A method for breeding transgenic plants with dwarf, increased tillering and lightened leaf color and its application

By regulating the expression of the OsASR5 gene and constructing recombinant plasmids and interference vectors using RNAi technology, the problems of dwarfing, increased tillering, and lighter leaf color in transgenic plants were solved, and excellent plants with fertilizer tolerance and lodging resistance were cultivated.

CN117587029BActive Publication Date: 2026-04-14GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-18
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies lack effective methods for breeding dwarfed, tillering, and lighter-colored transgenic plants, making it difficult to obtain superior plants that are tolerant to fertilizer and resistant to lodging.

Method used

By preparing plant interference vectors that can silence or interfere with the normal expression of the OsASR5 gene, the expression of the OsASR5 gene in transgenic plants can be regulated. RNAi technology can be used to control plant height, tillering, and leaf color. Recombinant plasmids and interference vectors can be constructed to achieve dwarfing, increased tillering, and lighter leaf color.

Benefits of technology

They successfully obtained transgenic plants that were dwarfed, had increased tillering number, and lighter leaf color, providing technical support for targeted plant modification, with significant intervention effects and commercial value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003804215520000061
    Figure BDA0003804215520000061
  • Figure BDA0003804215520000071
    Figure BDA0003804215520000071
  • Figure HDA0003804215530000011
    Figure HDA0003804215530000011
Patent Text Reader

Abstract

The application discloses a method for cultivating transgenic plants with dwarfing, increased tillering and lightened leaf color and application thereof, and is based on preparing a plant interference vector capable of silencing or interfering with normal expression of an OsASR5 gene to regulate expression of the OsASR5 gene in the transgenic plant, so that the transgenic plant is particularly characterized by dwarfing, increased tillering and lightened leaf color, and thus the specified characteristics can be easily obtained. Moreover, the method is simple in operation, remarkable in interference effect and high in success rate, and provides favorable technical support for directional cultivation of the transgenic plant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to a method for cultivating transgenic plants that are dwarfed, have increased tillering, and have lighter leaf color, and its application. Background Technology

[0002] Dwarfism is an important trait in plants. Plant height is controlled by internal genes and influenced by various hormones and external environmental factors. Plant dwarfism is the result of the expression of the main dwarfing gene, and is also affected by modifying and repressing genes. By breeding dwarfing plants and reducing their height, crops not only become more tolerant to fertilizer and lodging, but the plant shape is also altered, which can improve the yield index.

[0003] Tillering (branching) is one of the key factors affecting crop yield. Taking rice as an example, the tillering stage is the most important period for rice vegetative growth, encompassing the differentiation of tiller buds to the formation of young panicles. For most rice varieties, environmental conditions (such as temperature, moisture, and nutrient status) and planting density all influence tillering development. Rice varieties with longer growth cycles generally produce fewer tillers than those with shorter growth cycles. Rice tillers include primary and secondary tillers. Based on tiller grain filling, tillers are further classified into effective tillers and ineffective tillers. The number of effective tillers is one of the important factors determining rice yield.

[0004] Leaves are the main photosynthetic organs of plants, and they have a significant impact on plant growth and all stages of development. Taking rice as an example, leaves are the most important photosynthetic organs, and the strength of photosynthesis in leaves directly affects the yield of rice.

[0005] RNA interference (RNAi) technology uses small double-stranded RNA molecules to efficiently and specifically block the expression of specific genes in vivo and promote mRNA degradation, thereby inducing cells to exhibit a phenotype with specific gene deletion. This technology has been widely used in plant gene function research. Compared with other technologies, RNA interference technology has advantages such as high specificity and high silencing efficiency.

[0006] ASR proteins (Abscisic acid-, stress-, and ripening-induced proteins) possess the basic characteristics of transcription factors and LEA proteins, playing a crucial role in regulating plant growth and development, senescence, fruit ripening, and responses to abiotic stress. First discovered in tomato by Iusem et al. (1993), ASR genes have subsequently been isolated from at least 30 monocotyledonous and dicotyledonous plant species, but are not found in cruciferous plants such as Arabidopsis thaliana. ASR genes constitute a small gene family; for example, one member has been found in grapes, four in brackengraft, seven in sorghum, five in tomatoes, four in pine trees, six in rice, and nine in maize.

