Rhizopus glutenus bran koji fortified medium-temperature daqu and preparation method thereof and method for improving wine production by using the same
By introducing Rhizopus aquifera bran koji enhancer into medium-temperature koji, the fermentation performance of medium-temperature koji and the flavor of baijiu were improved, solving the technical problem of improving the fermentation performance of medium-temperature koji and achieving a significant increase in baijiu yield and flavor.
Patent Information
- Application Number
- CN202311430183.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-31
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2043-10-31
AI Technical Summary
Existing research has paid little attention to the impact of introducing Rhizopus into the production of medium-temperature Daqu on the fermentation process, resulting in limited improvement in the fermentation performance of medium-temperature Daqu and room for improvement in the flavor and yield of Baijiu.
Rhizopus azygosporus (CGMCC No. 20728) was used to strengthen medium-temperature Daqu (a type of starter culture). The effects of Rhizopus strengthening on the community structure and volatile metabolites of the mash were investigated through simulated fermentation in a fermentation pit. The inoculum amount of wheat bran was controlled at 0.049–0.051%, and fermentation was carried out at 28–32℃ for 28–30 days.
It significantly improves the fermentation, saccharification, and liquefaction power of medium-temperature daqu, changes the community structure of the mash, increases the content of ethyl acetate and ethyl hexanoate, increases the proportion of ester components, reduces the proportion of alcohols, enhances the flavor and aroma of baijiu, and shortens the fermentation cycle.
Smart Images

Figure CN117568122B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of liquor production, and particularly relates to a Rhizopus bran koji with enhanced medium-temperature Daqu, a preparation method and application thereof, and a method for improving liquor production by using the same. BACKGROUND
[0002] Chinese liquor is one of the six major distilled liquors in the world, with a long history. Luzhou-flavor liquor is one of the three major traditional Chinese liquors, and its production process is unique. The fermentation production process of Luzhou-flavor liquor mainly includes Daqu production and fermentation of fermented grains. The microbial system and enzyme system of Daqu are closely related to the yield and style of liquor.
[0003] Screening functional strains and applying them to strengthen Daqu can not only improve the enzyme activity of Daqu, but also improve the characteristic flavor of liquor. For example, studies have shown that Bacillus used to strengthen medium-temperature Daqu significantly improves its saccharifying power and liquefying power, and changes the microbial community composition related to saccharifying activity and liquefying activity from Lactobacillus and Rhizomucor to Bacillus, Weissella and Trichosporon. In addition, Hong L et al. found that using functional yeast to strengthen Daqu instead of traditional Daqu to simulate the fermentation of special-flavor liquor improves the alcohol content and volatile substance content of fermented grains, while not changing the relative abundance of dominant bacterial genera.
[0004] Rhizopus is one of the main functional bacteria in brewing starter, which has the main characteristics of broad hydrolase spectrum, such as secreting α-amylase, glucoamylase, glycosidase, glycosyltransferase, etc., and has the ability to produce alcohol. The high saccharifying power of Rhizopus makes it widely used in the fermentation industry. Literature (Huang Y, Zhou Q Y, Gao T, et al. Application of a Rhizopus strain in improving the flavor of rice vinegar [J]. Chinese Condiment, 2021, 46(11): 57-59.) reported that Rhizopus was screened from starter and applied to rice vinegar production, which successfully improved the flavor and quality of rice vinegar. In addition, literature (WU J, REN L, ZHAO N, et al. Solid-state fermentation by Rhizopus oryzae improves flavor of wheat bran for application in food [J]. Journal of cereal science, 2022, 107: 103536.) reported that after solid-state fermentation of wheat bran by inoculating rice Rhizopus, not only the relative content of unpleasant flavor substances was reduced, but also the relative content of various aromatic volatile components was improved, thereby improving the sensory quality and nutritional value. Literature (Huang K Y, Deng J, Wei C H, et al. Optimization of rice koji preparation process with rice Rhizopus isolated from medium-high temperature Daqu and its application [J]. Food and Machinery, 2022, 38(9): 185-190.) reported that rice Rhizopus isolated from medium-high temperature Daqu could be made into rice koji and added to liquor brewing, which significantly improved the liquor yield, indicating that the liquor yield was positively correlated with the saccharifying power of Daqu system. In literature (TANG Q, HUANG J, ZHANG S, et al. Keystone microbes affect the evolution and ecological coexistence of the community via species / strain specificity [J]. Journal of Applied Microbiology, 2022, 132(2): 1227-1238.), Rhizopus azygosporus derived from high-quality Xiaoqu was used to strengthen Xiaoqu fermentation, which improved the starch hydrolyzing power and esterifying activity of Xiaoqu, and improved the physicochemical properties and flavor characteristics of Xiaoqu. Literature (Ma P. Screening of high esterifying power, saccharifying power and liquefying power molds and research on strengthening Daqu [D]. Alar: Tarim University, 2022.) reported that rice koji was prepared by mixing Rhizopus, Aspergillus oryzae and Monascus, and mixed with traditional Daqu for solid-state fermentation of liquor, which improved the alcohol content of liquor and enriched the flavor substances of liquor.
[0005] In general, the current research mainly focuses on the application of Rhizopus in small koji and bran koji, and the mixing of bran koji and traditional Daqu for fermentation of fermented grains, focusing on the improvement of physicochemical properties and flavor of liquor. However, there are relatively few studies on the effects of introducing Rhizopus in the production of medium-temperature Daqu on medium-temperature Daqu and the subsequent fermentation process. SUMMARY
[0006] In order to further develop the fermentation performance of medium-temperature Daqu, the present application uses bran koji of Rhizopus azygosporus (CGMCC No. 20728) to strengthen medium-temperature Daqu, and uses it as a fermentation agent to simulate pit fermentation, and to explore the influence of Rhizopus strengthening on the community structure and volatile metabolic components of fermented grains in multiple scales, to regulate the brewing period of liquor and improve the flavor components, and to lay a theoretical foundation for the development of new solid-state liquor production technology.
[0007] The Rhizopus azygosporus (CGMCC No. 20728) used in the present application has a preservation number of CGMCC No. 20728. The preservation date is September 17, 2020. The preservation center is China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Beichen West Road, Haidian District, Beijing, China, with a postcode of 100101. The classification and naming is Rhizopus azygosporus, which can be translated as Rhizopus azygosporus according to Rhizopus azygosporus.
[0008] The present application first provides a Rhizopus bran koji to strengthen medium-temperature Daqu, which is inoculated with 0.049-0.051% bran koji of Rhizopus azygosporus in medium-temperature Daqu. The Rhizopus azygosporus is preserved in China General Microbiological Culture Collection Center, and its preservation number is CGMCC No. 20728.
[0009] In the above Rhizopus bran koji to strengthen medium-temperature Daqu, the DNA sequence of the Rhizopus azygosporus is as shown in SEQ ID NO: 1.
