Organic solvent-resistant lipase and application of the same in synthesis of aromatic amide compounds

The organic solvent-resistant lipase Ndbn obtained through screening solves the problem of low activity of existing lipases in the amidation reaction of aromatic amines and esters. It realizes efficient catalysis of amidation reaction in organic solvents, expands the substrate range and improves enzyme stability, and has important industrial application potential.

CN117511911BActive Publication Date: 2025-11-21NANJING TECH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311312713.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-11
Publication Date
2025-11-21
Estimated Expiration
2043-10-11

AI Technical Summary

Technical Problem

Existing lipases suffer from low activity and limited substrate spectrum in catalyzing the amidation reaction of aromatic amines with esters, especially with low efficiency in the reaction of aniline with methyl 3-phenylpropionate. Furthermore, traditional chemical methods pose environmental pollution and safety risks.

Method used

A novel organic solvent-resistant lipase, Ndbn, was obtained through soil screening. It exhibits high catalytic activity and can stably catalyze the amidation reaction of aromatic amines with esters in organic solvents. The specific steps include constructing a recombinant E. coli expression vector and expressing the enzyme, and optimizing reaction conditions such as temperature and solvent type.

Benefits of technology

This method enables efficient catalysis of amidation reactions of aromatic amines and esters under mild conditions, expanding the substrate range of amidation reactions, improving enzyme stability and catalytic efficiency, and has significant industrial application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117511911B_ABST
    Figure CN117511911B_ABST
Patent Text Reader

Abstract

The present application relates to the field of recombinant enzyme catalytic engineering technology, and provides a kind of intracellular expression lipase Ndbn and its related recombinant engineering bacteria.The lipase described in the present application has the characteristics of organic solvent resistance, can use aniline and ester as substrate in organic solvent, and enzyme synthesis amide compounds.Compared with existing lipases, lipase Ndbn shows high catalytic activity to weak nucleophile aniline, has a wide substrate spectrum, the aromatic amide catalyzed by it can be used as an intermediate of drug, avoids the shortcomings of high temperature and use of toxic reagent in the process of chemical synthesis of amide, has high atom economy, and meets the concept of green manufacturing.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of recombinant enzyme catalysis engineering, and particularly relates to an intracellularly expressed organic solvent-tolerant lipase and application thereof in synthesis of aromatic amide compounds. BACKGROUND

[0002] The synthesis of amide bond is one of the most important reactions in organic chemistry. Amide compounds have the characteristics of high stability and great polarity, and are widely used in various fields, especially playing an important role in the pharmaceutical industry. According to statistics, about 25% of drugs have amide bonds. Among them, aromatic amides account for a large part, including afatinib (an anticancer drug), teriflunomide (used for treating multiple sclerosis), lidocaine (an anesthetic), and the most common antipyretic analgesic paracetamol in daily life. Traditional chemical methods usually use toxic and expensive coupling reagents and high-temperature reactions to prepare amides from carboxylic acids and amines, which has the problems of great environmental pollution, low safety and poor atom economy. In 2007, the American Chemical Society Green Chemistry Institute held a pharmaceutical roundtable meeting, which clearly proposed the challenge and importance of green and efficient synthesis of amide bonds.

[0003] Enzymes have high chemical, regio- and enantio-selectivity; compared with traditional catalysts, enzymes have many advantages: harmless to the environment, work under mild conditions, and have versatility to substrates, so they have great potential for use in synthetic reactions. Currently, the enzymes commonly used to catalyze the synthesis of amides include N-acyltransferases, carboxylate reductases, lipases, proteases and penicillin acylases. Among them, lipases are better biological catalysts for synthesizing amides because they do not need high-activity esters as acyl donors and do not need expensive auxiliary factors such as ATP. However, it has been reported that only a few lipases can catalyze the amidation of aniline with esters to generate aromatic amides. For example, Candida cylindracea lipase (CCL) catalyzes the reaction of ethyl propiolate with aniline to generate propiolamide, but the reaction time is as long as 72-96 hours; Pseudomonas sp. lipase (PSL) has low activity in catalyzing the synthesis of amide from aniline and 3-phenylpropionic acid methyl ester, and cannot catalyze the reaction of aniline with 3-phenylformic acid methyl ester. In addition, although SPL has high activity in generating N,3-diphenylpropionamide, its activity in catalyzing the synthesis of other aromatic amides has not been studied. Therefore, although considerable progress has been made in the amidation reaction using lipases, it is still necessary to further explore the substrate spectrum of weak nucleophilic reagent aniline as a substrate for synthesizing amides, so as to synthesize aromatic amides with diverse structures, especially large-volume aromatic amides related to pharmaceuticals. SUMMARY

