A molecular marker for identifying the length of the rice mesocotyl and application thereof

Abstract

The present application relates to a kind of molecular marker for identifying rice mesocotyl length and its application, belong to the field of breeding technology.The present application provides the application of primer group for detecting molecular marker in identifying rice mesocotyl length, the molecular marker is the nucleotide of the 37th in the sequence as shown in SEQ ID NO.1 in sequence table on rice chromosome 3, and its nucleotide species is A or T;The molecular marker provided by the present application is Kasp-3-31.8 site, which is finely located on rice chromosome 3 (31.8Mb);Based on the site, a method for identifying or assisting in identifying rice mesocotyl length is provided, comprising using allelic competitive specific PCR method (KASP) to identify rice mesocotyl length.By analyzing the distribution and displayed fluorescent label of SNP site, the mesocotyl length of rice variety can be accurately identified, and the identification efficiency is improved.

Description

Technical Field

[0001] This invention relates to the field of breeding technology, and in particular to a molecular marker for identifying the length of the rice mesocotyl and its application. Background Technology

[0002] With the continuous advancements in genomics and molecular biology, single nucleotide polymorphism (SNP) markers and resequencing technologies have been widely applied in rice genetic research. These technologies provide powerful tools for the genetic analysis of complex traits in rice, including high-density genetic mapping, quantitative trait gene localization, genome-wide selection, and germplasm genotyping.

[0003] In genotyping technology, PCR (polymerase chain reaction) is a widely used technique that amplifies specific DNA fragments and performs qualitative or quantitative analysis. However, traditional PCR methods may encounter some problems when applied to rice genotyping. First, due to the complexity and polymorphism of the rice genome, traditional PCR methods may not accurately detect certain SNPs or InDels. Second, traditional PCR methods typically require large amounts of DNA samples and cumbersome experimental procedures, which may increase experimental costs and time.

[0004] KASP (Kompetitive Allele-Specific PCR) is a molecular marker technology that accurately identifies biallelic genes in SNPs and InDels at specific loci. The SNP genotyping detection solution based on KASP technology, developed by LGC Genomics in the UK, can effectively save costs and be efficiently applied to the detection of specific markers in large-scale materials, thereby effectively promoting the process of molecular-assisted breeding in rice.

[0005] In practice, applying KASP technology for genotyping of rice germplasm resources allows for the rapid screening of germplasm resources with long mesocotyl characteristics. Furthermore, combining this with genome-wide selection technology enables more precise screening of rice germplasm resources with superior traits. In addition, marker-assisted selection (MAS) using KASP technology allows for more accurate selection of individuals with superior traits during the breeding process, thereby improving breeding efficiency and quality. KASP technology can also be applied to the prediction and identification of heterosis in rice, providing more comprehensive technical support for rice breeding.

[0006] Direct seeding of rice is an advanced agricultural technology that can significantly reduce labor costs and facilitate large-scale mechanized operations. However, it still faces challenges such as low emergence rate, uneven emergence, and difficulty in weed control. To address these issues, identifying genes related to mesocotyl elongation and screening and creating germplasm with long mesocotyls has become an important research direction.

[0007] The mesocotyl is a crucial organ in rice seedling emergence, and its rapid elongation contributes to improved seedling emergence rate and uniformity. Seedlings with long mesocotyls possess a competitive advantage against weeds, effectively suppressing their growth. However, the mesocotyl is a complex quantitative trait controlled by multiple minor genes, resulting in significant variations in mesocotyl length among varieties. Therefore, identifying mesocotyl elongation genes and developing usable KASP molecular markers are urgent problems to be solved in long mesocotyl breeding. Summary of the Invention

[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide a molecular marker for identifying the length of the rice mesocotyl and its application.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] In a first aspect, the present invention provides a molecular marker for identifying the length of the mesocotyl in rice, wherein the molecular marker is a nucleotide at position 37 on rice chromosome 3 as shown in SEQ ID NO.1 in the sequence listing, and the nucleotide type is C or T.