[0010] SEQ ID NO: 1 is as follows:
[0011] CTTCCGTAAGGGGAACCTGCGGAAGGATCATTAACTAATGTATTGGCACTTTACTGGGATTTACTTCTCAGTATTGTTTGCTTCTATACTGTGAACCTCTGGCGATGAAGGTCGTAACTGACCTTCGGGAGAGACTCAGGACATATAGGCTATAATGGGTAGGCCTGTTCTGGGGTTTGATCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAAGGTGCCTGGTACCCTTTACCATATACCATGAATTCAGAATTGAAAGTATAATATAATAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGTACGCTTGCTTCAGTATCATAACCAACCCACACATAAAATTTATTTTATGTGGTGATGGACAAGCTCGGTTAAATTTAATTATTATACCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCATTAAATTACGAACTACCTAGCCATCGTGCTTTTTTGGTCCAACCAAAAAACATATAATCTAGGGGTTCTGCTAGCCAGCAGATATTTTAATGATCTTTAACTATGATCTGAAGTCAAGTGGGACTACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGAAA.
[0012] The present application further provides a preparation method of the Rhizopus bran-enhanced mesophilic Daqu, which comprises the following steps: raw material, moistening, crushing, mixing, treading, Daqu base, cultivation, transfer, and maturation. In the mixing step, 0.049-0.051% of Rhizopus oligosporus bran is added to the raw material.
[0013] Preferably, in the preparation method of the Rhizopus bran-enhanced mesophilic Daqu, the Rhizopus bran-enhanced mesophilic Daqu is the mesophilic Daqu during transfer.
[0014] Preferably, in the preparation method of the Rhizopus bran-enhanced mesophilic Daqu, the Rhizopus bran-enhanced mesophilic Daqu is the mesophilic Daqu during transfer.
[0015] The preparation method of the root mold bran-yeast enriched medium-temperature Daqu includes the following steps: mixing bran and water, sterilizing, inoculating Rhizopus azygosporus, culturing, and drying.
[0016] The application further provides application of the root mold bran-yeast enriched medium-temperature Daqu or the root mold bran-yeast enriched medium-temperature Daqu prepared by the preparation method in solid-state liquor production.
[0017] The application further provides a method for improving liquor production by using the root mold bran-yeast enriched medium-temperature Daqu or the root mold bran-yeast enriched medium-temperature Daqu prepared by the preparation method, which comprises the following steps: adding the root mold bran-yeast enriched medium-temperature Daqu into steamed highland barley, stacking and saccharifying, and then fermenting at 28-32 DEG C for 28-30 days to obtain root mold bran-yeast enriched medium-temperature Daqu; distilling the root mold bran-yeast enriched medium-temperature Daqu to obtain liquor; and the addition amount of the root mold bran-yeast enriched medium-temperature Daqu is 14-16% of the dry weight of the highland barley before steaming.
[0018] In the method for improving liquor production by using the root mold bran-yeast enriched medium-temperature Daqu, the stacking and saccharifying time is 20-25 hours.
[0019] The application has the following beneficial effects:
[0020] The application selects Rhizopus azygosporus (CGMCC No. 20728) bran-yeast to strengthen medium-temperature Daqu, strictly controls the inoculation amount of bran-yeast to be 0.049-0.051%, and significantly improves the fermentation performance of the root mold bran-yeast enriched medium-temperature Daqu, such as fermentation power, saccharifying power and liquefying power. Meanwhile, the application discloses the influence law of root mold bran-yeast on volatile components and community structure of Daqu: root mold bran-yeast can significantly change the community structure of Daqu and root mold bran-yeast, increase the abundance of Rhizopus, Lactobacillus, Thermomyces and Enterobacter, increase the content of ethyl acetate and ethyl hexanoate, increase the proportion of ester components, reduce the proportion of alcohol, improve the flavor and aroma of liquor, and accumulate rich nutrients in the early stage of Daqu production and the stacking and saccharifying stage of root mold bran-yeast, so as to accelerate the planting rate of bacteria, increase the hydrolysis rate of substrates, increase the metabolic rate of starch raw materials, reduce the starch content of Daqu, increase the acidity, reducing sugar content and alcohol content of Daqu, and accelerate the fermentation period.
[0021] The present application develops a kind of Rhizopus azygosporus (CGMCC No.20728) bran koji fortified medium-temperature Daqu through systematic research, which is used for liquor fermentation, and lays a methodological and theoretical foundation for adjusting microbial community structure and regulating flavor substances in liquor production. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 Figure 1 is a diagram of the physicochemical property differences of Daqu RQ and NQ and the change trend of physicochemical properties of RZP and NZP of fermented grains; wherein, A is the physicochemical property differences of Daqu RQ and NQ; B is the starch content of RZP and NZP of fermented grains; C is the reducing sugar content of RZP and NZP of fermented grains; D is the acidity of RZP and NZP of fermented grains; E is the alcoholicity of RZP and NZP of fermented grains.
[0023] Figure 2 Figure 2 is a diagram of the volatile component content differences of RZP and NZP of fermented grains at different fermentation stages and a clustering heat map of common volatile components; wherein, A is the difference in volatile component content; B is a petal diagram of common volatile components; C is a clustering heat map of common volatile components.
[0024] Figure 3 Figure 3 is a diagram of PLS-DA and heat map of volatile components of RZP and NZP of fermented grains at different fermentation stages; wherein, A is partial least squares discriminant analysis PLS-DA based on volatile components; B is permutation test of PLS-DA; C is a heat map of differential metabolites.
[0025] Figure 4 Figure 4 is a trend analysis diagram of volatile components of RZP and NZP during fermentation; wherein, A is RZP; B is NZP.
[0026] Figure 5 Figure 5 is a diagram of the microbial community composition differences of Daqu RQ, NQ and RZP, NZP of fermented grains; wherein, A is Fungi; B is Fungus; C is Bacteria; D is Bacterium.
[0027] Figure 6 Figure 6 is a LEfSe analysis diagram of the microbial community of RZP and NZP of fermented grains; wherein, A is Fungus; B is Bacterium.
[0028] Figure 7 Figure 7 is a diagram of raw material utilization, metabolite generation and enzyme metabolic pathway analysis.
[0029] Figure 8 Figure 8 is a redundancy analysis of the dominant microorganisms and main volatile compounds in RZP and NZP of fermented grains; wherein, A is Fungus; B is Bacterium. DETAILED DESCRIPTION
[0030] Specifically, the Rhizopus bran starter-fermented medium-temperature Daqu is medium-temperature Daqu inoculated with 0.049-0.051% Rhizopus azygosporus bran starter, and the Rhizopus azygosporus is preserved in the China General Microbiological Culture Collection Center, with a preservation number of CGMCC No. 20728.
[0031] The present application researches and finds that the relative abundance of the Daqu fungus genus may be affected by the competition among microorganisms, and in high-temperature Daqu, the more heat-tolerant thermophilic fungus genus and monascus genus have stronger competitive advantages, and the Rhizopus grows slowly; and the medium-temperature Daqu has higher saccharifying power, which is complementary to the characteristics of Rhizopus, and therefore, the present application introduces Rhizopus into the medium-temperature Daqu, which is more likely to improve the fermentation activity.
