A strain of Bacillus lateralis and its application

Abstract

This invention relates to the field of microbial technology, specifically to a strain of *Bacillus laterosporus* and its applications. The *Bacillus laterosporus* provided by this invention (… Brevibacillus laterosporus HNBR05-1 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25886. *Bacillus laterosporus* HNBR05-1 exhibits highly effective inhibition of plant pathogens, demonstrating dual efficacy against plant diseases such as brown spot and bacterial leaf spot, with high control efficacy. It shows promising application prospects in plant disease control and lays the foundation for the development of highly effective biocontrol agents.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a strain of Bacillus lateralis and its applications. Background Technology

[0002] Fruit tree cultivation is a relatively long process, and the risk of disease is high. Inadequate disease control measures can easily lead to serious losses. While traditional chemical pesticides may achieve good results, they inevitably leave harmful residues, causing a decline in fruit quality and safety. With advancements in technology, biological control methods have become the preferred approach for fruit tree disease management, playing a crucial role in its control.

[0003] Shot hole disease is very common in fruit tree cultivation and management. It causes significant leaf drop, and in severe cases, leads to shoot death, reduced yield, and affects flower bud formation. It occurs in various stone fruits such as peaches, plums, apricots, and cherries. As one of the oldest fruit trees in China, peaches are most susceptible to shot hole disease. In many regions, the peak season for peach shot hole disease is after flowering in May and June. During the hot and rainy season, the disease is more likely to occur after rain. After infection, it not only causes premature leaf drop and shoot dieback, but also causes lesions and cracking on the fruit surface. Control is very difficult, and it severely damages peach yield and fruit quality.

[0004] Currently, the most common types of leaf spot disease in peach trees are bacterial leaf spot and brown spot, which can occur singly or in mixed outbreaks. Although both are leaf spot diseases, different types have different disease characteristics and control methods. Many fruit growers fail to accurately identify the type of leaf spot disease after it occurs, and blindly apply pesticides, often delaying control and causing the leaf spot disease to worsen. Different biocontrol agents have different antibacterial spectra, target pathogens, efficacy, and persistence. Therefore, when controlling leaf spot disease in peach trees, it is essential to find targeted drugs that can control both bacterial leaf spot and brown spot to achieve the best control effect.

[0005] Bacterial leaf spot of peach is a prevalent and severely damaging disease worldwide in recent years, seriously hindering the economic development of the peach industry. The pathogen of bacterial leaf spot of peach is *Xanthomonas auricula-judae* var. *peach* (…). Xanthomonas arboricola pv. pruni(Smith) Vauserin, Hoste, Kersters & Swings). Once this disease occurs, it is highly susceptible to large-scale outbreaks in hot and humid weather, making it difficult to control and often necessitating the felling of infected trees to contain the source of infection. The scientific management and control of this disease must be given sufficient attention. While the extensive use of chemical agents, including copper-based agents, is effective and fast-acting, it also brings significant problems such as environmental pollution, pesticide residues, and resistance. Therefore, there is an urgent need to find new, green, environmentally friendly, and effective alternatives for control, namely biological control. However, the biocontrol technology for bacterial spot disease of peach is still immature, with only a few related reports: Esitken et al. (Effects of foliar application of Bacillus subtilis OSU-142 on the yield, growth and control of shot-holedisease (Coryneum blight) of apricot. European Journal of Horticultural Science, 2002, 67(4). pp. 139-142) and Biondi et al. (Use of a bacterial antagonist for the biological control of bacterial leaf / fruit spot of stone fruits. IOBC / WPRS Bulletin, 2009, 277-281) found that some biocontrol bacteria Bacillus subtilis and Pseudomonas fluorescens can control bacterial spot disease of stone fruits. Kawaguchi et al. (Biological control of bacterial spot on peach by nonpathogenic bacteria) Xanthomonas campestris strains AZ98101 and AZ98106. Journal of General Plant Pathology, 2014, 80:158-163) (This refers to non-pathogenic strains...) Xanthomonas Suspensions of strains AZ98101 and AZ98106 were sprayed onto peach trees, followed by inoculation with Xap. Results showed that both strains could inhibit the reproduction of the pathogen causing peach bacterial spot disease. The control efficacy of these biocontrol bacteria against bacterial spot disease ranged from 50% to 75%.

[0006] Peach brown spot disease frequently occurs in major peach-producing areas, and its severity has been increasing in recent years. It primarily affects leaves, but can also damage new shoots and fruit. The pathogen causing peach brown spot disease is *Cercospora drupecarpa* (…). Cercospora circumscissa The pathogen can overwinter as mycelium in diseased leaves or twigs. The following spring, as temperatures rise and rainfall occurs, conidia are produced and spread by wind and rain. Conidia produced at later sites can then cause reinfection. Low temperatures and abundant rainfall favor the occurrence and spread of this disease, and peach brown spot disease is often accompanied by bacterial spot disease.

[0007] Currently, there are no existing biocontrol agents capable of simultaneously and efficiently inhibiting *Xanthomonas aurea* var. *peach* and *Cercospora drupecarpa* and their corresponding diseases. Therefore, screening for biocontrol agents that can effectively control these diseases is of great significance for crop disease prevention and yield improvement. Summary of the Invention

[0008] This invention provides a strain of Bacillus lateralis ( ) Brevibacillus laterosporus ) and its applications.