[0004] The application obtains a new organic solvent-tolerant lipase (named Ndbn) from Rhizorhabdus dicambivorans UGC1 through soil screening, and the lipase has high catalytic activity for amidation reaction of aniline and ester.

[0005] The specific technical scheme of the application is as follows:

[0006] A lipase, the enzyme molecule of which comprises an amino acid sequence shown in SEQ ID NO: 1.

[0007] Another object of the application is to provide a DNA molecule encoding the lipase of claim 1. Preferably, the nucleotide sequence is shown in SEQ ID NO: 2.

[0008] Another object of the application is to provide an expression vector of the lipase, which expresses the lipase of the application. The expression vector can be a plasmid, a bacteriophage, a virus or a host cell.

[0009] The host cell is a prokaryotic cell or a eukaryotic cell, which can be Escherichia coli, yeast, Bacillus, Lactobacillus, Aspergillus or Trichoderma, preferably Escherichia coli.

[0010] Another object of the application is to provide the application of the lipase, the DNA molecule or the expression vector in catalyzing the amidation reaction of aromatic amine and ester.

[0011] Preferably, the aromatic amine is a substituted or unsubstituted aniline, which is selected from aniline substituted with one or more of H, C1-C10 alkyl, C1-C10 alkoxy, C1-C10 haloalkyl, C1-C10 haloalkoxy, halogen (preferably para-substituted).

[0012] In a specific example of the application, the amidation reaction is as follows:

[0013]

[0014] In the formula, R1 represents H, methyl, ethyl, n-propyl, isopropyl, t-butyl, methoxy, ethoxy, trifluoromethoxy, F, Cl, Br or I.

[0015] The solvent of the above amidation reaction is an organic solvent, preferably a hydrophobic organic solvent, such as one or more of n-octanol, nonane, n-octane, n-heptane or n-hexane.

[0016] Preferably, the above reaction temperature is 30℃.

[0017] Advantages of the application:

[0018] The present application is directed to the problem that there is currently a lack of lipase capable of catalyzing the synthesis of amide from aromatic amine and ester. Taking the amidation reaction of aniline and 3-phenylpropionic acid methyl ester as a model reaction, a new lipase Ndbn capable of high catalytic activity for the reaction is obtained through soil screening. The substrate spectrum of the lipase is studied, and the results show that Ndbn exhibits good catalytic activity for substituted or non-substituted aniline, and some amide products can be used as drug intermediates. In addition, according to the stability of the lipase in different organic solvents, the results show that organic solvents such as n-hexane and n-heptane have a certain promoting effect on the activity of the lipase Ndbn, and the half-life of the lipase in n-octanol is up to 10 days, indicating that the lipase is an organic solvent-tolerant lipase. In summary, the organic solvent-tolerant lipase Ndbn described in the present application has a wide substrate range and high catalytic activity for the amidation of aromatic amine and ester, and has important industrial application value. BRIEF DESCRIPTION OF DRAWINGS

[0019] The accompanying drawings, which form a part of this application, are included to provide a further understanding of the application and are incorporated in and constitute a part of this application. The embodiments of the present application illustrated in the drawings are presented to explain the present application and not to limit the present application.

[0020] Figure 1 SDS-PAGE electrophoresis analysis of lipase Ndbn. Lane 1 is a blank control, lane 2 is the intracellularly expressed soluble crude enzyme liquid, and lane 3 is the purified pure enzyme.

[0021] Figure 2 Optimum temperature analysis of lipase Ndbn.