[0032] In addition, different types of Rhizopus bran starters and different addition amounts will result in different enzyme activities of the medium-temperature Daqu prepared by the strengthening. In order to determine the most suitable Rhizopus bran starter and its addition amount, the present application screens different Rhizopus bran starters, such as Rhizopus azygosporus (CGMCC 20728) or Rhizopus oryzae (CGMCC 20726) in the prior art, and the influence of different addition amounts of Rhizopus bran starter on the physicochemical properties and enzyme activity of the medium-temperature Daqu, and it is accidentally found that the Rhizopus azygosporus (CGMCC 20728) bran starter, and the addition amount thereof is reduced to 0.049-0.051%, can significantly improve the fermentation performance of the medium-temperature Daqu, such as fermentation power, saccharifying power and liquefying power. Therefore, the present application inoculates 0.049-0.051% Rhizopus azygosporus bran starter in the medium-temperature Daqu, and the DNA sequence of the Rhizopus azygosporus is shown in SEQ ID NO: 1.
[0033] In the present application, the preparation method of the medium-temperature Daqu not using the Rhizopus bran Daqu fortification can refer to the process in the literature (ZHENG X, TABRIZI M R, NOUT M J R, et al. Daqu-A Traditional Chinese Liquor Fermentation Starter [J]. Journal of the Institute of Brewing, 2011, 117 (1): 82-90.), which comprises the raw material - moistening - crushing - mixing - treading - base - culture - transfer - mature process. After maturation, if not directly used, the storage process can be carried out. In the field, Daqu usually uses wheat, barley, peas and the like as raw materials, which requires full particles, no moldy, no insect, no impurities, no odor, no pesticide pollution; after moistening and crushing, the moisture content of wheat is adjusted to about 18%, and the crushing degree is required to be "plum blossom petals" with "rotten core but not rotten skin"; in the mixing process, 9 kg of water is mixed with 30 kg of wheat to adjust the moisture content of wheat to about 37%; in the treading process, the size of the base is generally 33 cm*20 cm*7 cm. If the base is too small, it is not easy to keep warm and moist, and if the base is too large, the microorganisms are not easy to grow through; the tightness of the base should be appropriate. If the base is too hard, the color of the finished Daqu is not correct, and the core has an odor; if the base is too loose, the operation is not convenient, and the Daqu is easy to scatter; the treading base is placed on the ground to naturally collect sweat; then the base is placed on a stainless steel rack, the indoor temperature, humidity and Daqu core temperature are adjusted by an air flow device to realize the production process without turning Daqu; after about 10-12 days of culture, the base is transferred, and after about one month, the Daqu is matured and then stored in the warehouse.
[0034] In the present application, when the Rhizopus bran Daqu fortified medium-temperature Daqu is prepared, the Rhizopus bran Daqu is added to the raw material in the mixing process, and then the subsequent processes are carried out to obtain the fortified medium-temperature Daqu.
[0035] In the present application, the physicochemical properties and enzyme activity of the fortified Daqu at different stages in the preparation process of the Rhizopus bran Daqu fortified medium-temperature Daqu are analyzed, and it is found that the Rhizopus bran Daqu fortified medium-temperature Daqu is the medium-temperature Daqu when the base is transferred or the medium-temperature Daqu when it is matured, and the activity of the Daqu is better; in particular, the activity of the medium-temperature Daqu when the base is transferred is more excellent.
[0036] In the present application, the preparation method of the Rhizopus bran Daqu comprises the processes of mixing water - sterilization - inoculating Rhizopus - culture - drying; in the process of inoculating Rhizopus, the Rhizomucor miehei spores are inoculated on the bran culture medium at 30-40℃; in the culture process, after the inoculation of Rhizopus is completed, the culture is carried out at 28-30℃ for 1-2 days, so that the mycelium covers the culture medium, then the bottle is buckled, and the culture is continued for 1-2 days.
[0037] In the preparation of Rhizopus azygosporus bran koji, the water mixing, sterilization and drying procedures are conventional procedures in the art, and specifically: water mixing: high-quality coarse bran is mixed with 80-90% water, and then stacked for 20-30 min to absorb water, with the requirement that the bran absorbs water sufficiently and is evenly dispersed; sterilization: the wet material is divided into 500ml sterilized triangular bottles, each bottle containing about 40-60g of material, and then the bottles are tightly plugged with cotton plugs and wrapped with newspapers, and then placed in a high-pressure steam sterilization pot for sterilization at 121℃ for 30 min, and then the bottles are taken out and gently tapped while hot to disperse the clumped bran in the bottles and return the condensed water in the bottles to the bran; drying: the clumped cakes are taken out of the bottles in a sterile operation table, and then the clumped cakes are dispersed with sterilized bamboo sticks, and then poured into sterilized cow leather paper bags, and then the bag openings are folded and sealed for drying; the drying is performed in a forced air drying oven at a temperature of 40-45℃ to rapidly remove water and stop the growth of the bacteria, thereby facilitating storage and preparation for use; after drying, the bran is ground and poured into sterile polyethylene sealed bags for storage.
[0038] The present application uses Rhizopus azygosporus (CGMCC 20728) bran koji to strengthen the medium-temperature Daqu as a fermentation agent, and through simulation of pit fermentation, the influence of Rhizopus strengthening on the community structure and volatile metabolic components of fermented grains is explored in multiple scales, and it is confirmed that Rhizopus has a significant advantage in liquor fermentation, and therefore the present application also provides the Rhizopus bran koji strengthened medium-temperature Daqu or the Rhizopus bran koji strengthened medium-temperature Daqu prepared by the above preparation method in the application of solid-state liquor production.
[0039] The present application also provides a method for improving liquor yield by using the Rhizopus bran koji strengthened medium-temperature Daqu or the Rhizopus bran koji strengthened medium-temperature Daqu prepared by the above preparation method, which comprises the following steps: adding the Rhizopus bran koji strengthened medium-temperature Daqu to steamed highland millet, stacking and saccharifying, and then fermenting at 28-32℃ for 28-30d to obtain Rhizopus fermented grains; distilling the Rhizopus fermented grains to obtain liquor; and the addition amount of the Rhizopus bran koji strengthened medium-temperature Daqu is 14-16% of the dry mass of the highland millet before steaming.
[0040] In the method for improving liquor yield by using the Rhizopus bran koji strengthened medium-temperature Daqu, the stacking and saccharifying time is 20-25h.
[0041] The present application will be further described in detail through examples, but the scope of protection of the present application is not limited in the range of the examples.
[0042] Test Example 1
[0043] Different kinds of Rhizopus bran koji and their addition amount can result in different enzyme activity of the prepared medium-temperature Daqu. In order to determine the most suitable addition amount of Rhizopus bran koji, two different Rhizopus bran koji and different inoculation amount of the strengthened medium-temperature Daqu are adopted in the present application. In the present experiment, X and T represent the Daqu strengthened by two different Rhizopus bran koji, -1 represents 0.01% bran koji addition amount, -2 represents 0.05% bran koji addition amount, and -3 represents 0.1% bran koji addition amount. The Daqu is sampled at the time of Daqu transfer and at the time of Daqu maturation (about one month after Daqu transfer), and the physicochemical and enzyme activity of the Daqu are determined.
[0044] The production process of Rhizopus bran koji is as follows: water mixing → sterilization → Rhizopus inoculation → culture → drying.