[0011] This invention provides a molecular marker suitable for marker-assisted breeding. Genome-wide association analysis identified a locus associated with mesocotyl length, named Kasp-3-31.8. This marker is a SNP locus that can be used to identify rice mesocotyl length and is tightly linked to the target trait. When selecting rice varieties with longer mesocotyls, this molecular marker Kasp-3-31.8 can be used to reduce the tediousness and errors of phenotypic selection in traditional breeding techniques, thereby improving the accuracy and efficiency of selection. Analysis using this locus showed an association between mesocotyl length and rice genotype length, with a p-value less than 0.05, indicating that this molecular marker is statistically significant in distinguishing mesocotyl length.

[0012] Secondly, the present invention provides an application of a molecular marker for identifying the length of the rice mesocotyl, including any one of the following a1)-a3):

[0013] a1) To determine the relative length of the mesocotyl of the rice to be tested;

[0014] a2) Screening for rice varieties with long mesocotyls;

[0015] a3) Rice breeding.

[0016] The molecular marker Kasp-3-31.8 of this invention can rapidly and accurately detect the relative length of the mesocotyl in rice, providing a basis for selection during the breeding process. By utilizing the molecular marker of this invention, superior varieties with long mesocotyls can be screened from a large number of rice varieties, improving breeding efficiency. Genotypic selection and combination during rice breeding enable efficient and precise breeding.

[0017] In a preferred embodiment of the present invention, the above application applies to the rice subspecies *Indica*. *Indica* is a subspecies of cultivated rice and one of China's traditional rice varieties. Indica rice grains are long and slender with a soft texture, making them suitable for cooking rice and porridge. In China, the planting area of ​​*Indica* accounts for more than 60% of the total rice planting area, mainly distributed in tropical South China and subtropical lowlands south of the Huai River. This invention, through this molecular marker, can identify *Indica* varieties whose traits match those of the currently characteristic short-mesocotyledonous *Indica* material IR 145 or long-mesocotyledonous material IRGC 135929. This locus can effectively perform population genotyping.

[0018] Thirdly, the present invention provides a method for identifying or assisting in the identification of rice mesocotyl length, comprising the following steps: detecting the molecular marker as described in claim 1 in the genome of the rice to be tested, determining whether the nucleotide type of the molecular marker is C or T, wherein homozygous rice with nucleotide C is CC homozygous rice, and homozygous rice with nucleotide T is TT homozygous rice, wherein the mesocotyl of CC homozygous rice is shorter than that of TT homozygous rice.

[0019] This invention provides a method for identifying or assisting in the identification of rice mesocotyl length. This method utilizes molecular markers in the rice genome for mesocotyl length identification. Compared to traditional genotyping techniques, it can rapidly and accurately identify the trait of mesocotyl length without affecting the expression of the target trait. Molecular markers can predict individuals with unknown genotypes, allowing for selection in early generations and improving breeding efficiency and accuracy. The molecular marker is a SNP locus; therefore, technologies such as massively parallel sequencing in SNP detection can be used to perform SNP detection on a large number of samples in a short time, thus accelerating the identification process of the rice mesocotyl length trait. Molecular marker / SNP detection typically employs polymerase chain reaction (PCR) technology, which can detect differences in single bases and has very high sensitivity. This allows for the accurate detection of even SNP loci with very low concentrations in DNA samples, improving detection accuracy. SNP detection typically uses paired-end sequencing technology, which can simultaneously obtain forward and reverse sequencing results, further improving detection accuracy. Furthermore, SNP detection results can be corrected and optimized through methods such as alignment analysis, further improving detection accuracy.

[0020] A preferred embodiment of the method described in this invention includes the following steps:

[0021] (1) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using molecular marker detection reagents to obtain PCR amplification products;

[0022] (2) Detect the fluorescence signal of the PCR amplification product described in step (1) and determine the genotype of the rice to be tested based on the fluorescence signal color; or sequence the PCR amplification product described in step (1) to obtain the genotype of the rice to be tested.

[0023] The molecular markers of this invention are applicable to KASP for rice variety identification, particularly for determining the length of the rice mesocotyl, and have the following advantages: 1. High efficiency: KASP technology can quickly and accurately identify rice varieties, especially for determining the length of the mesocotyl, which can greatly improve identification efficiency; 2. Accuracy: KASP technology can accurately detect SNP sites in the rice genome. By analyzing the distribution and frequency of SNP sites, the length of the rice mesocotyl can be accurately determined; 3. Wide applicability: KASP technology is applicable to the identification of various rice varieties, whether conventional or hybrid; 4. Convenience: The experimental materials and equipment required for KASP technology are relatively simple, and the operation procedure is relatively easy. Therefore, using KASP technology for rice variety identification is highly convenient.