[0007] There is a lack of existing technologies to effectively obtain transgenic plants that are dwarfed, have increased tillering, and have lighter leaf color, thereby obtaining superior plants that are tolerant to fertilizer and resistant to lodging. Summary of the Invention

[0008] This invention aims to solve at least one of the technical problems existing in the prior art. To this end, this invention proposes a method for cultivating transgenic plants with dwarfism, increased tillering, and lighter leaf color, and its application. This invention is based on preparing a plant interference vector capable of silencing or interfering with the normal expression of the OsASR5 gene to regulate the expression of the OsASR5 gene in transgenic plants, thereby causing the transgenic plants to exhibit dwarfism, increased tillering, and lighter leaf color, thus easily obtaining the specified characteristics and providing favorable technical support for the targeted cultivation of transgenic plants.

[0009] In a first aspect, the present invention provides the use of a product that regulates the expression level of the OsASR5 gene in at least one of the following (1) to (3);

[0010] (1) Regulating plant height;

[0011] (2) Control plant tillering;

[0012] (3) Adjust the color of the leaves.

[0013] According to a first aspect of the invention, in some embodiments of the invention, the OsASR5 gene is located at position 126 bp to 406 bp of the OsASR5 gene open reading frame.

[0014] In some embodiments of the present invention, the OsASR5 gene is the rice OsASR5 gene sequence (gene number AAX96480.1).

[0015] In some embodiments of the present invention, the nucleotide sequence of the OsASR5 gene is shown in SEQ ID NO: 8.

[0016] In some embodiments of the present invention, the sequence shown in SEQ ID NO: 8 is: 5'-CGGCGGCCAGGACGAGTACGAGAGGTACAAGAAGGAGGAGAAGCAGCACAAGCACAAGCAGCACCTCGGCGAGGCCGGCGCCCTCGCCGCCGGCGCCTTCGCCCTGTATGAGAAGCACGAGGCGAAGAAGGACCCGGAGAACGCGCACAGGCACAAGATCACGGAGGAGATCGCGGCCACGGCGGCGGTCGGCGCCGGCGGCTACGCCTTCCACGAGCACCACGAGAAGAAGAAGGACCACAAGAGCGCCGAGGAGTCCACCGGCGAGAAGAAGCACCACC-3' (SEQ ID NO: 8).

[0017] In some embodiments of the present invention, the sequence shown in SEQ ID NO: 8 is obtained by amplifying the rice OsASR5 gene sequence (gene number AAX96480.1) using the primers described in SEQ ID NO: 1 and SEQ ID NO: 2.

[0018] The amplification system is shown in Table 1 of the instruction manual. Amplification reaction program: 94℃, 3 min; 94℃, 0.5 min, 55℃, 0.5 min, 72℃, 0.5 min, 35 cycles; 72℃, 10 min.

[0019] In some embodiments of the present invention, the inventors constructed a recombinant plasmid (pGEM-OsASR5-1S) to obtain the purified sequence shown in SEQ ID NO: 8.

[0020] In some embodiments of the present invention, the double restriction sites of the recombinant plasmid (pGEM-OsASR5-1S) are BamHI and HindIII.

[0021] In some embodiments of the present invention, the nucleotide sequence of the recombinant plasmid (pGEM-OsASR5-1S) is shown in SEQ ID NO: 3.

[0022] In some embodiments of the present invention, the product contains at least one of the following (1) to (3):

[0023] (1) An expression vector containing the reverse fragment of the sequence shown in SEQ ID NO: 8;

[0024] (2) A transformed product containing the reverse segment of the sequence shown in SEQ ID NO: 8;

[0025] (3) A transformant containing the expression vector described in (1).

[0026] In some embodiments of the present invention, the reverse fragment of the sequence shown in SEQ ID NO: 8 is obtained by amplification using pGEM-OsASR5-1S recombinant plasmid as a template and primers SEQ ID NO: 4 and SEQ ID NO: 5.