[0009] This invention isolated plant endophytic bacteria from peach trees for the control of plant diseases. The bacteria were identified as belonging to the Bacillus laterosporus species and named Bacillus laterosporus HNBR05-1. Bacillus laterosporus HNBR05-1 can effectively inhibit Xanthomonas aureus var. peaches and Cercospora drupe, demonstrating high efficacy against plant diseases caused by these pathogens.

[0010] Specifically, the present invention provides the following technical solutions:

[0011] This invention provides *Bacillus laterosporus* strain HNBR05-1, which was deposited on October 10, 2022, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and is classified as *Bacillus laterosporus*. Brevibacillus laterosporus The accession number is CGMCC No. 25886.

[0012] *Bacillus laterosporus* HNBR05-1 is a Gram-positive, aerobic bacterium with rod-shaped cells that appear pale yellow under a microscope. Its colonies are milky white with rounded, slightly transparent edges and a rough, slightly wrinkled, raised surface. *Bacillus laterosporus* HNBR05-1 can grow in media containing conventional carbon and nitrogen sources (e.g., LB broth), with an optimal culture temperature of 28–40°C and a pH of 6.3–7.5.

[0013] The 16S rDNA gene sequence of Bacillus laterosporus HNBR05-1 is shown in SEQ ID NO.1, the gyrA gene sequence is shown in SEQ ID NO.2, and the gyrB gene sequence is shown in SEQ ID NO.3.

[0014] The present invention provides a microbial preparation comprising the Bacillus retroflexus HNBR05-1.

[0015] Preferably, in the microbial preparation, Bacillus retroflexus HNBR05-1 exists in live form.

[0016] The aforementioned microbial preparations may be solid or liquid formulations.

[0017] The aforementioned microbial preparations may also contain carriers or excipients permitted in the field of microbial preparations, including but not limited to freeze-drying protectants (such as glycerin), rice husk powder, peat moss, calcium carbonate, talc, attapulgite, diatomaceous earth, etc.

[0018] The present invention provides a biocontrol agent comprising, or prepared from, the Bacillus retroflexus HNBR05-1.

[0019] The active ingredients of the biocontrol agents described above may consist of one or more of Bacillus lateralis HNBR05-1, its fermentation supernatant, and fermentation broth extract, or may also contain other microorganisms, compounds, or plant extracts that have the effect of inhibiting plant pathogens.

[0020] The present invention provides a method for preparing the microbial preparation or biocontrol preparation, the method comprising the step of culturing the Bacillus laterosporus HNBR05-1 at 28~40℃, pH 6.3~7.5 and under aeration conditions to obtain a live bacterial culture.

[0021] As one embodiment of the present invention, the preparation method of the microbial preparation or the biocontrol preparation includes the following steps:

[0022] (1) Activation of bacterial strain: Bacillus lateralis HNBR05-1 was inoculated onto LB solid medium and streaked continuously at 28~32℃. Single colonies were picked and placed in LB liquid medium and cultured at 33~37℃ and 160~200rpm for 36~48h to obtain activated bacterial solution;

[0023] (2) Seed culture: In a fermenter containing seed culture medium, inoculate the activated bacterial solution obtained in step (1) at a volume ratio of 1:9, and culture at 33~37℃ and 160~200 rpm for 24~36h to obtain liquid seed;

[0024] (3) Fermentation culture: Inoculate the liquid seed obtained in step (2) into the seed culture medium at an inoculation amount of 10-20% by volume, and culture it under aeration, at 33-37℃ and 160-200 rpm for 36-48 h to obtain live bacterial culture.

[0025] The live bacterial culture obtained in step (3) above was adjusted to a bacterial count of 1.0 × 10⁻⁶. 10 ~2.0×10 10 The concentration of cfu / mL can be used to obtain a liquid bacterial agent, or excipients can be added to obtain a liquid bacterial agent.

[0026] The live bacterial culture obtained in step (3) above is added to a carrier, dispersant, wetting agent and protectant to obtain a wettable powder containing Bacillus retrosporum HNBR05-1.

[0027] The bacterial cells of the live bacterial culture obtained in step (3) are removed by centrifugation or filtration to obtain the fermentation supernatant of Bacillus lateralis HNBR05-1.

[0028] This invention demonstrates through experiments that Bacillus lateralis HNBR05-1 has a highly effective inhibitory effect on plant pathogens such as Xanthomonas aurea var. peach and Cercospora drupe, and has a high preventive effect on plant diseases caused by Xanthomonas aurea var. peach and Cercospora drupe (such as bacterial leaf spot and brown spot of peach).

[0029] Based on the above functions, the present invention provides the following applications of Bacillus retroflexus HNBR05-1:

[0030] The present invention provides the application of the Bacillus lateralis HNBR05-1 or the microbial preparation or the biocontrol preparation in inhibiting plant pathogens.

[0031] Preferably, the plant pathogen is Xanthomonas aurea var. truncatum and / or Cercospora drupe.

[0032] This invention provides the application of the Bacillus lateralis HNBR05-1, the microbial preparation, or the biocontrol agent in the prevention and control of plant diseases.