[0022] Figure 3 Temperature stability analysis of lipase Ndbn. DETAILED DESCRIPTION

[0023] In order for those skilled in the art to better understand the present application, the present application will be further described below in conjunction with the drawings and examples. It should be noted that the present embodiment is only used to explain the present application, and is not a limitation on the scope of the present application. Obviously, the described embodiment is only a part of the embodiment of the present application, and not all the embodiments. Based on the embodiment of the present application, all other embodiments obtained by those skilled in the art without creative labor should belong to the scope of protection of the present application.

[0024] Example 1 Construction of an engineered bacterium for expressing lipase

[0025] The β-galactosidase source strain of the present application is Rhizorhabdus dicambivorans UGC1, and the amino acid sequence is shown as SEQ ID NO: 1. In order to improve the protein expression amount, a recombinant E. coli expression vector is constructed.

[0026] Using the genomic DNA of strain Rhizorhabdus dicambivorans UGC1 as a template, high-fidelity enzyme 2×Phanta Max Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and primer pair BF(5'CG) GAATTC ATGAATCAAGAATTTGTTCGTC 3', EcoR I, SEQ ID NO:3) and BR (5'GC GTCGAC PCR amplification was performed using GGACGATATTCTTCGATCATAAC 3'Sal I (SEQ ID NO:4), following the experimental procedures outlined in the Vazyme biological products and user manual. The amplified coding gene DNA fragment should be 951 bp. Nucleic acid electrophoresis verified the correct band length, and its base sequence is shown in SEQ ID NO:2. The amplified DNA fragment was then digested with Dpn I to digest the template DNA.

[0027] After digestion, the PCR products are purified to remove primers, enzyme proteins, mononucleotides, etc. This step is completed using the AxyPrep PCR Clean up kit.

[0028] The purified DNA fragment was double-digested with the vector pET28a(+) using EcoRI and SalI (Baori Biotechnology Co., Ltd.). A 50 μl digestion system was used, prepared and administered according to the manufacturer's instructions. After digestion, the DNA fragment was recovered using a gel. Ligation of the vector DNA and fragment DNA was performed at a molar ratio of 1:3, using a 10 μl ligation system catalyzed by T4 ligase. Ligation was carried out overnight at 16°C to obtain the plasmid pET28a-Ndbn. After ligation, the ligation solution was transformed into competent *E. coli* BL21(DE3) cells using a heat shock method and plated on LB agar plates containing 100 μg / ml kanamycin sulfate, incubated at 37°C for 14-16 h. Sequencing results were verified by sequencing (performed by Anhui General Biotechnology Co., Ltd.), yielding the corresponding recombinant strain *E. coli* BL21(DE3)-Ndbn.

[0029] Example 2: Expression of lipase Ndbn in Escherichia coli

[0030] The recombinant strain obtained in Example 1 was inoculated into 50 mL of LB liquid medium containing 100 μg / mL kanamycin sulfate and cultured overnight at 37°C and 180 rpm. Seed culture was then inoculated into 50 mL of fresh TB liquid medium at a 2% inoculation rate and cultured at 37°C and 180 rpm until OD...600 When the value of X is 0.6-1.0, the ice water bath is cooled for 5 min, an inducer IPTG (isopropyl-beta-D thiogalactoside) is added (the final concentration is 0.3 mmol / L), and the expression is induced at 22°C and 180 rpm for 20 h.

[0031] The fermentation liquid after the expression induction is centrifuged at 12000 rpm for 20 min, the supernatant is discarded, the bacterial body is resuspended and washed with 50 mM Tris-HCl (pH 8.0) buffer, centrifuged at 12000 rpm for 20 min, the supernatant is discarded, resuspended with the buffer again, and then ultrasonically broken. The broken liquid is centrifuged at 12000 rpm for 20 min, the supernatant is taken for SDS-PAGE electrophoresis detection, the concentration of the concentrated gel is 4%, the concentration of the separation gel is 12.5%, the sample is mixed with the loading buffer at a ratio of 3:1, boiled in water bath for 5 min for loading electrophoresis. The electrophoresis instrument is set to an initial voltage of 120 V, and the voltage is increased to 230 V when the sample moves to the separation gel, and the electrophoresis is ended when the sample moves to the bottom of the electrophoresis tank.