[0024] In a preferred embodiment of the method of the present invention, in step (1), the detection reagent for the molecular marker includes a primer set for detecting the molecular marker; the primer set includes upstream primer F1, upstream primer F2 and downstream primer R; the nucleic acid sequence of the upstream primer F1 is the DNA fragment shown in SEQ ID NO:2 from position 22 to 40 from the 5' end; the nucleic acid sequence of the upstream primer F2 is the DNA fragment shown in SEQ ID NO:3 from position 22 to 40 from the 5' end; the nucleic acid sequence of the downstream primer R is shown in SEQ ID NO:4.

[0025] The primer set of this invention is suitable for competitive allele-specific PCR, specifically the KASP primer set. The KASP method differs from conventional fluorescent PCR in primer and probe design. First, two corresponding upstream primers are designed for each SNP allele. The 3' ends of these primers are located at their respective SNP sites, and each primer has a unique tag sequence at its 5' end. The downstream primer is a conventionally designed, shared primer. Because KASP technology uses specific primers and probes, it can accurately distinguish different genotypes, avoiding technical errors that may occur in traditional PCR methods. Therefore, KASP technology has higher accuracy and specificity than ordinary PCR technology, making it more advantageous for identifying rice mesocotyl length.

[0026] In a preferred embodiment of the method described in this invention, the upstream primer in the primer set is linked to a fluorescent label: the fluorescent label of the upstream primer F1 is FAM, and the fluorescent label of the upstream primer F2 is HEX.

[0027] Furthermore, the fluorescent tag sequence of the upstream primer F1 is a FAM fluorescent tag sequence, as shown in the DNA fragment from position 1 to 21 of SEQ ID NO.2; the fluorescent tag sequence of the downstream primer F1 is a HEX fluorescent tag sequence, as shown in the DNA fragment from position 1 to 21 of SEQ ID NO.3.

[0028] The fluorescent labels FAM and HEX selected in this invention are both fluorescent dyes. Their fluorescence signals are relatively stable, which can effectively monitor the amplification products in PCR experiments. FAM and HEX have different fluorescence signal wavelengths, which can effectively distinguish different genotypes and shorten the identification process. FAM and HEX have high sensitivity and can detect low concentrations of rice DNA template, thereby reducing background noise in the experiment.

[0029] In a preferred embodiment of the method described in this invention, the principle for determining the genotype of the rice to be tested based on the fluorescence signal color in step (2) is as follows:

[0030] If the PCR amplification product shows a blue fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is TT homozygous.

[0031] If the PCR amplification product shows a red fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is CC homozygous.

[0032] If the PCR amplification product shows a green fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is TC heterozygous.

[0033] As a preferred embodiment of the method of the present invention, the method can be applied in rice breeding.

[0034] Fourthly, the present invention provides a product for detecting molecular markers or genotypes in rice, comprising any one of the following b1)-b3):

[0035] b1) Products that detect SNP polymorphisms or genotypes related to the length of the rice mesocotyl;

[0036] b2) Products used for identification or auxiliary identification of mesocoaxial length;

[0037] b3) Products used in rice breeding;

[0038] The molecular marker is the nucleotide at position 37 on rice chromosome 3, as shown in SEQ ID NO.1 in the sequence listing, and its nucleotide type is C or T.

[0039] Fifthly, the present invention provides a method for rice breeding, comprising the following steps: replacing the nucleotide at position 37 of the genome of CC homozygous rice, as shown in SEQ ID NO.1, with T to obtain TT homozygous rice; wherein the mesocotyl of the CC homozygous rice is shorter than that of the TT homozygous rice.