[0033] The plant diseases mentioned include diseases of stone fruit trees.

[0034] Preferably, the plant disease is peach bacterial spot and / or brown spot, or the plant disease is a plant disease caused by infection with Xanthomonas aurea var. peache and / or Cercospora drupe, other than peach bacterial spot and brown spot.

[0035] This invention provides the application of the Bacillus lateralis HNBR05-1 or the microbial preparation in the selection and breeding of agricultural microorganisms.

[0036] The agricultural microorganisms mentioned above include agricultural microorganisms with plant disease control functions.

[0037] The above applications can be used to select agricultural microorganisms from Bacillus lateralis HNBR05-1 through mutagenesis, adaptive evolution, and genetic engineering.

[0038] This invention provides the application of the Bacillus lateralis HNBR05-1, the microbial preparation, or the biocontrol preparation in the preparation of agricultural formulations.

[0039] Preferably, the agricultural preparation has functions selected from plant disease control.

[0040] The above-mentioned agricultural formulations can be prepared using one or more of the following: bacterial cells, bacterial powder, bacterial suspension, fermentation supernatant, and fermentation broth extract of Bacillus laterosporus HNBR05-1.

[0041] The present invention provides a method for preventing and controlling plant diseases, the method comprising: applying the Bacillus retrosporum HNBR05-1 or the microbial preparation or the biocontrol preparation to the plant.

[0042] Preferably, the plant disease is a plant disease caused by infection with Xanthomonas aurea var. truncatum and / or Cercospora drupecarpa.

[0043] Preferably, the plant disease is bacterial spot and / or brown spot, or the plant disease is a plant disease caused by infection with Xanthomonas aurea var. truncatum and / or Cercospora drupe, other than bacterial spot and brown spot.

[0044] The plants described in this invention are dicotyledonous or monocotyledonous plants, including but not limited to drupe plants, such as peach, apricot, plum, cherry, blueberry, kiwi, hawthorn, apple, pear, grape, papaya, jujube, tomato, cucumber, eggplant, pumpkin, potato, tobacco, cabbage, Arabidopsis thaliana, etc.

[0045] Preferably, the plant is a drupe fruit tree, including peach, plum, apricot, cherry, and plum, and more preferably peach.

[0046] Preferably, the application method includes spraying or the like.

[0047] Preferably, when applying by spraying, the dosage of Bacillus laterosporus HNBR05-1 is 1.0 × 10⁻⁶ per plant. 10 CFU ~1.5×10 10 CFU.

[0048] Specifically, when used for disease control, when plant diseases are sporadic, a concentration of 10 is applied. 6 ~10 7 Spray with 80-110 L / mu of Bacillus lateralis HNBR05-1 bacterial solution (cfu / mL).

[0049] The *Bacillus lateralis* HNBR05-1 provided by this invention has at least the following beneficial effects:

[0050] (1) It can effectively inhibit plant pathogens: Bacillus lateralis HNBR05-1 has excellent inhibitory effects on plant pathogens such as Xanthomonas aureus var. peach and plum (inhibition zone diameter reaches 56 mm) and Cercospora drupe (inhibition rate reaches 93.90%).

[0051] (2) It has both therapeutic and preventive effects on plant diseases: Bacillus lateralis HNBR05-1 has a high preventive effect on plant diseases such as bacterial spot disease and brown spot disease of peach caused by Xanthomonas truncatulae and Cercospora drupe, with an average preventive effect of over 90.0%.

[0052] (3) Using Bacillus lateralis HNBR05-1 to control plant diseases is less likely to produce drug resistance, has good long-lasting efficacy, and is safe for humans and animals and will not cause environmental pollution.

[0053] (4) The preparation method of the bacterial agent and biocontrol agent of Bacillus laterosporus HNBR05-1 is simple, low cost and easy to use.

[0054] In conclusion, Bacillus laterosporus HNBR05-1 has great application prospects in the control of plant diseases, providing new strain resources for the biological control of plant diseases and laying the foundation for the development of highly efficient and broad-spectrum biocontrol agents. Attached Figure Description

[0055] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0056] Figure 1 This is a morphological image of Bacillus lateralis HNBR05-1 on an LB plate in Example 1 of the present invention.

[0057] Figure 2 This is an electrophoresis diagram of the PCR amplification products of 16S rDNA, gyrA and gyrB genes of Bacillus lateralis HNBR05-1 in Example 1 of the present invention. The left diagram is a schematic diagram of the DNA marker band size, and the right diagram is an electrophoresis diagram of the PCR amplification products of 16S rDNA, gyrA and gyrB genes. Lane 1 is the amplification product of 16S rDNA, lane 2 is the amplification product of gyrA gene, lane 3 is the amplification product of gyrB gene, and M is the DNA marker.

[0058] Figure 3 This is a phylogenetic tree of Bacillus lateralis HNBR05-1 obtained from the 16S rDNA sequence in Example 1 of the present invention.

[0059] Figure 4 This is the phylogenetic tree of Bacillus lateralis HNBR05-1 obtained from the gyrA gene sequence in Example 1 of the present invention.

[0060] Figure 5 This is the phylogenetic tree of Bacillus lateralis HNBR05-1 obtained from the gyrB gene sequence in Example 1 of the present invention.

