DNA aptamer nanoflower-modified capillary silica monolithic column and its chiral separation method for histidine

By modifying single-stranded DNA or DNA nanoflowers on a capillary silica monolithic column, a new capillary electrochromatographic chiral separation system was constructed, which solved the problem of chiral separation of amino acid enantiomers, achieved baseline separation and efficient separation of histidine, and expanded the application of DNA aptamers.

CN117504839BActive Publication Date: 2025-10-03CHANGZHOU UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202311832954.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2025-10-03
Estimated Expiration
2043-12-28

AI Technical Summary

Technical Problem

There are few methods for chiral separation of amino acid enantiomers in the prior art, and there are few reports on the use of immobilized DNA aptamers for chiral separation, making it difficult to achieve efficient and rapid separation.

Method used

Single-stranded DNA or DNA nanoflowers are used as chiral selectors to modify the capillary silica monolithic column and construct a new capillary electrochromatographic chiral separation system. The high specific surface area and specific sequence of DNA aptamer nanoflowers are utilized to interact with histidine molecules to achieve efficient separation.

Benefits of technology

The baseline separation of histidine was achieved, which expanded the application of DNA aptamers as chiral selectors in the field of capillary electrochromatography chiral separation and provided a fast and efficient analysis platform.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention discloses a capillary silica monolith column modified with DNA aptamer nanoflowers and a method for chiral separation of histidine, which belongs to the field of pharmaceutical analysis. The method first prepares a capillary silica monolith column, then immobilizes the DNA aptamer nanoflowers as chiral selectors onto a graphene oxide-functionalized capillary silica monolith. The chiral molecules are then separated under electrophoretic conditions. This method achieves baseline separation of histidine enantiomers. The separation method is simple to operate and establishes a novel, highly selective chiral separation and detection technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of drug analysis, and particularly relates to a method for chiral separation of histidine based on a DNA aptamer nanoflower-modified capillary silica monolithic column and a chiral separation method thereof. Background Art

[0002] Chiral separation is of great practical significance because a pair of enantiomers have different physiological effects and pharmacological toxicities. Developing methods for the chiral separation of amino acid enantiomers is crucial for exploring chiral recognition in nature. Among the many methods for chiral separation of amino acids, capillary electrochromatography (CEC) technology has its unique advantages. It combines the high selectivity of high-performance liquid chromatography with the high efficiency of capillary electrophoresis. Compared with HPLC, CEC is more environmentally friendly and energy-efficient. The CEC system based on capillary silica monolithic columns can provide a higher specific surface area for the immobilization of chiral selectors, which is conducive to enhancing the interaction between amino acid small molecules and chiral selectors, achieving efficient and rapid separation.

[0003] Endogenous biomolecules such as polysaccharides and proteins are commonly used as chiral immobilized phases in chiral separations, but the immobilization of DNA aptamers for chiral separations is less well documented. This paper constructs a novel CEC chiral separation system using single-stranded DNA sequences and nanoflowers self-assembled from DNA aptamers as chiral selectors. Summary of the Invention

[0004] The purpose of the present invention is to broaden the scope of currently available chiral selectors. Single-stranded DNA or DNA nanoflowers are selected as chiral selectors, a capillary silica monolith is used as a matrix column, DNA is bonded to the capillary silica monolith, and different types of DNA-modified capillary columns are obtained for chiral separation, and baseline separation of histidine has been preliminarily achieved.

[0005] In order to solve the technical problem, the technical solution adopted by the present invention is:

[0006] A capillary silica monolithic column for histidine chiral separation is a capillary silica monolithic column functionalized with amino-DNA-modified graphene oxide; the DNA is any one of poly-dA, poly-dT, poly-dG, poly-dC, and DNA aptamer nanoflowers.