[0045] Water mixing: high-quality bran is adopted, 80%-90% water is added, and the mixture is uniformly mixed, and then is stacked for 20-30 min for water absorption. The bran is required to be fully absorbed with water, not to be in a group, and to be uniformly dispersed.
[0046] Sterilization: the wet material is divided into 500ml sterilized triangular bottles, about 40-60g of material is filled in each bottle, the bottle is plugged with cotton, the bottle mouth is wrapped with newspaper, and then is placed in a high-pressure steam sterilization pot for sterilization at 121℃ for 30 min. Then, the triangular bottle is taken out, and is lightly tapped while hot, so that the blocky bran in the bottle is dispersed, and the condensate water on the bottle wall is returned to the bran.
[0047] Rhizopus inoculation: when the temperature of the triangular bottle is cooled to 30-40℃, the Rhizopus test tube strain is inoculated on the bran culture medium in the sterile operation table, and then is uniformly shaken, so that the bacteria are dispersed, and the culture is facilitated.
[0048] Culture: after inoculation, the triangular bottle is placed in a constant temperature incubator for culture at 28-30℃ for 1-2d. When the mycelium covers the culture medium, and the bran is connected into a cake shape, the bottle is shaken and laid down, so that the bran cake is separated from the bottom of the bottle, and is suspended in the middle of the bottle, so as to increase the contact area with air, and to make the Rhizopus at the bottom of the bran grow and reproduce rapidly. After the bottle is taken off, the culture is continued for about 1d, and then is taken out for drying.
[0049] Drying: the culture is taken out in the sterile operation table, and is fully dispersed by using sterilized bamboo sticks, and then is poured into a sterilized cow leather paper bag, and is folded and sealed for drying. The drying is carried out in a blowing drying box, and the drying temperature is 40-45℃, so that the water is rapidly removed, the bacteria stop growing, and the bran is convenient for storage and standby use. After drying, the bran is ground and crushed, and is poured into a sterile polyethylene sealing bag for storage and standby use.
[0050] Inoculating Rhizopus azygosporus (CGMCC 20728) or Rhizopus oryzae (CGMCC 20726) in the process of "inoculating Rhizopus", X is Rhizopus azygosporus (CGMCC 20728) enhanced mesophilic Daqu, and T is Rhizopus oryzae (CGMCC 20726) enhanced mesophilic Daqu.
[0051] The production process of mesophilic Daqu is as follows: raw material (wheat) → moistening → crushing → mixing (adding bran Daqu) → treading → Daqu base → culturing → transferring → maturation → storage in warehouse → finished Daqu.
[0052] Raw material treatment: high-quality wheat is used as raw material, which is required to be full-grained, free of mildew, insect damage, impurities, peculiar smell and pesticide pollution; after moistening and crushing, the moisture content of wheat is adjusted to about 18%, and the crushed degree is required to be "plum blossom petals" with rotten core but not rotten skin;
[0053] Mixing: 9 kg of water is mixed with every 30 kg of wheat to adjust the moisture content of wheat to about 37%; at the same time, a certain amount of Rhizopus bran Daqu powder (the addition amount of Rhizopus bran Daqu powder is based on the dry mass of raw material wheat) is added when preparing Rhizopus enhanced mesophilic Daqu;
[0054] Treading: the size of Daqu base is generally 33 cm*20 cm*7 cm, and the Daqu base is not easy to keep warm and moist if it is too small, and the microorganisms are not easy to grow through if it is too large; the tightness of Daqu base should be appropriate, and the Daqu base is too hard, which causes improper color and peculiar smell of the core; the Daqu base is too loose, which is not convenient to operate and is easy to scatter, and is also not conducive to keeping warm and moist; the treading Daqu base is placed on the ground to naturally sweat.
[0055] Culturing: the Daqu base is placed on a stainless steel rack, the indoor temperature, humidity and Daqu core temperature are adjusted by air flow device to realize the production process without turning Daqu; after about 10-12 days of culturing, the Daqu is transferred, and after about one month, the Daqu is matured and then stored in the warehouse.
[0056] When the Daqu is transferred, X-2 has the highest saccharifying power, liquefying power, fermenting power and esterifying power in X Daqu, and has the best enhancement effect. In T Daqu, the enzyme activity of T-1 and T-2 is higher, and the enhancement effect is higher than that of T-3. Compared with T-2 and T-1, the four enzyme activities of X-2 are higher than those of T Daqu, which indicates that the enhancement effect of X-2 is better than that of T Daqu.
[0057] At maturity, the saccharifying power and esterifying power of X-2 were significantly higher than those of X-1 and X-3 in X Daqu, and the reinforcing effect was the best. The enzyme activities of X-3 were the lowest, and the reinforcing effect was the worst. The fermentation power, saccharifying power and liquefying power of T-2 were higher than those of T-1 and T-3 in T Daqu, and the reinforcing effect was the best. The reinforcing effect of T-3 was the worst. Compared with T-2, the enzyme activities of X-2 were significantly higher than those of T-2 except the fermentation power, indicating that the reinforcing effect of X-2 was better.
[0058] Compared with the enzyme activities of X-2 at maturity, the saccharifying power, liquefying power, fermentation power and esterifying power of X-2 at transfer were higher, and the activity of the reinforcing Daqu was more excellent.
[0059] The above results show that the reinforcing effect of Daqu with 0.05% bran koji addition is the best, and the reinforcing effect of X Daqu is better than that of T Daqu. The effect of transfer Daqu is better than that of mature Daqu. The difference in enzyme activity between mature Daqu and transfer Daqu mainly reflects the fermentation power. If mature Daqu is used for fermentation, the alcohol content of the fermented grains will be slightly reduced, and the other changes will not be too large.
[0060] Table 1 Physicochemical properties and enzyme activities of Daqu at transfer
[0061]
[0062] Table 2 Physicochemical properties and enzyme activities of Daqu at maturity
[0063]
[0064]
[0065] Example 1
[0066] 1.1 Materials and reagents
[0067] Rhizopus azygosporus (CGMCC 20728) was screened from a typical Chinese Daqu liquor factory by the laboratory of the present application, and the strain was preserved in the laboratory of the present application; Fast DNA SPIN extraction kit: MP Biomedicals Company, USA; Q5 DNA high-fidelity polymerase: New England Biolabs Company, USA; agarose, agarose gel electrophoresis buffer, Quant-iT PicoGreen dsDNA Assay Kit: Invitrogen Company, USA; VAH TS DNA Clean Beads: Nanjing Vazyme Company; other chemical reagents (analytical pure): purchased from Chengdu Jinshan Chemical Reagent Co., Ltd.
[0068] 1.2 Instruments and equipment
[0069] Trace 1300-TSQ 9000 gas chromatography-mass spectrometer: Thermo Fisher Electron Corporation, USA; equipped with VF-WAX-MS capillary chromatographic column (30 m x 0.25 mm x 0.25 μm): Bellefonte Corporation, USA; NanoDrop ND-1000 spectrophotometer: Thermo Fisher Scientific Corporation, USA; GL-20G-II vertical high-speed refrigerated centrifuge: Shanghai Anting Scientific Instrument Co., Ltd.; S100 TM Thermal Cycler PCR instrument and Gel Doc TM XR gel imager: Bio-Rad Corporation, USA; 85-2 type digital constant temperature magnetic stirrer: Shanghai Shuangjie Experimental Equipment Co., Ltd.