[0061] Figure 6 This invention demonstrates the inhibitory effect of Bacillus lateralis HNBR05-1 on Xanthomonas aureus var. truncatula and Cercospora drupe in Example 3 of this invention. The left figure shows the size of the inhibition zone of strain HNBR05-1 against Xanthomonas aureus var. truncatula, and the right figure shows the inhibitory effect of strain HNBR05-1 against Cercospora drupe.

[0062] Figure 7 This study examines the resistance of Bacillus lateralis HNBR05-1 to different antibiotics in Example 6 of this invention. Detailed Implementation

[0063] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0064] Unless otherwise specified, all percentages in the following examples are by weight.

[0065] The specific culture medium formulations involved in the following examples are as follows:

[0066] LB solid medium (culture preservation medium): 5g yeast extract, 5.0g peptone, 3.0g beef extract, 15.0g agar, 5mg MnSO4·H2O, add water to 1L, pH 6.3-7.5.

[0067] LB culture medium (strain activation medium): 5g yeast extract, 5.0g peptone, 3.0g beef extract, 5mg MnSO4·H2O, add water to 1L, pH 6.3-7.5.

[0068] Seed culture medium (liquid): 15 g sucrose, 4.8 g K₂HPO₄, 3.5 g KH₂PO₄, 2 g (NH₄)₂SO₄, 0.16 g MgCl₂, 0.02 g CaCl₂, 0.0024 g Na₂MoO₄•2H₂O, 0.0018 g FeCl₃, 0.0015 g MnCl₂•2H₂O, 2 g sodium chloride, add water to 1 L, pH 6.3-7.5.

[0069] All the above culture media were sterilized at 121℃ for 15-30 min.

[0070] LB plates: Prepare 100 mL of the above LB solid medium. After autoclaving, place the melted LB solid medium in a 55°C water bath. When the medium temperature drops to 55°C, pour the plates into a sterile petri dish and add 10 mL of LB solid medium. Open the lid and irradiate under a UV lamp for 10-15 minutes. After cooling, seal with sealing film and invert in a 4°C refrigerator for later use.

[0071] PDA plates: Peel 200 g of potatoes, cut them into small pieces, put them in a pot, add 1000 mL of water, heat to a boil and continue for 20-30 minutes. Filter through 4 layers of gauze while hot to remove residue, add 20 g of agar powder, wait for the agar to dissolve, add 20 g of glucose, add water to make up to 1000 mL, sterilize at 121℃ for 15-30 minutes, remove and cool to 55℃, pour 10 mL of culture medium into a sterilized petri dish, open the lid, irradiate under a UV lamp for 10-15 minutes, cool, seal with sealing film and invert and store in a 4℃ refrigerator for later use.

[0072] The pathogenic strains used in the following examples are: Xanthomonas aurea var. peach-plum (A Preliminary Study on the Identification and Biological Control of Peach Leaf Diseases in Hebei Province. Dissertation, 2022), provided by Hebei Agricultural University; and Cercospora drupe (A Study on the Control Effect of Enoxacillin·Tebuconazole on Peach Brown Spot Perforation Disease. Science of Biological Disasters, 2020, 43(1): 26-28), provided by Shandong Green Food Development Center.

[0073] The peach varieties used in the following examples are the following three varieties: Okubo (susceptible to bacterial spot disease), Ruipan (susceptible to brown spot disease), and Zhongyoupan No. 7 (mixed bacterial spot disease and brown spot disease), all of which came from the Mancheng District Nursery in Baoding City, Hebei Province.

[0074] Example 1: Obtaining and identifying Bacillus retroflexus HNBR05-1

[0075] 1. Screening and isolation of Bacillus retrosporum strain HNBR05-1

[0076] (1) Sample collection: Fresh leaves of peach trees from Hebei Jinxianhe Modern Agricultural Development Co., Ltd. were collected. The dust on the surface of the leaves was washed off with sterile water. Then the leaves were disinfected by soaking in 75% alcohol for 1 min and 8% NaClO for 4 min in sequence. The leaves were washed with sterile water 4 times.

[0077] (2) Separation and screening: Cut the leaves into 1cm×1cm fragments, add water and grind into a paste, let stand for 10 min and spread on LB plates, and place them at 30 ℃ for 48 h;

[0078] (3) Purification: After the culture has grown, the plate streak isolation method is used for purification. The colonies are picked and streaked on the enrichment medium until pure culture is obtained.

[0079] Targeting bacterial spot and brown spot diseases of peach, biocontrol bacteria were screened using the inhibition zone method / plate confrontation method and field plot experiment method. Finally, a strain that showed good control effects against bacterial spot and brown spot diseases of peach caused by *Xanthomonas aurea* var. *prunus* and *Cercospora drupecarpa* was selected and named strain HNBR05-1.