[0007] The DNA aptamer nanoflower is a nanoflower structure formed by rolling circle amplification of a circular DNA template formed by a DNA template chain and a primer under the action of DNA ligase;

[0008] Specifically, the synthesis method for the amino-modified DNA aptamer nanoflowers is as follows: a DNA template strand (10 μM) and an amino-modified primer strand (10 μM) are mixed in 10× DNA ligase buffer, heated at 95°C for 5 minutes, and then slowly cooled to room temperature. The annealed products are ligated using T4 DNA ligase, and the reaction is continued at room temperature for 4 hours to obtain a circularized DNA template. The circularized DNA template is then incubated with Phi29 DNA polymerase, dNTPs, and BSA at 30°C for 3 hours. The reaction is terminated by heating at 75°C for 10 minutes. The pellet is then centrifuged and rinsed with deionized water to obtain the amino-modified DNA aptamer nanoflowers.

[0009] The nucleotide sequence of the DNA template strand is:

[0010] 5' - Phosphate - TTC CCG GCG GCG CAG CAG TTA GAT GCT GCT GCA GCG ATACGC GTA TCG CTA TGG CAT ATC GTA CGA TAT GCC GCA GCA GCA TCT AAC CGT ACA GTATT-3';

[0011] The nucleotide sequence of the primer is:

[0012] 5'-NH2-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'.

[0013] The sequences of the DNA single strands are:

[0014] poly-dA:5'-NH2-AAAAAAAAAAAAAAAAAAAAAAAAAAA-3';

[0015] poly-dT: 5'-NH2-TTTTTTTTTTTTTTTTTTTTTTTTTTTT-3';

[0016] poly-dG: 5'-NH2-GGGGGGGGGGGGGGGGGGGG-3';

[0017] poly-dC: 5'-NH2-CCCCCCCCCCCCCCCCCCCCC-3'.

[0018] Specifically, DNA modification involves injecting a 20 mmol / L 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride in phosphate into a graphene oxide-functionalized silica monolith for at least one hour. Then, the aforementioned amino-modified DNA single strand or amino-modified DNA aptamer nanoflower solution is added to the monolith and allowed to react for five hours, immobilizing the DNA on the graphene oxide-modified silica monolith. Unreacted DNA is then removed by rinsing with buffer, resulting in a DNA-modified capillary silica monolith, which is then stored in electrophoresis buffer. The DNA can be single strands of DNA of varying sequences (poly-dG, poly-dC, poly-dA, poly-dT), or any of the DNA aptamer nanoflowers.

[0019] Among them, the concentration of poly-dA, poly-dT, poly-dG, and poly-dC is 10 μM; the concentration of DNA aptamer nanoflower is 0.001 μmol / L-1 μmol / L.

[0020] The capillary silica monolithic column modified with the aforementioned DNA single strand and DNA aptamer nanoflowers was used for the chiral separation of histidine. The sample solution was prepared by dissolving the chiral histidine molecule in electrophoresis buffer. The capillary column was equilibrated with electrophoresis buffer for 30 minutes before injection. The injection voltage was 10 kV for 3 seconds, and the separation voltage was 10 kV.

[0021] Furthermore, the concentration of histidine in the sample solution is 1 mg / mL.

[0022] Furthermore, the electrophoresis buffer is a phosphate buffer with a concentration of 20 mmol / L and a pH value of 7.4.

[0023] In a specific embodiment of the present invention, capillary electrochromatographic chiral separation systems modified with poly-dA, poly-dT, poly-dG, and poly-dC were constructed, respectively, which can achieve partial separation of histidine chiral molecules.

[0024] In a specific embodiment of the present invention, a capillary electrochromatographic chiral separation system modified with DNA aptamer nanoflowers was constructed to achieve baseline separation of histidine.

[0025] This invention constructs a novel capillary electrochromatographic chiral separation system based on immobilized DNA aptamer nanoflowers. By employing the aforementioned technical solution, the present invention achieves the following beneficial effects: The method provided by the present invention for chiral separation of histidine using a DNA-modified capillary silica monolithic column further expands the application of DNA aptamers as chiral selectors in capillary electrochromatographic chiral separations. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a scanning electron microscope image of DNA aptamer nanoflower.