[0040] This invention provides a method for rice breeding. Mesocolumn length is a crucial factor affecting rice yield and quality, and is related to yield, quality, and lodging resistance. Therefore, through the selection of the aforementioned genotypes during the breeding process, rice varieties with longer mesocolumnar axes can be bred, which is beneficial for increasing the number of grains per panicle and grain weight, thereby improving rice yield. Furthermore, the length of the rice mesocolumn is closely related to the plant's lodging resistance. Rice plants with excessively long mesocolumnar axes are prone to lodging in the later stages of growth, affecting yield and quality. Therefore, it is necessary to select an appropriate mesocolumn length during the breeding process to improve the plant's lodging resistance.

[0041] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0042] 1. This invention provides a molecular marker and corresponding primer set. This molecular marker can be precisely located on rice chromosome 3 (31.8 Mb), a site that is statistically significantly associated with the length of the rice mesocotyl. The primer set designed based on this molecular marker has high specificity and accuracy, and can effectively amplify specific regions on rice chromosome 3. The primer set designed and synthesized in this invention can be applied to allele competitive specific PCR to identify the length of the rice mesocotyl. This method uses the primer set to amplify a specific gene, and by comparing the amplification products of different rice genotypes, the length of the rice mesocotyl can be accurately identified.

[0043] 2. This invention provides a method for identifying or assisting in the identification of rice mesocotyls, which can effectively distinguish the length of rice mesocotyls corresponding to different genotypes. This method is based on allele competitive specific PCR, and by comparing the amplification products of different rice genotypes, the length of the rice mesocotyl can be accurately identified. Specifically, the mesocotyl length of CC homozygous rice varieties is significantly different from that of TT homozygous rice varieties, indicating that the length of the rice mesocotyl can be identified by detecting the genotype of the test rice based on the Kasp-3-31.8 locus. This method can provide important reference information for rice breeding, helping breeders select rice varieties with excellent mesocotyl lengths, improving breeding efficiency and accuracy; it also has significant application value in the process of molecular marker-assisted breeding of rice. Attached Figure Description

[0044] Figure 1 This is a partial detection result of the F2:3 population of 345 IR 145 and IRGC 49311 in Example 1;

[0045] Figure 2 This is a partial test result of 470 rice varieties in the Indica population in Example 2. Detailed Implementation

[0046] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0048] Example 1: Development and Polymorphism Detection of Kasp-3-31.8, a Molecular Marker for Mesocotyl Length in Rice

[0049] 1. Development of the molecular marker Kasp-3-31.8

[0050] Through extensive experimentation, the inventors of this invention designed and synthesized a primer set suitable for identifying the length of the rice mesocotyl using allele-competitive specific PCR, located on rice chromosome 3 (at 31.8 Mb) using a fine-mapping method. The primer set consists of three primer sequences: upstream primer F1, upstream primer F2, and downstream primer R, used to amplify the target sequence including the Kasp-3-31.8 site. The nucleotide sequences of each primer are shown in Table 1; wherein, the nucleotide sequence of the fluorescent tag sequence FAM is shown as positions 1 to 21 from the 5' end of SEQ ID NO:2; and the nucleotide sequence of the fluorescent tag sequence HEX is shown as positions 1 to 21 from the 5' end of SEQ ID NO:3.

[0051] Table 1. Nucleotide sequences of each primer

[0052]

[0053] The Kasp-3-31.8 site is the 37th nucleotide from the 5' end of SEQ ID NO:1 in the rice genome, with genotypes of TT homozygous, CC homozygous, and TC heterozygous. SEQ ID NO:1: GTTACTTCCATAAAGGTTTCACAAAGCAACACAGCA[T / C]TAGTTGCTCACA CCCCATATAGTCCATGGCTCCATG.

[0054] Since genomic DNA is composed of two single-stranded DNA molecules that are antisense complements each other, the DNA molecule that encodes proteins is generally called the sense DNA molecule; the DNA molecule that is antisense complement to the sense DNA molecule is called the antisense DNA molecule. The genotypes at the Kasp-3-31.8 locus are all sense DNA genotypes.

[0055] 2. Polymorphism detection

[0056] 2.1 Phenotypic identification of field mesocotyls of IR 145 / IRGC 49311

[0057] IR 145 is an important indica rice material, with a relatively short hypocotyl of only 0.18 cm. IRGC 49311 has a longer hypocotyl of 4.74 cm. In June 2018, IR 145 and IRGC 49311 were crossbred. After harvesting F1 generation seeds, the F2 generation was propagated in southern China at the experimental base in Lingshui County, Hainan Province in December of the same year. F2 generation seeds were obtained from individual plants in April of the following year, and the F2 population was constructed.