[0070] 1.3 Method
[0071] 1.3.1 Sample preparation and collection
[0072] Rhizopus enhanced mesophilic Daqu (RQ) was inoculated with 0.05% Rhizopus azygosporus (CGMCC 20728) bran Daqu, and when the fermentation was about 12 d, 0.05% Rhizopus azygosporus (CGMCC 20728) was added to the mesophilic Daqu. The normal Daqu (NQ) was used as a control, which was not inoculated with Rhizopus bran Daqu and was fermented for about 12 d.
[0073] The simulation fermentation experiment used a modified pile saccharification fermentation process and was fermented for 28 d. RQ and NQ were added to steamed sorghum (ratio of 15% of dry mass), and the pile saccharification was performed for 24 h. The samples were then loaded into a simulation fermentation tank (6 L plastic container with an inner diameter of 25 cm x 17 cm x 14 cm) and were fermented at 30°C for 28 d. The corresponding fermented grains were referred to as Rhizopus fermented grains (RZP) and normal fermented grains (NZP). Each group of samples was set in triplicate and was referred to as -1, -2, and -3. Five-point sampling was performed at 0 d, 7 d, 14 d, 21 d, and 28 d of fermentation. Each parallel sample was divided into two parts after sampling, one of which was stored at -20°C for physicochemical property and volatile substance detection, and the other was stored at -80°C for microbial community analysis.
[0074] 1.3.2 Physicochemical property determination
[0075] The determination of the moisture content, acidity, esterifying power, saccharifying power, liquefying power and fermenting power of the Daqu sample was performed according to the method described in the General Analysis Method for Distiller's Yeast (QB / T 4257-2011). The determination of the reducing sugar (RS) content, starch content, total acidity (TA) and alcoholicity of the distiller's grains was performed according to the method described in the Analysis and Detection Technology of Baijiu (Liquor).
[0076] 1.3.3 Detection of volatile substances
[0077] The volatile substances were determined by headspace solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC-MS).
[0078] Pre-treatment of the sample: 1.00 g of the sample and 10 μL of the internal standard substance (methyl octanoate, 0.0073 g / 100 mL) were added to a 20 mL headspace bottle, the headspace bottle was placed in a thermostatic magnetic stirrer for equilibrium at 60 °C for 15 min, and a 50 / 30 μm DVB / CAR / PDMS fiber was used to extract and adsorb the volatile components for 45 min. The extraction head was desorbed at 250 °C for 5 min.
[0079] Chromatographic conditions: the injection port temperature was 250 °C, the carrier gas was high-purity helium gas (> 99.999%) with a flow rate of 1 mL / min, and the splitless mode was used; the temperature program was as follows: the initial temperature was 40 °C, maintained for 5 min, then increased to 100 °C at a rate of 4 °C / min, then increased to 230 °C at a rate of 6 °C / min, and maintained for 10 min.
[0080] Mass spectrometric conditions: the ion source temperature was 250 °C, the transfer line temperature was 300 °C, the ionization mode was electron impact (EI) electron energy 70 eV, and the scanning range was 35-400 amu.
[0081] Qualitative analysis: after comparing the obtained mass spectrum with the NIST 2017 mass spectrum library, only the compounds with a similarity of > 80% were retained for further analysis. Quantitative analysis: according to the ratio of the content of the internal standard methyl octanoate to its peak area, the content of each volatile compound was calculated.
[0082] 1.3.4 Detection of microbial community diversity
[0083] Total DNA was extracted from samples according to the operation manual of Fast DNA SPIN Extraction Kit. Meanwhile, 0.8% agarose gel electrophoresis was used to detect the quality of DNA extraction and spectrophotometer was used to detect the content of DNA. The V3-V4 region of bacterial 16S rRNA and the ITS1 region of fungi were amplified by universal primers 338F / 806R and ITS5 / ITS1, respectively.
[0084] Polymerase chain reaction (PCR) system: 5 μL 5×Q5 high-fidelity reaction buffer, 5 μL 5×Q5 high-fidelity gas chromatography buffer, 0.25 μL Q5 high-fidelity DNA polymerase (5 U / μL), 2 μL dNTPs (2.5 mmol / L), 1 μL of forward and reverse primers (10 μmol / L) respectively, 2 μL DNA template and 8.75 μL ddH2O. The amplification reaction was as follows: preheating at 98℃ for 2 min, then 25 cycles including denaturation at 98℃ for 15 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, and finally extension at 72℃ for 5 min. PCR product purification: the amplified product was purified with VAHTSTM DNA Clean Beads, and quantified with Quant-iTPicoGreen dsDNA Assay Kit. After sample purification, Shanghai Paissennol Biotechnology Co., Ltd. was entrusted to complete the double-end (2×300 bp) sequencing of DNA fragments on the Illumina Novaseq platform.
[0085] The original sequencing data was mainly processed by QIIME2. The original sequence was demultiplexed using the demux plug-in, the primer was removed using cutadapt, and then the sequence was quality filtered, denoised, merged and chimera removed using DADA2. Further screening of amplicon sequences (ASV) found only in one sample and single body. Finally, alignment was performed according to the Silva (v132) and UNITE (v8.0) databases.
[0086] 1.3.5 Statistical analysis of data
[0087] Physicochemical properties were visualized using OriginPro 2019b. The following analyses were performed on the Pasenuo Gene Cloud Platform (https: / / www.genescloud.cn / home): α-diversity and β-diversity of the microbial community, including the Chao1 index and Shannon index, were analyzed, and marker microorganisms of the microbial community were identified using LEfSe analysis (LDA > 4, P < 0.05). Metabolic functions were predicted using PICRUSt2 based on the KEGG and Metalac databases. Partial least squares discriminant analysis (PLS-DA) and permutation tests were performed in SIMCA14.1. Heatmaps were generated using TB Tools (v1.108). Redundancy analysis (RDA) and trend analysis were performed on the TuTu Cloud Platform (https: / / www.cloudtutu.com / # / index) and OmicShare Tools (https: / / www.omicshare.com / tools), respectively.
[0088] 2 Results and Analysis
[0089] 2.1 Changes in the physicochemical properties of fermented mash
[0090] Moisture content, acidity, and hydrolysis capacity are the main parameters for evaluating the quality of Daqu (a type of starter culture). When two types of Daqu are used to ferment the mash, the differences in the physicochemical properties of the Daqu and the physicochemical parameters between the two types of mash are as follows: Figure 1 As shown.