[0080] 2. Classification and identification of strain HNBR05-1

[0081] (1) Morphological characteristics identification

[0082] Strain HNBR05-1, when cultured on LB medium, forms rod-shaped, Gram-positive, aerobic cells that appear pale yellow under a microscope; its colonies are milky white with rounded, slightly transparent edges and a rough, slightly wrinkled, raised surface. Figure 1 When streaked on nutrient agar slant, the streaks are linear. When incubated statically in liquid medium, the liquid is opaque and milky white. These morphological characteristics are basically consistent with the morphological characteristics of Bacillus genus described in "Handbook of Systematic Identification of Common Bacteria" (edited by Dong Xiuzhu et al., Science Press, 2001), and the strain HNBR05-1 is preliminarily identified as Bacillus.

[0083] (2) Physiological and biochemical identification: Referring to the physiological and biochemical identification indicators in the "Handbook for Systematic Identification of Common Bacteria", the test strain was subjected to VP test, MR test, salt tolerance test, catalase test, sugar alcohol fermentation test, starch hydrolysis and gelatin liquefaction tests, etc. Some physiological and biochemical characteristics of strain HNBR05-1 are shown in Table 1. Based on the results of the physiological and biochemical tests and the morphological characteristics, strain HNBR05-1 can be preliminarily identified as Brevibacillus Bacillus genus.

[0084] Table 1. Physiological and biochemical experimental results of strain HNBR05-1

[0085]

[0086] Note: +: positive; -: negative.

[0087] (3) Identification and classification using 16S rDNA sequences

[0088] Using genomic DNA from HNBR05-1 as a template, PCR amplification was performed using universal primers F27 and R1492 to obtain the PCR amplification products. The sequences of primers 27F and 1492R are as follows:

[0089] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO. 4);

[0090] 1492R: 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO. 5).

[0091] The PCR reaction system (20 μL) for 16S rDNA amplification was as follows: 10×Ex Taq buffer 2.0 μL; 5U Ex Taq 0.2 μL; 2.5 mM dNTP Mix 1.6 μL; 27 F 1 μL; 1492 R 1 μL; HNBR05-1 genomic DNA 0.5 μL; ddH2O to bring the total volume to 20 μL.

[0092] The PCR reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1.5 min, 25 cycles; 72℃ for 10 min. The obtained PCR amplification products were subjected to gel electrophoresis and sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing to obtain the 16S rDNA sequence of HNBR05-1 (as shown in SEQ ID NO.1).

[0093] The electrophoretic detection results of PCR amplification products are as follows: Figure 2 As shown.

[0094] A phylogenetic tree was constructed using the 16S rDNA sequence of strain HNBR05-1 using MEGA software (Molecular Evolutionary Genetics Analysis), as shown in the phylogenetic analysis diagram. Figure 3 As shown, the 16S rDNA gene sequence of the strain was compared with that of the registered bacterial strain using the BLAST program on the GenBank website (http: / / www.ncbi.nlm.nih.gov / ). The results showed that the 16S rDNA of this strain had the highest similarity to Bacillus laterosporus, reaching 97.90%.

[0095] (4) Identification and classification based on gyrA gene sequence

[0096] Using genomic DNA of strain HNBR05-1 as a template, PCR amplification was performed using primers 42F and 1066R for the Bacillus gyrA gene. The PCR amplification products were obtained, and the sequences of the gyrA-F and gyrA-R primers are as follows:

[0097] 42F: 5'-CAGTCAGGAAATGCGTACGTCCTT-3' (SEQ ID NO. 6);

[0098] 1066R: 5'-CAAGGTAATGCTCCAGGCATTGCT-3' (SEQ ID NO. 7).

[0099] The PCR reaction system (50 μL) for gyrA amplification was: 10×PCR Buffer (Mg 2+ 5 μL of dNTP mixture (2.5 mM); 1 μL of Taq (5 U / μL); 1 μL of 42F (10 μmol / L); 1 μL of 1066R (10 μmol / L); 50 ng of HNBR05-1 genomic DNA; and ddH2O to bring the total volume to 50 μL.

[0100] The PCR reaction conditions were: 94℃ for 2 min; 94℃ for 1 min, 51℃ for 45 s, 68℃ for 50 s, for 40 cycles; and 68℃ for 10 min.

[0101] The amplified products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, and the gyrA gene sequence of strain HNBR05-1 was obtained (as shown in SEQ ID NO.2). Homology comparison of the obtained gyrA gene sequence of strain HNBR05-1 was performed in GenBank, and the results showed that the gyrA gene sequence of HNBR05-1 had the highest homology with that of *Bacillus laterosporus*, reaching 96.16%. Simultaneously, a phylogenetic tree of the gyrA gene was constructed using MEGA software (Molecular Evolutionary Genetics Analysis). Figure 4 The results showed that strain HNBR05-1 aggregated with Bacillus laterosporus, indicating that strain HNBR05-1 is Bacillus laterosporus.

[0102] (5) Identification and classification based on gyrB gene sequence

[0103] Using genomic DNA from strain HNBR05-1 as a template, PCR amplification was performed using the degenerate primers UP1 and UP2r for the Bacillus gyrB gene. The PCR amplification products were obtained. The sequences of the UP1 and UP2r amplification primers are as follows:

[0104] UP1:5'GAAGTCATCATCATGACCGTTCTGCAYGCNGGNAARTTYGA-3'(SEQ ID NO.8);

[0105] UP2r: 5'AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT-3' (SEQ ID NO. 9).