[0032] The SDS-PAGE electrophoresis result of the above crude enzyme liquid is shown in Figure 1 The molecular weight of Ndbn is 37 kDa, which is consistent with the calculated molecular weight, indicating that Ndbn is successfully induced and expressed, and accounts for about 70% of the total soluble protein.

[0033] Example 3: Determination method of lipase Ndbn enzyme activity

[0034] The recombinant strain constructed in Example 1 is fermented and cultured according to the method of Example 2, and the crude enzyme liquid of the obtained protein is determined for enzyme activity change with pNPG as the substrate, and the determination method is as follows:

[0035] The definition of enzyme activity unit is that one enzyme activity unit is the amount of enzyme required to catalyze the hydrolysis of pNPG to generate 1 μmol pNP per minute under the conditions of 45°C and pH 8.0. The specific steps are as follows:

[0036] (1) The configuration of A solution: 50 mM Tris-HCl buffer with pH 8.0, wherein 0.6% Triton X-100 and 0.1% gum arabic are added;

[0037] (2) The configuration of B solution: accurately take 3 mg of pNPP and dissolve it in 1 mL of isopropyl alcohol;

[0038] (3) Mix A solution and B solution according to the volume ratio of 9:1 to prepare a pNP substrate solution with a concentration of 16.5 mM;

[0039] (4) Lipase enzyme activity assay: 10 μL of enzyme solution diluted to an appropriate degree was added to the reaction system, and inactivated enzyme solution was used as a blank control. Then, 240 μL of substrate solution was added, and the reaction was carried out in an enzyme marker instrument, with a reaction temperature of 30°C and a reaction time of 10 min. The amount of p-nitrophenol (pNP) generated at the end of the reaction was detected at 410 nm.

[0040] Example 4 Purification of lipase Ndbn

[0041] Since the N-terminal of lipase Ndbn is fused with a six-histidine (His) tag, nickel chloride in the Ni column can bind to the protein containing the His tag and also bind to imidazole. Therefore, the nickel column was used to purify the target protein. After centrifugation and crushing of the bacterial solution obtained by fermentation expression in Example 2, the supernatant was filtered through a 0.22 μm filter membrane. The nickel column was equilibrated by flushing with Buffer A (20 mM Tris-HCl, pH 7.5) at a flow rate of 2 mL / min. The protein sample was injected into the sample loop using a syringe, and the breakthrough peak protein was collected. The nickel column was then flushed again with Buffer A (20 mM Tris-HCl, pH 7.5) until no protein was eluted. Gradient elution was used, and at least 5 volumes of Buffer B (20 mM Tris-HCl, 500 mM imidazole, pH 7.5) was used to flush the nickel column for each gradient. The absorption peak protein of each gradient was collected until no protein was eluted. The protein solution obtained by nickel column purification was passed through a desalting column preloaded by GE to replace the imidazole-containing Buffer with 50 mM Tris-HCl (pH 8.0) buffer to remove imidazole from the protein solution. The protein solutions collected in different gradients were verified by SDS-PAGE, and the purity of the target protein obtained at 20% Buffer B elution was higher, as shown in Figure 2. Figure 1 .

[0042] Example 5 Analysis of the enzymatic properties of lipase Ndbn

[0043] To determine the optimal reaction temperature of the lipase catalytic reaction, the optimum temperature and temperature stability of lipase Ndbn were determined. Optimum temperature: after appropriate dilution of the purified enzyme obtained in Example 4, the substrate solution prepared in Example 3 was added, and the reaction was carried out in a 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, and 50°C water bath for 10 min. The absorbance at 410 nm was measured, and the enzyme activity at each temperature was calculated according to the standard curve, as shown in Figure 3. Figure 2The optimum temperature of Ndbn is 45°C. Temperature stability: the purified enzyme obtained in Example 4 was diluted appropriately and incubated in a water bath at 20°C, 25°C, 30°C, 35°C, 40°C, 45°C and 50°C respectively for 2h. After incubation, the residual enzyme activity was measured according to the method described in Example 3. The highest enzyme activity at 0h was taken as 100%, and the relative enzyme activity after incubation at different temperatures was calculated. The change curve of residual enzyme activity under different incubation conditions was drawn. The results are shown in Figure 2. Figure 3 As shown in Figure 2, after incubation at 20-45°C for 2h, the original enzyme activity of Ndbn was less lost, and 80% of the enzyme activity was retained. After incubation at 50°C, the residual enzyme activity was less than 35%.