[0091] Depend on Figure 1 As shown in Figure A, RQ had slightly lower moisture, acidity, and esterification power (EA) than NQ, while its saccharification power (SA), liquefaction power (LA), and fermentation power (FA) were higher. Except for esterification power, all other relevant parameters were improved by inoculation with Rhizopus. During the stacking saccharification stage, the starch contents of RZP and NZP were 31.53% and 34.42%, respectively, with the former having a higher hydrolysis rate than the latter. At the end of fermentation, the starch contents were 25.07% and 27.51%, respectively. Starch was significantly hydrolyzed in the early to mid-fermentation stages (0–14 days), but the degradation rate slowed in the later stages due to inhibition by metabolites (TA, ethanol) and a decrease in starch substrate content. Reducing sugar content and acidity gradually increased in both RZP and NZP, with a greater increase in RZP than NZP. This may be because RQ has higher saccharification and liquefaction power, allowing RZP substrates to be more effectively hydrolyzed into sugars, while the sugars fermented into acids. The alcohol content increased significantly in the early stage. At 14 days of fermentation, the alcohol content of RZP (8.57% vol) was significantly higher than that of NZP (7.28% vol, P<0.05). At the end of fermentation, the alcohol content of RZP (7.70% vol) was only slightly higher than that of NZP (7.20% vol).
[0092] The above results indicate that the physicochemical parameters of RZP and NZP show the same trend, but Rhizopus enhancement reduces the starch content of the mash while increasing its acidity, reducing sugar content, and alcohol content.
[0093] 2.2 Differences in volatile metabolites
[0094] 2.2.1 Differences in volatile component content
[0095] The results of the determination of volatile components in the fermented mash sample are shown in the figure. Figure 2 .Depend on Figure 2 It was found that a total of 69 volatile components were detected in the two samples, including esters (45), alcohols (4), acids (1), alkanes (2), alkenes (3), ketones (3), phenols (1), aldehydes (6), and other components (2). Figure 2 In the formula, v1: ethyl palmitate, v2: ethyl hexanoate, v3: ethyl transoleate, v4: ethyl acetate, v5: diethyl succinate, v6: methyl palmitate, v8: ethyl octanoate, v10: ethyl myristate, v11: ethyl phenylacetate, v12: ethyl 9-hexadecenoate, v14: methyl γ-linolenic acid, v17: ethyl laurate, v18: ethyl pentadecanoate, v21: isoamyl acetate, v24: methyl myristate, v25: glyceryl linolenic acid ester, v31: ethyl 2-methylbutyrate, v46: phenylethanol, v47: isoamyl alcohol, v48: isobutanol, v61: 4-ethylguaiacol, v64: acetal).
[0096] Depend on Figure 2As can be seen from Table 1, the total amount of volatile components gradually increased with the increase of fermentation time, and the increment was obvious in the initial stage (0-7 d) and the middle and later stages (14-21 d). The total amount of volatile components of RZP increased by 20.15 mg / kg and 19.86 mg / kg, respectively, which was 39.07% and 37.05% higher than that of NZP. In the later stage (21-28 d), the total amount of volatile components of RZP tended to be stable, while that of NZP decreased. At the end of fermentation, the total amount of volatile components of RZP was 59.52 mg / kg, while that of NZP was only 28.11 mg / kg. The content of esters accounted for 74.23%-88.68% of the total volatile components. After 7 d of fermentation, the content of esters increased from 74.23%-74.34% to 86.52%-87.81%, and then tended to be stable. Among the esters, ethyl esters, which imparted fruity, floral and sweet flavors to the base liquor, were the main components. The contents of ethyl hexanoate and ethyl acetate, which were the backbone components, increased significantly (P<0.05) during fermentation, and the increase was more obvious in RZP than in NZP. At the end of fermentation, the contents of the two components in RZP were 71.22% and 44.36% higher than those in NZP, respectively. In addition, the content of ethyl palmitate in RZP also increased due to the reinforcement of Rhizopus. At the end of fermentation, the content of ethyl palmitate in RZP was 93.66% higher than that in NZP. Ethyl palmitate imparted weak wax, fruity and buttery flavors to the liquor, and reduced the astringency. After fermentation, the proportion of components such as methyl palmitate decreased. Alcohols imparted a rich and sweet flavor to the liquor. At 0 d, the proportion of alcohols was the highest, being 7.88%-19.39%. The change trend of alcohols was opposite to that of esters, which might be related to the synthesis of esters. The proportion of isoamyl alcohol in RZP and NZP decreased from 10.80% and 12.45% at the beginning to 3.21% and 3.46% at the end, respectively.
[0097] From Figure 2 As can be seen from Table 2, 22 volatile metabolites were detected in both RZP and NZP, including 17 esters, 3 alcohols, 1 phenol and 1 aldehyde. The results of hierarchical cluster analysis of these components are shown in Figure 2 C. From Figure 2 As can be seen from Table 3, the volatile flavor substances could be divided into two clusters. Cluster I included 2 esters and 1 phenol, while cluster II included 15 esters, 3 alcohols and 1 aldehyde. The contents of these components in RZP were higher than those in NZP. During fermentation, cluster I was relatively stable, while cluster II gradually increased, and the increment was the largest at 21 d.
[0098] 2.2.2 Analysis of characteristic volatile components
[0099] The differences between RZP and NZP were explored by partial least squares-discriminant analysis (PLS-DA), and the results are shown in Table 4. Figure 3.
[0100] By Figure 3 Aknowledging that R 2 X (the fitting degree of the model in X space), R 2 Y (the fitting degree of the model in Y space), Q 2 (the predictive ability of the model) are 0.872, 0.919, 0.855 respectively, it shows that the constructed model has good reliability, and RZP and NZP are obviously separated. Figure 3 Bknowledging that 200 permutation tests prove that the PLS-DA model has no overfitting, and is suitable for screening characteristic volatile metabolites between samples. Based on the results of the predictive variable importance scores (VIP>1.0), 12 components are determined, including 10 esters, 1 alcohol and 1 phenol, of which 9 are shared. The changes of these components with fermentation are shown in Figure 3 C. The contents of most ethyl esters (ethyl palmitate, ethyl hexanoate, ethyl acetate, ethyl elaidate, diethyl succinate, ethyl heptadecanoate) have significantly increased during fermentation, and the highest increase is in 14-21d, while methyl palmitate, ethyl octanoate, isoamyl alcohol and 4-ethyl guaiacol are relatively stable during the fermentation process, and ethyl decanoate and methyl linoleate have higher content in the early and middle stages of NZP but are not detected in the later stage. The contents of most components in RZP are higher than those in NZP, indicating that the reinforcement of Rhizopus can increase the content of characteristic volatile components in the fermented grains.
[0101] 2.2.3 Expression trend analysis of volatile components
[0102] The time trend of flavor metabolite accumulation was studied, the trend analysis of the content of volatile components during fermentation was carried out, and the trends with a correlation coefficient greater than 0.7 were clustered into one class. In RZP and NZP, 9 and 10 different clusters were observed respectively, and the results are shown in Figure 4 . It can be seen from Figure 4 that 79.48% and 77.09% of the volatile components in RZP and NZP respectively show an increasing trend (cluster 1, cluster 2), and the trend is significant (P<0.05). It is worth noting that 46.15% and 66.67% of the volatile components in RZP and NZP respectively increased in content before 21d of fermentation, and slightly decreased after 21d, revealing that 21d is a key time node for the change of volatile components in fermented grains.