[0106] Sequencing primers:

[0107] UP1S:GAAGTCATCATGACCGTTCTGCA(SEQ ID NO.10);

[0108] UP2rS: AGCAGGGTACGGATGTGCGAGCC (SEQ ID NO. 11).

[0109] The PCR reaction system for gyrB amplification is the same as that for gyrA amplification.

[0110] The PCR reaction conditions were 94℃ for 4 min; 94℃ for 1 min, 57℃ for 1 min, 72℃ for 1 min 10 s, for 35 cycles; and 72℃ for 10 min.

[0111] The amplified products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, and the gyrB gene sequence of strain HNBR05-1 was obtained (as shown in SEQ ID NO.3). Homology comparison of the obtained gyrB gene sequence of strain HNBR05-1 was performed in GenBank, and the results showed that the gyrB gene sequence of HNBR05-1 had the highest homology with that of *Bacillus laterosporus*, reaching 97.88%. Simultaneously, a phylogenetic tree of the gyrB gene was constructed using MEGA software (Molecular Evolutionary Genetics Analysis). Figure 5 The results showed that strain HNBR05-1 aggregated with Bacillus laterosporus, indicating that strain HNBR05-1 is Bacillus laterosporus.

[0112] Based on the above morphological characteristics, physiological and biochemical identification, and homology analysis of 16S rDNA, gyrA, and gyrB gene sequences, it can be concluded that HNBR05-1 belongs to Bacillus laterosporus and is different from existing Bacillus laterosporus strains, making it a new Bacillus laterosporus strain.

[0113] Bacillus laterosporus HNBR05-1 was deposited on October 10, 2022, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and classified as Bacillus laterosporus. Brevibacillus laterosporus The accession number is CGMCC No. 25886.

[0114] Example 2: Preparation of bacterial suspension and inoculum of Bacillus laterosporus HNBR05-1

[0115] The preparation methods for bacterial suspensions and inoculum of Bacillus laterosporus HNBR05-1 include the following steps:

[0116] (1) Activation of strain: Bacillus retroflexus HNBR05-1 was picked into the strain preservation medium, streaked continuously at 28℃ and cultured twice by picking single colonies, and then single colonies were picked into the strain activation medium and cultured at 35℃ and 180 r / min for 40h to obtain HNBR05-1 activated bacterial solution;

[0117] (2) Liquid seed preparation: HNBR05-1 activated bacterial solution obtained in step (1) was inoculated into a fermenter containing high-temperature sterilized seed culture medium at an inoculation rate of 10% (V / V), and cultured at 37℃, 180 rpm with shaking and air circulation for 30 h to obtain liquid seed;

[0118] (3) Liquid fermentation: Liquid seeds were inoculated into a seed culture medium that had been sterilized at high temperature at an inoculation rate of 10% by volume, and cultured at 37°C and 180 r / min for 36 h (logarithmic growth phase) to obtain live bacterial culture.

[0119] (4) Preparation of bacterial agent: Centrifuge the live bacterial culture at 4℃ and 5000 r / min for 15 min, take the bacterial precipitate and wash it 3 times with 0.85% sterile physiological saline, add an appropriate amount of seed culture medium to adjust the bacterial content to 10. 10 Add 50% glycerol (v / v) to the cfu / mL solution to obtain HNBR05-1 liquid bacterial agent, which is then bottled and stored.

[0120] Example 3: Antibacterial effect of Bacillus laterosporus HNBR05-1

[0121] This embodiment examines the inhibitory effect of Bacillus laterosporus HNBR05-1 on Xanthomonas aurantium var. peachensis and Cercospora drupecarpa, using the following specific methods:

[0122] (1) The inhibitory activity of Bacillus laterosporus HNBR05-1 against Xanthomonas aureus var. peach-plum was determined using the inhibition zone method. The Xanthomonas aureus var. peach-plum bacterial suspension was diluted to 10... 7 After mixing the cfu / mL solution with the LB medium to be solidified, pour the mixture into plates. Once the plates have solidified and dried, place a filter paper disc in the center of each LB plate and inoculate with a 10% concentration of *Bacillus laterosporus* HNBR05-1 bacterial suspension. 6 The bacteria (cfu / mL, 5 μL) were incubated at 28℃ for 24 h, and the antibacterial activity was observed. This was repeated 4 times. The antibacterial activity of strain HNBR05-1 was determined by the presence or absence of an inhibition zone at the treatment site of the pathogenic bacteria, and the degree of antibacterial activity was determined by the size of the inhibition zone.

[0123] (2) The antibacterial activity of Bacillus laterosporus HNBR05-1 against Cercospora drupe in peach was determined by the plate confrontation method. Cercospora drupe in peach was inoculated onto PDA plates and cultured at 26℃. After the plates reached two-thirds full size, mycelial cakes were prepared using a 5 mm diameter punch and inoculated into the center of the PDA plate. Simultaneously, HNBR05-1 bacterial suspension (concentration 10) was spot-inoculated at four corner points approximately 30 mm from the center. 6 (cfu / mL, 20 μL) The above treatments were used as the experimental group, while plates inoculated only with *Cercospora sclerotiorum* were used as the control group. Each treatment was repeated 4 times. The PDA plates after inoculation were placed at 26℃ and incubated for 7 days. The diameter of the pathogen colonies in each treatment was measured, and the inhibition rate was calculated according to the following formula: Inhibition rate (%) = [(AB) / (A-5)] ×100%, where A is the diameter of the pathogen colonies in the control group and B is the diameter of the pathogen colonies in the experimental group.