[0027] In some embodiments of the present invention, the reverse fragment of the sequence shown in SEQ ID NO: 8 is ligated into the pYLRNAi interference vector. The resulting recombinant interference vector is named pYLRNAi-OsASR5-1S, and its expression cassette is shown in the figure below. Figure 3 As shown.

[0028] In some embodiments of the present invention, the double restriction sites during the ligation of the pYLRNAi-OsASR5-1S recombinant interference vector are Mlu I and Pst I.

[0029] In some embodiments of the present invention, the product has the functions of dwarfing plants, increasing plant tillering, and lightening leaf color.

[0030] In some embodiments of the present invention, the regulation is to silence or reduce the expression level.

[0031] In some embodiments of the present invention, the plant is a monocotyledonous plant.

[0032] In some embodiments of the present invention, the plant is rice.

[0033] In a second aspect, the present invention provides a plant gene interference vector containing a reverse fragment of the sequence shown in SEQ ID NO: 8.

[0034] According to a second aspect of the invention, in some embodiments of the invention, the reverse fragment of the sequence shown in SEQ ID NO: 8 is amplified using pGEM-OsASR5-1S recombinant plasmid as a template and based on SEQ ID NO: 4 and SEQ ID NO: 5 as primers.

[0035] In some embodiments of the present invention, the reverse fragment of the sequence shown in SEQ ID NO: 8 is ligated into the pYLRNAi interference vector. The resulting recombinant interference vector is named pYLRNAi-OsASR5-1S, and its expression cassette is shown in the figure below. Figure 3 As shown.

[0036] In some embodiments of the present invention, the double restriction sites during the ligation of the pYLRNAi-OsASR5-1S recombinant interference vector are Mlu I and Pst I.

[0037] In this invention, the inventors have demonstrated that by introducing the pYLRNAi-OsASR5-1S recombinant interference vector into plants, they can effectively dwarf plant height, significantly promote plant tillering, and lighten leaf color.

[0038] A third aspect of the present invention provides a method for interfering with plant traits, comprising the following steps: infecting plant callus tissue with the plant gene interference vector described in the second aspect of the present invention.

[0039] In some embodiments of the present invention, the culture of the callus tissue is carried out in accordance with conventional technical manuals in the art. Those skilled in the art can make reasonable adjustments according to actual usage needs to obtain healthy and normal callus tissue for use in plant gene interference vector infection.

[0040] According to a third aspect of the invention, in some embodiments of the invention, the infection includes Agrobacterium-mediated transformation, gene gun transformation, electroporation, PEG vector method, and liposome method.

[0041] Of course, those skilled in the art can reasonably select other infection or transformation methods for the introduction of plant gene interference vectors according to actual needs.

[0042] The beneficial effects of this invention are:

[0043] 1. This invention provides a vector for interfering with or regulating the expression of the OsASR5 gene. After transfecting rice, this vector can be used to prepare rice plants that interfere with the expression of the ASR5 gene. By controlling the expression level of this gene through RNAi interference technology, the plant is dwarfed, the number of tillers increases, and the leaf color becomes lighter, thereby effectively achieving targeted modification of the plant.

[0044] 2. The interference technique in this invention is simple, has significant interference effects, and a high success rate. It can easily create new types of ornamental plants (dwarfed, with more tillers and lighter leaf color, mainly used for the cultivation of landscape plants) and agricultural products with new commercial value (improving lodging resistance and pest prevention through dwarfing, more tillers, and lighter leaf color). Therefore, it has extremely important significance in the fields of agriculture and horticulture. Attached Figure Description

[0045] Figure 1 The image shows an agarose gel electrophoresis diagram of the PCR amplification of the OsASR5-1 gene fragment, where M is a standard DNA molecule and 2 is the amplified fragment of the OsASR5-1 gene.

[0046] Figure 2 The enzyme digestion diagram was used to verify the pYLRNAi-OsASR5-1-Ri interference vector during its construction. M is MarkerDL5000, and the size of the fragment obtained by BamHI digestion is approximately 960bp, including the forward and reverse fragments and introns.

[0047] Figure 3 This is a schematic diagram of the expression cassette of the plant interference vector pYLRNAi-OsASR5-1-Ri.