[0058] 'IR 145' and IRGC 49311 see: Liu, J., Zhan, J., Chen, J., Lu, X., Zhi, S., & Ye, G. (2021). Validation of genes affecting rice grain zinc content through candidate gene-based association analysis. Frontiers in Genetics, 12, 701658.

[0059] In June 2018, a hybrid combination 'IR 145' and IRGC 49311 was bred. After harvesting F1 generation seeds, the F2 generation was propagated in Lingshui County, Hainan Province in December of the same year. F2 generation seeds were obtained by harvesting individual plants in April of the following year. Approximately 400 plump, uncracked rice grains were selected and sown in 10×5-well trays containing a measured amount of homogeneous nutrient soil, ensuring a sowing depth of 6 cm. The grains were ensured to be free from compression, and the nutrient soil was covered to be level with the surface of the holes. 500g of nutrient soil was weighed into the tray and compacted. The tray was placed in the tray, and an appropriate amount of tap water was sprayed onto both the tray and the tray. The entire setup was then placed in a 30℃ constant temperature dark incubator. Watering was done daily until germination, and germination status was recorded. After approximately 10 days of constant temperature cultivation (3 days after all seedlings have emerged), the seedling trays were removed from the artificial climate chamber. The soil around the seedling roots was quickly rinsed with running water, and individual plants with significant differences in growth were removed. The uniform plant lines were photographed, and the mesocotyl length was measured using ImageJ software (https: / / image j.en.softonic.com / ).

[0060] 2.2, 345 rice samples F 2:3 Molecular identification of populations

[0061] (1) Genomic DNA was extracted from young leaves of 345 rice germplasm resources using the CTAB method. The quality and concentration of genomic DNA had to meet the requirements of PCR, with the following standards: agarose gel electrophoresis showed a single DNA band without obvious diffusion; the A260 / A280 ratio was between 1.8 and 2.0 (indicating no protein contamination in the DNA sample), and the A260 / A230 ratio was between 1.8 and 2.0 (indicating low salt ion concentration in the DNA sample), with no obvious light absorption at 270 nm (indicating no phenol contamination in the DNA sample); the concentration of the genomic DNA of the rice samples was between 50 and 200 ng / μL.

[0062] (2) Competitive allele-specific PCR. Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the primer set synthesized in step three to obtain the PCR amplification product. The reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ (using the touch down program, decreasing by 0.6℃ per cycle) for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, and continued amplification for 26 cycles.

[0063] (3) After completing step (2), when the temperature of the PCR amplification product drops below 40°C, read the fluorescence value by scanning with the FAM and HEX beams of the microplate reader. (The FAM fluorescent tag sequence was observed and read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm. HEX fluorescence...) The optical tag sequence was observed and read at excitation wavelengths of 528 nm and emission wavelengths of 560 nm. The genotype of the rice sample based on the Kasp-3-31.8 locus was determined by the color of the fluorescence signal.

[0064] The specific judgment principles are as follows: If the tested rice shows a red fluorescent signal at the Kasp-3-31.8 locus, then the genotype of the tested rice at the Kasp-3-31.8 locus is CC homozygous, consistent with IR145; if the tested rice shows a blue fluorescent signal at the Kasp-3-31.8 locus, then the genotype of the tested rice at the Kasp-3-31.8 locus is TT homozygous, consistent with IRGC 49311; if the tested rice shows a green fluorescent signal at the Kasp-3-31.8 locus, then the genotype of the tested rice at the Kasp-3-31.8 locus is TC heterozygous. The detection results are shown below. Figure 1 .

[0065] 2.3 Significance Analysis

[0066] The average mesocotyl length of the two rice genotypes was statistically analyzed (Table 2), and a t-test was performed using the PROC TTEST model in the internationally used SAS 9.2 statistical software. The statistical results are shown in Table 3.

[0067] Table 2 IR 145 / IRGC 49311 F 2:3 KASP-3-31.8 detection results and mesocotyl length in the population

[0068]

[0069]

[0070]

[0071] Table 3. Mesocotyl association analysis of Kasp-3-31.8 in the IR 145 / IRGC 49311 population.