[0124] (3) Results of antibacterial experiment: The results are shown in Table 2 and Figure 6 As shown, the inhibition zone diameter of strain HNBR05-1 against Xanthomonas aureus var. peachae was 56 mm, and the inhibition rate of strain HNBR05-1 against Cercospora drupe was 93.90%, indicating that Bacillus lateralis has a good inhibitory effect on both Xanthomonas aureus var. peachae and Cercospora drupe in peaches.

[0125] Table 2. Antibacterial effects of strain HNBR05-1 against Xanthomonas aurea var. pyrifolia and Cercospora drupeosa.

[0126]

[0127] Note: The experimental results in Table 2 are the average of four replicates.

[0128] Example 4: Field trial of Bacillus laterosporus HNBR05-1 for the control of bacterial leaf spot and brown spot disease in peach.

[0129] This embodiment provides a field trial of Bacillus laterosporus HNBR05-1 for controlling bacterial leaf spot caused by Xanthomonas aureus var. peach and plum and brown spot leaf spot caused by Cercospora drupe. The specific method is as follows:

[0130] The treatment was conducted in 2021 and 2022 at a nursery in Mancheng District, Baoding City, Hebei Province. The number of applications was determined based on the disease occurrence patterns and severity, as well as climatic conditions. The peach varieties used were Okubo (susceptible to bacterial spot), Ruipan (susceptible to brown spot), and Zhongyoupan No. 7 (affected by a mixture of bacterial spot and brown spot), with tree ages of 5-6 years, 4-5 years, and 5-6 years respectively. The tree spacing was 4.0m / 5.0m, 3.0m / 5.0m, and 3.0m / 5.0m respectively. The trees were of moderate vigor and had a history of experiencing the corresponding diseases in previous years. Application was performed after the peach trees had finished blooming, with an interval of 10-15 days. A conventional chemical agent and a water control were also included. A total of three applications were made, with four replicates per treatment, randomly arranged. Each plot contained 20 peach trees. Chemical treatment: A: Microbial inoculum group (HNBR05-1): The liquid inoculum of Bacillus laterosporus prepared in Example 2, HNBR05-1, was diluted with water 2000 times to a cell concentration of 5 × 10⁻⁶. 6 CFU / mL; B: Fungicide control group: 4% Kasugamycin wettable powder (Shanxi Xinyuan Huakang Chemical Co., Ltd.) 1000x dilution, 10% Difenoconazole water-dispersible granules (Syngenta Nantong Crop Protection Co., Ltd.) 1500x dilution, 40% Tebuconazole·Thiamethoxam zinc suspension (Zhejiang Xinong Chemical Co., Ltd.) 1000x dilution; C: Blank control group: Water. Taishan-18 motorized high-pressure sprayer was used for uniform spraying, ensuring the fruit was moistened with slight dripping of pesticide. The average application rate per plant for each variety was 3.0L, 2.0L, and 2.0L. Disease incidence was investigated during fruit harvest. Ten sampling points were collected in each plot, with samples taken from the east, south, west, north, and center directions. 100 leaves were selected to investigate disease occurrence, recording the total number of leaves and the number of leaves affected at each level. Analysis was performed according to the grading standards and disease severity calculation formula. Grading standards for diseased leaves: Grade 0: No disease, healthy leaves; Grade 1: Diseased area less than 10% of the total leaf area; Grade 3: Diseased area 10%–25% of the total leaf area; Grade 5: Diseased area 25%–40% of the total leaf area; Grade 7: Diseased area 40%–65% of the total leaf area, some diseased leaves have fallen off. Based on the survey results, the disease index and control efficacy were calculated: Disease index = [(Number of diseased leaves at each level × Relative grade) / (Total number of leaves surveyed × Highest grade)] × 100; Control efficacy (%) = [(Control disease index – Treatment disease index) / Control disease index] × 100.

[0131] (1) Results of control of peach bacterial spot disease: The results are shown in Table 3. The control efficacy of Bacillus laterosporus HNBR05-1 against peach bacterial spot disease was 92.85%, which was higher than that of the fungicide kasugamycin. This indicates that Bacillus laterosporus HNBR05-1 and its microbial agents have a good control effect on peach bacterial spot disease.

[0132] (2) Results of control of peach brown spot perforation: The results are shown in Table 3. The control efficacy of Bacillus laterosporus HNBR05-1 against peach brown spot perforation was 90.12%, which was higher than that of the fungicide difenoconazole. This indicates that Bacillus laterosporus HNBR05-1 and its microbial agents have a good control effect on peach brown spot perforation.

[0133] (3) Results of control of mixed occurrence of peach bacterial spot and brown spot: The results are shown in Table 3. The control efficacy of Bacillus laterosporus HNBR05-1 against peach bacterial spot and brown spot was 90.64% and 90.55%, respectively. Its control effect was higher than that of the fungicide tebuconazole·thiazolium zinc, indicating that Bacillus laterosporus HNBR05-1 and its microbial agents have a good control effect on the mixed occurrence of peach bacterial spot and brown spot.

