family. The applicant conducted an evolutionary analysis on some members of the ALDHs family in wild soybeans and Arabidopsis thaliana. The analysis results showed that the members of the ALDHs family in wild soybeans could be divided into 10 subfamilies, just like those in Arabidopsis thaliana. According to the homologous genes of Gs15g041262 and their chromosomal positions, it was named GsALDH7B2 (as Figure 1 ). Its homologous gene in Arabidopsis thaliana, AtALDH7B4, has been reported to be involved in abiotic stress responses. Combining the omics analysis results of wild soybeans, it is suggested that GsALDH7B2 might have a very important function in the stress response of wild soybeans.

[0031] Example 2: The gene expression of GsALDH7B2 responds significantly better in terms of degree and time under various abiotic stress conditions than the homologous genes in soybeans

[0032] 1. To further study the gene function and expression pattern of GsALDH7B2, we detected its expression levels under stress and hormone treatments. We treated 14-day-old seedlings of wild soybeans and cultivated soybeans with 200 mM NaCl, 10 mM Na 2 CO 3 , drought, 100 μM ABA, 10 μM JA, 10 μM GA3, and 10 μM ACC for 14 days, sampled at 0, 1, 3, and 6 hours, extracted RNA, performed reverse transcription, and then conducted qPCR detection. The specific operation method is as follows:

[0033] (1) Wild soybeans and soybean variety William82 (preserved in this laboratory) were selected as materials for expression profile analysis. Samples treated with 200 mM NaCl, 10 mM Na 2 CO 3 , drought, 100 μM ABA, 10 μM JA, 10 μM GA 3, Treat the 14-day-old seedlings of wild soybean and soybean with 10 μM ACC, and take RNA samples of tissue materials at 0 h, 1 h, 3 h, and 6 h. The total RNA was extracted using TRIzol reagent (purchased from Invitrogen), and the extraction method was in accordance with the TRIzol reagent instruction manual. Using reverse transcriptase MLV (purchased from Invitrogen), it was reverse transcribed into cDNA (the method was based on the Invitrogen reverse transcriptase reagent instruction manual), and the reaction conditions were: 65 °C for 5 min, 50 °C for 60 min, 70 °C for 10 min. Using the cDNA synthesized by the above reverse transcription as a template, the gene GsALDH7B2 was specifically amplified by PCR with primers qF: 5’-CTATTCCGGCACCGAAGAGA-3’ (SEQ ID NO.5) and qR: 5’-TTGGCCCTCAATGCTTCAC-3’ (SEQ ID NO.6).

[0034] (2) At the same time, use primers (actin-qF: 5’-GAGCTATGAATTGCCTGATGG-3’ and actin-qR: 5’-CGTTTCATGAATTCCAGTAGC-3’) to specifically amplify the actin genes of wild soybean and soybean (the amplified product is 66 bp long) as an internal control for quantitative analysis. The reaction conditions were: 50 °C for 2 min; 95 °C for 2 min; 95 °C for 3 sec, 60 °C for 30 sec, 40 cycles. Fluorescence detection and real-time quantitative analysis were carried out during the reaction process.

[0035] The results are as Figure 2 shown. The detection results show that in wild soybean, the expression level of GsALDH7B2 was significantly up-regulated after salt stress, alkali stress, ABA treatment, gibberellin treatment, and ACC treatment, and the change in expression level was not significant after drought treatment.

[0036] 2. At the same time, we also detected the expression levels of the homologous genes of GsALDH7B2 in soybean

[0037] The results are as Figure 2 shown. The results found that although the expression levels of the homologous genes also showed up-regulation, the degree of up-regulation change of GsALDH7B2 in wild soybean was significantly stronger than that of the homologous genes in soybean, and the response time was also relatively rapid.

[0038] The above results suggest that there are differences in the expression patterns and regulatory patterns of GsALDH7B2 in soybean and wild soybean. GsALDH7B in wild soybean is involved in salt stress response and may be regulated by factors related to the ABA and GA signal pathways. It is very likely to improve the salt tolerance of soybean by introducing it into soybean.

[0039] Example 3: Overexpression of GsALDH7B2 in soybeans can improve the salt tolerance and antioxidant capacity of soybeans

[0040] 1. To further study the function of GsALDH7B2, the applicant used the Agrobacterium-mediated transformation method to overexpress the wild soybean GsALDH7B2 gene in soybeans, and a total of 44 transgenic plants were obtained, including six overexpression families, namely OE-7, 22, 26, 36, 37, and 38. After the overexpression plants and the control W82 wild type germinated for 2 days, seedlings with consistent growth were selected and placed in a phenotype observation bag, and water and 200 mM NaCl solution were added respectively for continuous cultivation for 7 days to observe the phenotype. The specific implementation plan is as follows:

[0041] (1) Design primers GsALDH7B2-FL-F: 5’-GAATTCATGGGTTCCGATAATACCAACT-3’ and GsALDH7B2-FL-R: 5’-GTCGACCTAGCCAAAGTTTATTCCCTGAG-3’. Using wild soybean leaf cDNA as a template, the CDS sequence encoded by the GsALDH7B2 gene was amplified using primers GsALDH7B2-FL-F and GsALDH7B2-FL-R. The amplified sequence is shown in SEQ ID NO:1, and the encoded amino acid sequence is shown in SEQ ID NO.2. The PCR reaction conditions are as follows: pre-denaturation at 95°C for 3 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, for 33 cycles; extension at 72°C for 5 min.