[0072]

[0073] The results in Table 3 show that the average mesocotyl length of the CC homozygous rice variety (mesocotyl length 1.15 cm) was 17.2% lower than that of the TT homozygous rice variety (mesocotyl length 1.39 cm), which was significant at the 0.05 level.

[0074] Example 2: Correlation analysis and verification between primer sets and hypocotyl length in natural rice varieties

[0075] 1. Genotyping of 470 rice varieties based on the KASP-3-31.8 locus.

[0076] Following the method in Example 1, the rice varieties to be tested were replaced with 470 different varieties, with all other steps remaining unchanged, resulting in the genotypes of 470 rice varieties based on the KASP-3-31.8 locus. The test results are shown below. Figure 2 .

[0077] 2. Detection of the mesocotyl

[0078] Forty-seventy rice accessions from the Indica subgroup in Southeast and South Asia were selected. From each accession, 15 plump, uncracked rice grains were chosen and sown in 10×5-cell trays containing a measured amount of homogeneous potting soil, one variety per cell (15 grains). The sowing depth was ensured to be 6 cm, with no grains pressed together. The soil was then covered to be level with the surface of the cell. 500g of potting soil was weighed into the tray and compacted. The cell tray was placed in the tray, and a suitable amount of tap water was sprayed onto both the cell tray and the tray. The entire setup was then placed in a 30℃ constant-temperature dark incubator. Watering was done daily until germination, and germination status was recorded. After approximately 10 days of constant temperature cultivation (3 days after all seedlings have emerged), the seedling trays were removed from the artificial climate chamber. The soil around the seedling roots was quickly rinsed with running water, and individual plants with significant differences in growth were removed. The plants with uniform growth were photographed, and the mesocotyl length was measured using ImageJ software (https: / / image j.en.softonic.com / ).

[0079] The sources of materials are recorded as follows: Wang W, Mauleon R, Hu Z, Chebotarov D, Tai S, Wu Z, Li M, Zheng T, Fuentes RR, Zhang F, Mansueto L, Copetti D, Sanciangco M, Palis KC, Xu J, Sun C, Fu B, Zhang H, Gao Y, Zhao X, Shen F, Cui X, Yu H, Li Z, Chen M, Detras J,ZhouY,Zhang X,Zhao Y,Kudrna S,Wang C,Li R,Jia B,Lu J,He Z,Naredo MEB,Talag J,Wang X,Li J, Fang

[0080] 3. Correlation Analysis

[0081] The average mesocotyl length of rice from the two genotypes was statistically analyzed, and the results are shown in Table 4. A t-test was performed using the PROC TTEST model in the internationally recognized SAS 9.2 statistical software. The statistical results are shown in Table 5.

[0082] Table 4. Genotyping results of 470 rice varieties

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093] Table 5. Association analysis of mesocotyl length in the Kasp-3-31.8 population IR 145 / IRGC 49311.

[0094]

[0095] The results in Table 5 show that the average mesocotyl length of the CC homozygous rice variety (1.28 cm) was 5.23% shorter than that of the TT homozygous rice variety (1.35 cm), a significant difference at the 0.05 level. Therefore, the genotype at the Kasp-3-31.8 locus can be used to identify the mesocotyl length of rice, with the following criteria: if the rice genotype at the Kasp-3-31.8 locus is TT homozygous, the rice has a longer mesocotyl; if the rice genotype at the Kasp-3-31.8 locus is CC homozygous, the rice has a shorter mesocotyl.

[0096] This invention provides a method for identifying or assisting in the identification of rice mesocotyls, which can effectively distinguish the length of rice mesocotyls corresponding to different genotypes. This method is based on allele competitive specific PCR, and by comparing the amplification products of different rice genotypes, the length of the rice mesocotyl can be accurately identified. Specifically, the mesocotyl length of CC homozygous rice varieties differs significantly from that of TT homozygous rice varieties, indicating that the length of the rice mesocotyl can be identified by detecting the genotype of the test rice based on the Kasp-3-31.8 locus. This method can provide important reference information for rice breeding, helping breeders select rice varieties with excellent mesocotyl lengths and improving breeding efficiency and accuracy. It has significant application value in rice molecular marker-assisted breeding.