[0134] Table 3. Results of field trials of strain HNBR05-1 for controlling bacterial leaf spot and brown spot disease in peach.

[0135]

[0136] Note: The experimental results in Table 3 are the average of 4 replicates (2 years); data with different letters on the top label show significant differences.

[0137] Example 5: Detection of UV radiation stability of Bacillus laterosporus HNBR05-1

[0138] In this embodiment, the UV radiation stability of Bacillus retrospora brevis was determined. 10 mL of the fermentation broth of strain HNBR05-1 was placed in 7 test tubes and irradiated vertically at 20 cm under an 18 W UV lamp for 12 h. Samples were taken every 2 h to prepare plates for testing antibacterial activity (the methods for testing and investigating antibacterial activity were the same as in Example 3). The control group was not treated with UV irradiation. Each treatment was repeated 4 times.

[0139] The results are shown in Table 4. After being irradiated with ultraviolet light for different durations, the fermentation broth of strain HNBR05-1 still showed high antibacterial activity against Xanthomonas aurea var. truncatum and Cercospora drupe. With the increase of time, its antibacterial effect decreased slightly, but it still maintained a high antibacterial effect after 12 h of ultraviolet radiation. The difference in the antibacterial rate was within 5%, and there was no significant difference (P>0.05), indicating that the antibacterial active substances of strain HNBR05-1 are highly stable under ultraviolet light irradiation.

[0140] Table 4. Results of UV radiation stability test for strain HNBR05-1

[0141]

[0142] Example 6: Detection of antibiotic resistance in Bacillus laterosporus brevis 1 (HNBR05-1)

[0143] This embodiment tested the antibiotic resistance of *Bacillus laterosporus* HNBR05-1 using streptomycin, oxytetracycline, and kasugamycin at an antibiotic concentration of 1000 μg / mL. Circular paper discs (5 mm in diameter) were immersed in the corresponding antibiotic solutions for 2 hours, then removed and air-dried. The cultured *Bacillus laterosporus* HNBR05-1 was mixed with solid culture medium, maintaining a viable count of 10⁻⁶. 9 CFU / mL, take 10mL of the liquid and pour it into a plate. After it is evenly dispersed and solidified, place a sterile filter paper disc on the plate and incubate for 48h before measuring the size of the inhibition zone.

[0144] The results of antibiotic resistance testing for strain HNBR05-1 are as follows: Figure 7 As shown, the smaller the diameter of the inhibition zone, the better the antibiotic resistance of the bacterium. According to the paper disc method for antibiotic susceptibility testing, an inhibition zone diameter of 0 mm indicates no resistance, 0–10 mm indicates low resistance, 10–15 mm indicates moderate resistance, and greater than 15 mm indicates high resistance. The antibiotic resistance results showed that strain HNBR05-1 exhibited low resistance to oxytetracycline (8 mm) and no resistance to streptomycin and kasugamycin. These results indicate that strain HNBR05-1 has strong antibiotic resistance.

[0145] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A type of Laterospora brevispera ( Brevibacillus laterosporus strain HNBR05-1, characterized in that, The HNBR05-1 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25886.

2. A microbial preparation, characterized in that, The microbial preparation comprises the HNBR05-1 strain as described in claim 1.

3. A biocontrol agent, characterized in that, The biocontrol agent comprises the HNBR05-1 strain as described in claim 1, or is prepared from the HNBR05-1 strain as described in claim 1.

4. The method for preparing the microbial preparation according to claim 2 or the biocontrol preparation according to claim 3, characterized in that, The method includes the step of culturing the HNBR05-1 strain at 33-37℃, pH 6.3-7.5 and under aeration conditions to obtain a live bacterial culture; The culture medium used for the culture consisted of the following components: sucrose 15 g / L, K2HPO4 4.8 g / L, KH2PO4 3.5 g / L, (NH4)2SO4 2 g / L, MgCl2 0.16 g / L, CaCl2 0.02 g / L, Na2MoO4•2H2O 0.0024 g / L, FeCl3 0.0018 g / L, MnCl2•2H2O 0.0015 g / L, and sodium chloride 2 g / L.

5. The application of the HNBR05-1 strain of claim 1, the microbial preparation of claim 2, or the biocontrol preparation of claim 3 in inhibiting plant pathogens; in, The pathogen is Xanthomonas arboreum var. peach-plum (… Xanthomonas arboricola pv. pruni (Smith) Vauserin, Hoste, Kersters & Swings) and / or Cercospora sclerotiorum ... Cercospora circumscissa ); The plant in question is a peach.

6. The application of the HNBR05-1 strain of claim 1, the microbial preparation of claim 2, or the biocontrol preparation of claim 3 in the control of plant diseases; in, The diseases mentioned are bacterial leaf spot and / or brown spot leaf spot; The plant in question is a peach.

7. A method for preventing and controlling plant diseases, characterized in that, The method includes: applying the HNBR05-1 strain of claim 1, the microbial preparation of claim 2, or the biocontrol agent of claim 3 to the plant; The diseases mentioned are bacterial leaf spot and / or brown spot leaf spot; The plant in question is a peach.

Images