[0044] Example 6 Analysis of the organic solvent resistance of lipase Ndbn

[0045] In order to investigate the effect of organic solvents on the activity of lipase, 50% (volume fraction, the same below) (2mL organic solvent / 2mL enzyme solution) organic solvents (isopropyl alcohol, acetonitrile, ethanol, methanol, dimethyl sulfoxide, nonane, n-octanol, n-octane, n-heptane, n-hexane) were added to lipase Ndbn respectively, and the samples were oscillated at 45°C and 150r / min. The residual lipase activity in each sample was detected after 28h. The determination of hydrophobic organic solvent resistance was taken with enzyme solution without organic solvent as control, while the determination of hydrophilic organic solvent resistance was taken with enzyme solution added with the same volume of Tris-HCl buffer (pH 8.0) instead of organic solvent as control. In order to detect the effect of organic solvents on the stability of lipase, the residual lipase activity of each sample was detected at regular time intervals within 10d, and the half-life was investigated.

[0046] As shown in Table 1, the hydrophobic organic solvents had an activating effect on the activity of lipase Ndbn. After treatment in 50% n-octanol, nonane and n-octane for 28h, the enzyme activity of lipase Ndbn was 200.77%, 276.61% and 226.29% of the initial enzyme activity without organic solvent, respectively. The half-life of lipase Ndbn in the control sample without organic solvent was only 40h, but the half-life of the lipase in n-octanol system was more than 10d, and the stability was increased by 6 times. The half-life of lipase Ndbn in other organic solvents was also significantly higher than that of the control sample without organic solvent. In this study, the enzyme activity and stability of lipase Ndbn in various hydrophobic organic solvents were enhanced, indicating that it had good application prospect in organic solvent system biocatalysis.

[0047] Table 1 Effect of organic solvents on the activity and stability of lipase Ndbn

[0048]

[0049] Example 7 Lipase Ndbn catalyzed amidation of different aromatic amines with 3-phenylpropionic acid methyl ester

[0050] To investigate the catalytic activity of lipase Ndbn on different aromatic amine substrates, anilines with different substituents were selected to react with 3-phenylpropionic acid methyl ester. The reaction conditions were as follows: 10 mM of 3-phenylpropionic acid methyl ester and 20 mM of amine were added in 2 mL of n-hexane, 30 mg of lipase Ndbn freeze-dried enzyme powder was added to activate the reaction, and after 24 h of reaction at 30°C and 250 rpm, the inactivated enzyme was used as a blank control. The conversion rate was determined by HPLC method. HPLC detection method: Diacel Chiralpak IA-3 column (250 x 4.6 mm, 3 μm), mobile phase n-hexane: isopropyl alcohol = 90:10, flow rate 1.0 ml·min -1 ; UV detector (254 nm); column temperature: 25°C. As can be seen from Table 2, Ndbn has high catalytic activity on anilines with different substituents, and the activity of para-substitution is higher than that of meta-substitution, and the activity of ortho-substitution is the lowest. These aromatic amides can become the skeleton of many useful drug compounds, such as phenylpropenoyl aniline derivatives (anti-hepatic fibrosis drugs). The investigation of the substrate spectrum shows that lipase Ndbn has high activity and substrate range for the synthesis of amides from aromatic amines and esters, and is an excellent biocatalyst for the synthesis of aromatic amides.

[0051] Table 2 Conversion rate of lipase Ndbn catalyzed amidation of different aromatic amines with 3-phenylpropionic acid methyl ester

[0052]

[0053] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A lipase, characterized in that... The amino acid sequence of the lipase is shown in SEQ ID NO:

1.

2. The application of the lipase as described in claim 1 in catalyzing the amidation reaction of aniline with ester.

3. The application as described in claim 2, characterized in that... The solvent for the amidation reaction is the organic solvent n-hexane.

4. The application as described in claim 2, characterized in that... The amidation reaction temperature is 30℃.