[0103] 2.3 Microbial diversity analysis
[0104] 2.3.1 Difference of community Alpha diversity index
[0105] The results of the volatile metabolite profiling showed that 21 d was the key time node for the change of volatile components in the fermentation system, so only the microbial community structure of Daqu and fermented 21 d grains was analyzed. The differences in the Alpha diversity indices of the communities are shown in Table 3.
[0106] Table 3 Alpha diversity indices of Daqu and fermented 21 d grains
[0107]
[0108] Note: The fungal and bacterial Alpha diversity indices were calculated at a sequencing depth of 100,000 and 60,000 sequences, respectively.
[0109] The Alpha diversity differences of microorganisms can generally be explained by richness (Cao's index, observed species index) and diversity (Shannon index, Simpson index). As shown in Table 1, the Alpha diversity of the communities of Daqu and the corresponding fermented grains showed consistent trends.
[0110] For the fungal community, the richness of RQ was lower than that of NQ, but the diversity was higher than that of NQ, and the richness of RZP was also lower than that of NZP. This may be because the Rhizopus enrichment increased the abundance of Rhizopus in RQ, also changed the microbial community structure, especially reduced the richness of the fungal community.
[0111] For the bacterial community, the richness and diversity of RQ were higher than those of NQ, and similarly, the richness and diversity of RZP were higher than those of NZP. The Rhizopus enrichment increased the rate of hydrolyzing the substrate, resulting in the accumulation of rich nutrients during the early stage of Daqu making and the saccharification stage of grains stacking, which accelerated the colonization rate of bacteria, so that the richness of the bacterial communities of RQ and RZP was higher than that of NQ and NZP.
[0112] 2.3.2 Differences in the composition of microbial communities
[0113] The results of the microbial community composition of Daqu and grains are shown in Figure 5 . As shown in Figure 5 A, the fungal communities of Daqu and grains were composed of 6 phyla, mainly Mucoromycota and Ascomycota, with a total relative abundance of 88.08% to 99.49%. The relative abundance of Mucoromycota in RQ and NQ was 27.40% and 4.73%, respectively, while it increased to 57.64% and 39.54% in RZP and NZP, respectively. On the contrary, the relative abundance of Ascomycota in RQ and NQ was 72.09% and 93.31%, respectively, while it decreased to 30.44% and 53.26% in RZP and NZP, respectively.
[0114] Dominant fungi at the genus level, such as Figure 5 As shown in B, the dominant fungi in Daqu (a type of fermented koji) include *Rhizopus*, *Thermomyces*, and *Thermoascus*. *Rhizopus* is a common fungus that secretes various hydrolytic enzymes, possessing the ability to saccharify and ferment, and produce metabolic components such as ethyl acetate. The relative abundance of *Rhizopus* in RQ is 27.35%, while in NQ it is only 3.86%. Notably, *Rhizopus* enhancement significantly increased the relative abundance of *Thermomyces* in Daqu (48.06%), but decreased the relative abundance of *Thermoascus* (22.92%). The relative abundances of these two fungal genera in NQ are 14.64% and 69.47%, respectively. *Thermoascus* can also secrete various enzymes, such as catalase, endoglucanase, and glucosidase. Both *Thermomyces* and *Thermoascus* exhibit strong thermostability and maintain stable catalytic efficiency during fermentation. At 21 days of fermentation, the dominant fungal genera in RZP were Rhizopus (57.32%), Thermomyces (3.22%), and Saccharomyces (1.17%), while the dominant fungal genera in NZP were Rhizopus (32.16%), Lichtheimia (7.30%), Pichia (2.26%), and Saccharomyces (1.37%). The increased abundance of Rhizopus due to Rhizopus enrichment also occupied space for other fungi, leading to a decrease in the richness of the fungal community.
[0115] Depend on Figure 5 C indicates that the bacterial communities of Daqu and Zaomai consist of 12 phyla, mainly Firmicutes and Proteobacteria, with a combined relative abundance of 99.18%–99.88%. Firmicutes had the highest relative abundance in Daqu, reaching 93.58% and 98.94% in RQ and NQ, respectively. In RZP and NZP, the relative abundance of Firmicutes decreased to 50.30% and 44.89%, respectively, while the relative abundance of Proteobacteria increased to 49.58% and 54.96%, respectively. The dominant bacterial genera composition of the two types of Daqu differed only slightly, but the relative abundances showed significant differences. Figure 5D) Lactobacillus, Kroppenstedtia and Weissella were the shared dominant genera, and the relative abundances of Lactobacillus and Weissella in RQ (29.43% and 25.53%) were higher than those in NQ (10.20% and 11.37%), while the relative abundance of Kroppenstedtia in NQ (76.68%) was significantly higher than that in RQ (22.86%). Thermoactionmyces (13.02%) was also one of the dominant genera in RQ. At 21 d of fermentation, the dominant genera of RZP included Pediococcus (28.17%), Enterobacter (10.46%), Lactobacillus (10.31%), Ralstonia (22.91%) and other 8 genera, while NZP only included Pediococcus (38.45%), Ralstonia (37.39%), Sphingomonas (10.21%) and other 6 genera. The main metabolic products of lactic acid bacteria such as Lactobacillus, Pediococcus and Weissella included various organic acids such as acetic acid and lactic acid, which were not only the flavor components of liquor, but also the precursors of characteristic metabolites such as ethyl acetate and ethyl lactate.
[0116] Rhizopus reinforcement significantly changed the community structure of Daqu and fermented grains. It increased the relative abundances of Rhizopus, Thermomyces, Lactobacillus, Weissella and Thermoactionmyces in Daqu, and decreased the relative abundances of Thermomyces and Kroppenstedtia. For fermented grains, Rhizopus reinforcement increased the relative abundances of Rhizopus, Thermomyces, etc., while decreased the relative abundances of Lichtheimia, Pichia, etc. In addition, Rhizopus reinforcement also increased the number of dominant genera of bacteria in fermented grains, and improved the RA of Enterobacter, Lactobacillus, etc.
[0117] 2.3.3 Analysis of characteristic microorganisms
[0118] The characteristic microorganisms between RZP and NZP at 21 d were identified by linear discriminant analysis (Linear discriminant analysis Effect Size, LEfSe) (LDA>4, P<0.05), and the results were shown in Table 2. Figure 6 Figure 6 As shown in A, the RZP identified characteristic fungi at the class, order, family, and genus levels, while the NZP identified characteristic fungi at all five taxonomic levels (phylum, class, order, family, and genus). At the genus level, *Thermomyces* is the characteristic fungus of the RZP, while *Pichia* and *Lichtheimia* are characteristic fungi of the NZP. Figure 6 As shown in B, RZP identified characteristic bacteria at the kingdom, order, family, and genus levels, and the characteristic bacterial genera of RZP are Thermoactinomyces, Lactobacillus, and Enterobacter, while no characteristic bacteria of NZP were identified at any taxonomic level.