[0042] (2) The PCR product obtained by amplification was ligated into the pGEM-T Easy vector by enzymatic digestion and ligation methods, positive clones were screened and confirmed by sequencing, and the CDS sequence of GsALDH7B2 was obtained. Its sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0043] (3) Soybean genetic transformation:

[0044] Using wild soybean leaf cDNA as a template, PCR amplification was performed with the primer pair shown in SEQ ID NO.3-4 (F: GAATTCATGGGTTCCGATAATACCAACT and R: CGGGATCCGCCAAAGTTTATTCCCTGAG) to obtain a PCR product;

[0045] The PCR product was ligated into the transformation vector pCAMBIA3300 (restriction enzyme cleavage sites of EcoR1 and BamH1) through enzymatic digestion and ligation, and the vector was transferred into Agrobacterium tumefaciens EHA105 by electroporation and identified by PCR. Using soybeans germinated for 1 day as materials, they were placed in a petri dish containing 50 ml of Agrobacterium suspension, and about 150 explants were treated within 2 hours and placed at room temperature for 30 minutes for infection. After the infection ended, the Agrobacterium suspension was discarded, and the explants were placed in the co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to the resting medium, light-cultured at 25°C for 7 days, and then placed on the screening medium with corresponding resistance for screening culture for three weeks to induce resistant buds. Then, they were transferred to the elongation medium with corresponding resistance for light-culturing for 6 - 9 weeks, and the regenerated and elongated seedlings were rooted to obtain transgenic seedlings.

[0046] (4) Manage in the normal way. After about 3 weeks, extract the DNA of soybean plants from individual plants, and use the primer pair

[0047] qF: 5’-CTATTCCGGCACCGAAGAGA-3’; qR: 5’-TTGGCCCTCAATGCTTCAC-3’ to identify positive seedlings of soybeans and eliminate negative plants. After positive screening, select single-copy positive families for subsequent experiments. Select overexpression plants and wild-type control plants that have grown for 3 days and are of the same size. Add 200 mM concentration of NaCl to the soil, and after 7 days, observe, take pictures, sample and analyze, etc., to monitor the growth of soybeans.

[0048] (5) Select overexpression plants and wild-type control plants that have grown normally for 14 days and are of the same size. Select leaves from the same part, punch out leaf discs of the same size (diameter of 0.8 cm), and add the photo-oxidant methyl viologen to treat the leaf discs of wild-type and overexpression plants for 24 h, and observe the phenotypes.

[0049] The results are as Figure 3 shown in A - B, showing that the growth of the GsALDH7B2 overexpression material under salt stress treatment is significantly better than that of the wild type (as Figure 3 shown in A - B), indicating that overexpression of GsALDH7B2 can significantly improve the salt tolerance of soybeans.

[0050] 2. In addition, the applicant found that by treating wild-type and overexpression plants with the photo-oxidant methyl viologen, the overexpression plants have obvious antioxidant ability (as Figure 3 shown in C), and ALDH is a class of genes that can remove aldehyde substances, and its antioxidant ability largely comes from aldehyde catalytic activity.

[0051] In summary, overexpression of GsALDH7B2 can improve the salt tolerance and antioxidant ability of soybeans, and it is a positive regulatory factor for salt stress response.

[0052] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article or apparatus comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or elements inherent to such process, method, article or apparatus.

[0053] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0054] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Application of a wild soybean GsALDH7B2 gene in improving salt tolerance and antioxidant capacity of soybean Characterized in that, The wild soybean GsALDH7B2 The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. Application of a recombinant vector in improving salt tolerance and antioxidant capacity of soybean, Characterized in that, The recombinant vector contains the wild soybean with the CDS sequence shown in SEQ ID NO.1 GsALDH7B2 gene.

3. Application of a transformant in improving salt tolerance and antioxidant capacity of soybean, Characterized in that, The transformant contains a recombinant vector capable of expressing the wild soybean gene shown in SEQ ID NO.1 GsALDH7B2 gene.

4. A method for improving salt tolerance and antioxidant capacity of soybean, Characterized in that, The method comprises: Overexpress the wild soybean shown in SEQ ID NO.1 in cultivated soybean GsALDH7B2 gene.

Images