[0027] Figure 2 This is a scanning electron micrograph of the cross section of a capillary silica monolith modified with DNA aptamer nanoflowers.

[0028] Figure 3 This is the agarose gel electrophoresis diagram of DNA aptamer nanoflowers.

[0029] Figure 4 Effects of different pH buffers on the stability of DNA aptamer nanoflowers; (a) 1 h; (b) 8 h; (c) 16 h; (d) 24 h; (e) 48 h; (f) 72 h.

[0030] Figure 5 Electrochromatogram of the separation of histidine enantiomers using a DNA aptamer nanoflower-modified capillary silica monolithic column.

[0031] Figure 6 Figure 3. Effect of injection volume on the separation of histidine enantiomers using a DNA aptamer nanoflower-modified capillary silica monolithic column. Injection volume: a, 10 kV, 6 s; b, 10 kV, 3 s; c, 10 kV, 1 s.

[0032] Figure 7 This is the electrochromatogram of the separation of tryptophan enantiomers using a DNA aptamer nanoflower-modified capillary silica monolithic column.

[0033] Figure 8 The electrochromatogram of the separation of histidine enantiomers using a poly-dA modified capillary silica monolithic column.

[0034] Figure 9 The electrochromatogram of the separation of histidine enantiomers using a poly-dT modified capillary silica monolithic column.

[0035] Figure 10 The electrochromatogram of the separation of histidine enantiomers using a poly-dG modified capillary silica monolithic column.

[0036] Figure 11 The electrochromatogram of the separation of histidine enantiomers using a poly-dC modified capillary silica monolithic column.

[0037] Figure 12 Electrochromatogram of the separation of histidine enantiomers using a graphene oxide-functionalized capillary silica monolithic column. DETAILED DESCRIPTION

[0038] The present invention will be further described with reference to the following examples. However, it should be understood that these examples are for illustrative purposes only and should not be construed as limiting the present invention. Example 1

[0039] (1) Graphene oxide functionalized silica monolithic columns were prepared according to the method of CN116943286A.

[0040] (2) Preparation of DNA aptamer nanoflowers:

[0041] 5'-phosphorylated template strand:

[0042] 5'-Phosphate-TTCCCGGCGGCGCAGCAGTTAGATGCTGCTGCAGCGATACGCGTATCGCTATGGCATATCGTACGATATGCCGCAGCAGCATCTAACCGTACAGTATT-3'

[0043] Amino-modified primer strand:

[0044] 5'-NH2-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'

[0045] The DNA aptamer template strand (10 μM, 6 μL) and the amino-modified primer strand (10 μM, 12 μL) were mixed in 10× DNA ligase buffer and heated at 95°C for 5 minutes, followed by slow cooling to room temperature. The annealed products were ligated using T4 DNA ligase, and the reaction was continued at room temperature for 4 hours to obtain a circularized DNA template. The circularized DNA template was incubated with Phi29 DNA polymerase, dNTPs, and BSA at 30°C for 3 hours and terminated by heating at 75°C for 10 minutes. The pellet was centrifuged and rinsed with deionized water to obtain the DNA aptamer nanoflowers.

[0046] A 20 mmol / L 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride in phosphate solution (2 mL) was injected into a graphene oxide-modified silica monolith for 1 hour. A 100 μL solution of DNA aptamer nanoflowers (ranging from 0.001 μmol / L to 1 μmol / L, with varying concentrations having little effect on the modification effect) was then injected and allowed to react for at least 5 hours. Unreacted DNA was removed by washing with buffer, resulting in a capillary silica monolith modified with single-stranded DNA and DNA nanoflowers, which was then stored in electrophoresis buffer.