[0119] 2.3.4 Comprehensive Metabolic Pathway Analysis
[0120] The metabolic pathways involving the utilization of fermented mash, the generation of metabolites, and the expression of enzymes were analyzed, and the results are shown in [the table below]. Figure 7 .Depend on Figure 7 It was found that in RZP, the enhancement of Rhizopus increased the relative abundance of Rhizopus, and the expression of glucosylamylase, glycogen phosphorylase, and endoglucanase was significantly upregulated (P<0.05), increasing the metabolic rate of starch raw materials and reducing the starch content of RZP. Therefore, the RS content in RZP was higher than that in NZP. Key enzymes in ethanol metabolism in the glycolysis pathway were significantly downregulated (P<0.05), including pyruvate decarboxylase and alcohol dehydrogenase, explaining the gradually decreasing ethanol content in RZP during the later stages of fermentation. The significant upregulation of formate C-acetyltransferase (P<0.05) and the significant downregulation of acetyl-CoA synthase (P<0.05) led to increased acetate accumulation in RZP.
[0121] 2.4 Correlation between microbial community and volatile components
[0122] Redundancy analysis (RDA), combining correspondence analysis and multiple regression analysis, revealed the correlation between dominant microbial genera and important volatile components in the fermented mash. The results are shown in [Figure number missing]. Figure 8 ( Figure 8 Medium, F1: Rhizopus, F3: Thermomyces, F6: Saccharomyces, F7: Pichia, F9: Lichtheimia; B1: Pediococcus, B2: Ralstonia, B3: Lactobacillus, B4: Enterobacter, B7: Sphingomonas).
[0123] Depend on Figure 8The Hellinger distance method was used to obtain the correlations between 19 volatile components and 5 dominant fungal and 5 dominant bacterial genera. Rhizopus, Lactobacillus, and ethyl palmitate, ethyl transoleate, ethyl butyrate, ethyl hexadecenoate, ethyl acetate, and phenethyl alcohol showed positive correlations. This may be because lactic acid, acetic acid, and other organic acids are the main metabolites of lactic acid bacteria such as Lactobacillus, while Rhizopus has a strong esterification effect, promoting the formation of esters from precursor substances. Therefore, the high relative abundance of Rhizopus and Lactobacillus in RZP synergistically increased the content of components such as ethyl palmitate, ethyl transoleate, ethyl butyrate, ethyl hexadecenoate, and phenethyl alcohol. This indicates that Rhizopus fortification helps increase the content of dominant volatile components in fermented grains, enhancing their flavor and aroma. Thermomyces, Enterobacter, and ethyl hexadecenoate, ethyl acetate, phenethyl alcohol, ethyl myristate, ethyl hexanoate, methyl γ-linolenic acid, isoamyl alcohol, and ethyl octanoate showed positive correlations. Ralstonia, Sphingomonas, and Saccharomyces showed positive correlations with methyl γ-linolenic acid, ethyl hexanoate, ethyl octanoate, methyl palmitate, ethyl lactate, methyl linoleate, and ethyl decanoate. Pichia, Lichtheimia, and Pediococcus showed positive correlations with ethyl phenylacetate, 4-ethylguaiacol, ethyl laurate, diethyl succinate, ethyl decanoate, methyl linoleate, ethyl transoleate, and ethyl butyrate. Rhizopus enhancement increased the abundance of Rhizopus, Lactobacillus, Thermomyces, and Enterobacter in RZP, leading to an increase in the content of flavor metabolites associated with these dominant microbial genera, thus improving the flavor and aroma of the fermented mash.
[0124] This invention utilizes HS-SPME-GC-MS and high-throughput sequencing to reveal the effects of Rhizopus enhancement on the volatile components and community structure of fermented grains. Rhizopus enhancement significantly altered the community structure of both koji (fermentation starter) and fermented grains, significantly increasing the relative abundance of Rhizopus and Thermomyces in both RQ and RZP. Thermomyces, Thermoactinomyces, Lactobacillus, and Enterobacter are marker microorganisms for RZP, while Pichia and Lichtheimia are marker microorganisms for NZP. Rhizopus in the fermented grains showed a positive correlation with most dominant volatile components, indicating that Rhizopus enhancement increased the content of these dominant volatile components. The fermentation process increased the content of ethyl acetate and ethyl hexanoate, and increased the proportion of ester components while decreasing the proportion of alcohols. A total of 12 volatile components were identified that contributed to the flavor differences between the two types of fermented grains, with 21 days being a critical time point for systemic metabolic changes. The findings provide a methodological and theoretical foundation for regulating microbial community structure and flavor compounds.
Claims
1. Rhizopus glutenus koji fortified medium-temperature Daqu, characterized in that: Medium-temperature Daqu inoculated with 0.049~0.051% Rhizopus arrhizus (strain) Rhizopus azygosporus ) bran-fermented starter, which is preserved in China General Microbiological Culture Collection Center with the preservation number of CGMCC No.20728.
2. The Rhizopus bran koji fortified mesophilic Daqu according to claim 1, characterized in that: The DNA sequence of the Rhizopus azygosporus is shown as SEQ ID NO:
1.
3. The preparation method of the Rhizopus gluten meal fortified medium-temperature Daqu according to claim 1 or 2, comprising the steps of raw material, wetting material, crushing, mixing, treading, Daqu base, culture, transfer, and maturation, characterized in that: In the mixing process, 0.049~0.051% of the Rhizopus azygosporus bran starter by dry weight of raw materials is added.
4. The preparation method of Rhizopus bran koji fortified medium-temperature Daqu according to claim 3, characterized in that: The Rhizopus bran starter reinforced medium-temperature Daqu is medium-temperature Daqu at the time of transfer or medium-temperature Daqu at the time of maturity.
5. The preparation method of Rhizopus gluten meal fortified medium-temperature Daqu according to claim 3, characterized in that: The preparation method of the Rhizopus azygosporus bran starter comprises the steps of mixing water, sterilization, inoculation of Rhizopus, culture and drying; in the inoculation of Rhizopus step, the Rhizopus azygosporus spores are inoculated on the bran medium at 30~40℃; in the culture step, after inoculation of Rhizopus is completed, the culture is carried out at 28~30℃ for 1~2d to make the mycelium cover the medium, then the bottle is buckled, and the culture is continued for 1~2d.
6. The application of the Rhizopus bran starter reinforced medium-temperature Daqu of claim 1 or 2 or the Rhizopus bran starter reinforced medium-temperature Daqu prepared by the preparation method of any one of claims 3~5 in the production of solid-state liquor.
7. The method for improving wine production by using the Rhizopus bran fortified medium-temperature Daqu according to claim 1 or 2 or the Rhizopus bran fortified medium-temperature Daqu prepared by the method according to any one of claims 3-5, characterized in that: comprising the following steps: The Rhizopus bran starter reinforced medium-temperature Daqu is added to steamed highland barley, and after stacking and saccharifying, fermentation is carried out at 28~32℃ for 28~30d to obtain Rhizopus dregs; the Rhizopus dregs are distilled to obtain liquor; the addition amount of the Rhizopus bran starter reinforced medium-temperature Daqu is 14~16% by dry weight of the highland barley before steaming.
8. The method of claim 7, wherein: The stacking and saccharifying time is 20~25h.
Citation Information
Patent Citations
Rhizopus microsporus root-shaped variant ZJPH1308 and application thereof in preparation of sitagliptin intermediate
CN104893989A
Rhizopus oryzae, microbial agent, mouldy bran, preparation methods and application thereof, wine and preparation method of wine
CN112011467A