[0097] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An application of a molecular marker for identifying the length of the rice mesocotyl, characterized in that, Includes any one of the following: a1)-a3) a1) To determine the length of the mesocotyl of the rice to be tested; a2) Screening for rice varieties with long mesocotyls; a3) Rice breeding with mesocotyl length; The molecular marker is the nucleotide at position 37 on rice chromosome 3, as shown in SEQ ID NO: 1 in the sequence listing, and its nucleotide type is C or T.

2. A method for identifying or assisting in the identification of rice mesocotyl length, characterized in that, Includes the following steps: The nucleotide genotype at position 37 of the genome of the rice to be tested, as shown in SEQ ID NO: 1 in the sequence listing, is detected to determine whether the molecular marker nucleotide type is C or T. Homozygous rice with nucleotide C is CC homozygous rice, and homozygous rice with nucleotide T is TT homozygous rice. The mesocotyl of CC homozygous rice is shorter than that of TT homozygous rice.

3. The method as described in claim 2, characterized in that, Includes the following steps: (1) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using molecular marker detection reagents to obtain PCR amplification products; (2) Detect the fluorescence signal of the PCR amplification product described in step (1) and determine the genotype of the rice to be tested based on the fluorescence signal color; or sequence the PCR amplification product described in step (1) to obtain the genotype of the rice to be tested.

4. The method as described in claim 3, characterized in that, In step (1), the detection reagent for the molecular marker includes a primer set for detecting the molecular marker; The primer set includes upstream primer F1, upstream primer F2, and downstream primer R; The nucleic acid sequence of the upstream primer F1 is the DNA fragment shown in SEQ ID NO:2 from position 22 to 40 from the 5' end; The nucleic acid sequence of the upstream primer F2 is the DNA fragment shown in SEQ ID NO:3 from position 22 to 40 starting from the 5' end; The nucleic acid sequence of the downstream primer R is shown in SEQ ID NO:4; The upstream primer in the primer set is linked to a fluorescent label: The upstream primer F1 is fluorescently labeled with FAM, and the upstream primer F2 is fluorescently labeled with HEX; The FAM fluorescent tag sequence is shown as the DNA fragment from position 1 to 21 of SEQ ID NO: 2 starting from the 5' end; The HEX fluorescent tag sequence is shown as the DNA fragment from position 1 to 21 of SEQ ID NO. 3 starting from the 5' end; In step (1), the PCR amplification includes the following steps: Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the primer set described above to obtain PCR amplification products. The PCR reaction program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ for 1 min, amplification for 10 cycles; 94℃ denaturation for 20 s, 55℃ for 1 min, amplification for 26 more cycles. When the temperature of the PCR amplification product drops below 40°C, the fluorescence value is read by scanning with FAM and HEX beams of an enzyme-linked immunosorbent assay (ELISA) reader. The genotype of the rice sample at position 37, as shown in SEQ ID NO: 1, is determined based on the fluorescence signal color. The FAM fluorescent tag sequence is read at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, while the HEX fluorescent tag sequence is read at an excitation wavelength of 528 nm and an emission wavelength of 560 nm.

5. The method as described in claim 3, characterized in that, In step (2), the principle for determining the genotype of the rice to be tested based on the fluorescence signal color is as follows: If the PCR amplification product shows a blue fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is TT homozygous. If the PCR amplification product shows a red fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is CC homozygous. If the PCR amplification product shows a green fluorescent signal based on molecular markers, then the corresponding genotype of the rice being tested is TC heterozygous.

6. The application of the method as described in any one of claims 2-5 in rice breeding with mesocotyl length.

7. A method for rice breeding, characterized in that, The steps include: crossing a homozygous rice variety whose nucleotide at position 37 of the genome, as shown in SEQ ID NO: 1, is CC homozygous with a homozygous rice variety whose nucleotide at position 37 of the genome, as shown in SEQ ID NO: 1, to obtain the F1 generation; After harvesting F1 generation seeds, the F2 generation seeds are obtained through further propagation. The genotype of the nucleotide at position 37 in the genome, as shown in SEQ ID NO: 1, is identified using the method described in claim 2, resulting in rice with the nucleotide at position 37 in SEQ ID NO: 1 being of the TT type.

Images