[0047] The prepared DNA aptamer nanoflowers were characterized by scanning electron microscopy and agarose gel electrophoresis ( Figure 1 , Figure 3The cross-sectional structure of the DNA aptamer nanoflower modified capillary silica monolith was characterized using scanning electron microscopy ( Figure 2 ). Example 2

[0048] The DNA aptamer nanoflowers prepared according to the method of Example 1 were further investigated for their stability. The DNA aptamer nanoflowers were exposed to solutions of different pH values ​​(5-9) for a certain period of time to investigate the stability of the DNA in the DNA aptamer nanoflowers. The stability of the DNA aptamer nanoflowers was evaluated by agarose gel electrophoresis after the DNA aptamer nanoflowers were exposed to solutions of different pH values ​​for 1 h, 8 h, 16 h, 24 h, 48 h and 72 h. Figure 4 After the DNA aptamer nanoflowers were exposed to solutions of different pH values ​​for 72 hours, there was no band breakage in the agarose gel electrophoresis diagram, indicating that the DNA aptamer nanoflowers were relatively stable under pH conditions of 5-9. Example 3

[0049] According to the method of Example 1, the prepared DNA aptamer nanoflower-modified capillary silica monolithic column was used for histidine chiral separation. 20 mM phosphate buffer was prepared and the pH was adjusted to 7.4. Purchased histidine (McLean (Shanghai, China)) was dissolved in electrophoresis buffer and a 1 mg / mL sample solution was prepared at room temperature. The electrophoresis separation voltage was 10 kV, the buffer concentration was 20 mM, and the injection volume was 10 kV for 1-6 s. Optimization was performed to obtain the optimal electrophoresis conditions for the separation of histidine enantiomers ( Figure 5 ).like Figure 6 As the injection volume increases, the chromatographic peak will tail, the column efficiency will decrease, and the separation of histidine enantiomers will decrease at higher sample volumes. The optimal value of the injection volume was finally determined to be 10 kV, 3 s. Example 4

[0050] According to the method of Example 1, the prepared DNA aptamer nanoflower-modified capillary silica monolithic column was used for tryptophan chiral separation. 20 mM phosphate buffer was prepared and the pH value was adjusted to 7.4. Purchased tryptophan (McLean (Shanghai, China)) was dissolved in electrophoresis buffer and a 1 mg / mL sample solution was prepared at room temperature. The electrophoresis separation voltage was 10 kV, the buffer concentration was 20 mM, and the injection volume was 10 kV for 3 s. Figure 7 As shown in the figure, the capillary silica monolithic column modified with DNA aptamer nanoflowers does not have chiral separation performance for tryptophan enantiomers. Therefore, the selective separation of histidine by DNA aptamer nanoflowers is specific. Example 5

[0051] Following the method of Example 1, a poly-dA solution (10 μM, 100 μL) was used instead of the DNA aptamer nanoflower solution to prepare a poly-dA modified capillary silica monolithic column, and chiral separation of histidine was performed according to the optimal conditions of Example 3. Figure 8 As shown, the poly-dA-modified capillary silica monolithic column only partially separated histidine chiral molecules. However, the capillary silica monolithic column modified with DNA aptamer nanoflowers in Example 3 achieved baseline separation of histidine. This is presumably due to the large number of repeating sequences and high specific surface area in the DNA aptamer nanoflowers, which enhance the interaction between the chiral drug and the nanoflowers, thereby improving the chiral separation efficiency. Example 6

[0052] Following the method of Example 1, a poly-dT solution (10 μM, 100 μL) was used instead of the DNA aptamer nanoflower solution to prepare a poly-dT chain-modified capillary silica monolithic column, and chiral separation of histidine was performed according to the optimal conditions of Example 3. Figure 9 As shown in the figure, the poly-dT chain modified capillary silica monolithic column only achieves partial separation of histidine chiral molecules. Example 7

[0053] According to the method of Example 1, the DNA aptamer nanoflower solution was replaced with poly-dG solution (10 μM, 100 μL) to prepare a poly-dG chain modified capillary silica monolithic column, and the chiral separation of histidine was performed according to the optimal conditions of Example 3. Figure 10 As shown in the figure, the poly-dG chain modified capillary silica monolithic column only achieves partial separation of histidine chiral molecules. Example 8

[0054] Following the method of Example 1, the DNA aptamer nanoflower solution was replaced with a poly-dC solution (10 μM, 100 μL) to prepare a poly-dC chain-modified capillary silica monolithic column, and chiral separation of histidine was performed according to the optimal conditions of Example 3. Figure 11 As shown in the figure, the poly-dC chain modified capillary silica monolithic column only achieves partial separation of histidine chiral molecules. Example 9

[0055] The graphene oxide modified capillary silica monolithic column without DNA modification was used for chiral separation of histidine according to the optimal conditions of Example 3. Figure 12 As shown in the figure, the graphene oxide modified capillary silica monolithic column has no chiral separation efficiency for histidine. Therefore, the chiral separation performance of the DNA aptamer nanoflower modified capillary silica monolithic column can be attributed to the combined effect of the DNA aptamer nanoflowers.

[0056] It can be seen from the above examples that the capillary electrochromatography technology based on DNA-modified silica monolithic columns provides a fast and efficient analytical platform for the separation of enantiomers.

[0057] With the above-described preferred embodiments of the present invention as a guide, and with reference to the above description, relevant personnel are fully capable of making various changes and modifications without departing from the technical scope of this invention. The technical scope of this invention is not limited to the contents of the specification and must be determined according to the scope of the claims.

Claims

1. Application of a capillary silica monolithic column for chiral separation of histidine, characterized in that: The capillary silica monolith is an amino-modified graphene oxide-functionalized capillary silica monolith; the DNA is a DNA aptamer nanoflower; the DNA aptamer nanoflower is a nanoflower structure formed by rolling circle amplification of a circular DNA template formed by a DNA template chain and a primer closed under the action of DNA ligase; the nucleotide sequence of the DNA template chain is: 5'-Phosphate-TTC CCG GCG GCG CAG CAG TTA GAT GCT GCT GCA GCG ATA CGC GTA TCG CTA TGG CATATC GTA CGA TAT GCC GCA GCA GCA TCT AAC CGT ACA GTA TT-3'; the nucleotide sequence of the primer is: 5'-NH2-TCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA-3'.

2. The use of the capillary silica monolithic column according to claim 1 for chiral separation of histidine, characterized in that: The preparation method of the DNA-modified capillary silica monolithic column comprises the following steps: injecting a phosphate solution of 20 mmol / L 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride into a graphene oxide-functionalized silica monolithic column for at least 1 hour, then injecting an amino-modified DNA solution and reacting for at least 5 hours, and rinsing with an electrophoresis buffer to obtain the column; wherein the DNA solution is a DNA aptamer nanoflower solution with a concentration of 0.001 μmol / L-1 μmol / L.

3. Use of the capillary silica monolithic column according to claim 1 for chiral separation of histidine, characterized in that: Histidine is dissolved in electrophoresis buffer to prepare a sample solution at room temperature, and the sample solution is passed through the capillary silica monolithic column to separate chiral molecules under electrophoresis conditions.

4. Use of the capillary silica monolithic column according to claim 3 for chiral separation of histidine, characterized in that: The electrophoresis buffer was a phosphate buffer with a concentration of 20 mmol / L and a pH of 7.4; the concentration of histidine in the sample solution was 1 mg / mL; the electrophoresis separation voltage was 10 kV, and the injection volume was 10 kV for 3 s.

Citation Information

Patent Citations

  • Multifunctional magnetic DNA (deoxyribonucleic acid) nanosphere and preparation method and application thereof

    CN106754894A

  • Aptamer ordered functionalized affinity monolithic column and preparation method thereof

    CN115990355A

  • Chiral capillary electrochromatography based on DNA nanoflower modified silica gel monolithic column and application of chiral capillary electrochromatography

    CN116943286A