[0048] Figure 4 Agarose gel electrophoresis image showing the PCR identification results of transgenic rice with OsASR5-1 gene interference fragment introduced. In the image, W represents wild type; PI represents pYLRNAi-OsASR5-1-Ri vector; P is positive control; and I1, I2, I3, I4, I5, I6, I7, I8, I9, I10, I11, I12, I13, I14, I15, I16, I17, I18, I19, I20, I21, and I22 represent different transgenic rice samples after being transformed with OsASR5-1 gene interference fragment.

[0049] Figure 5 Southern hybridization (A) and real-time quantitative PCR (B) of four OsASR5-1 interference rice plants are shown. W represents wild-type plants; R1, R2, R3, R4 and R5 represent different transgenic interference rice lines; the letters a, b, c and d above the columns indicate significant differences between different materials (P≤0.05).

[0050] Figure 6 The results of morphological observation of wild-type and OsASR5-1 interference plants after 120 days are shown. WT is wild-type, and R is the transgenic interference rice line. Among them, (A) is the appearance of different rice lines, (B) is the leaf segment of different rice lines, (C) is the plant height of wild-type and OsASR5-1 interference plants after 120 days, and (D) is the statistical data of tiller number of wild-type and OsASR5-1 interference plants after 120 days.

[0051] Figure 7 The data are chlorophyll content statistics (A) and chlorophyll a / b statistics (B) of wild-type and OsASR5-1 interference plants after 83 days, where WT is wild-type; R is the transgenic interference rice line, and the letters a, b and c above the column indicate significant differences between different materials (P≤0.05). Detailed Implementation

[0052] To make the objectives, technical solutions, and effects of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described in this specification are merely for explaining the invention and are not intended to limit the invention.

[0053] Unless otherwise specified, all experimental materials and reagents used are commercially available consumables and reagents.

[0054] In the following embodiments, the rice seed variety used was Zhonghua 11 (84-213), with the approval number: Tianjin Approval Rice 1989016, which is kept at South China Agricultural University.

[0055] In the following examples, the Agrobacterium tumefaciens EHA105 used was purchased from Beijing Tianenze Gene Technology Co., Ltd.

[0056] In the following embodiments, the pYLRNAi interference vector used was kindly provided by Dr. Liu Yaoguang of South China Agricultural University.

[0057] In the following examples, the Escherichia coli DH5a used was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0058] Cloning of the OsASR5-1 gene fragment

[0059] (1) Preparation of rice cDNA template:

[0060] Rice seeds (Zhonghua 11) were disinfected with 70% alcohol for 2 minutes and soaked in water at 28℃ for 1 day. Then, they were germinated at 30℃ for 3 days and sown at 28℃. Seedlings were raised and managed according to the method described by Jiang De'an et al. (Jiang De'an, Rao Lihua, Peng Zuoquan. Some physiological effects of rice on yield formation, Journal of Zhejiang Agricultural University, 13(4):441-444) to obtain rice plants.

[0061] Mature rice leaves were collected, and total RNA was extracted using the Trizol method. The cDNA template was obtained by reverse transcription using the M-MLV reverse transcriptase kit (Promega) and stored at -20℃ for later use.

[0062] (2) Design specific primers for amplifying the OsASR5-1 gene:

[0063] The rice OsASR5 gene sequence (gene ID AAX96480.1) was downloaded from NCBI. DNAMAN software was used to analyze the sequence characteristics, resulting in a highly specific OsASR5-1S gene interference fragment. The primer sequences for this fragment are as follows:

[0064] OsASR5-1S gene fragment amplification upstream primer P1F: 5'-GAGTGGATCCCGGCGGCCAGGACGA-3' (SEQ ID NO:1);

[0065] OsASR5-1S gene fragment amplification upstream primer P1R: 5'-TGGCCAAGCTTGGTGGTGCTTCTTCT-3' (SEQ ID NO:2).

[0066] (3) Constructing a carrier:

[0067] The cDNA template from step (1) was amplified by PCR using the primers shown in SEQ ID NO:1 and SEQ ID NO:2 above.

[0068] The PCR reaction system is shown in Table 1.

[0069] Table 1 PCR reaction system

[0070] Components Dosage <![CDATA[1U·μL -1 KOD-Plus DNA polymerase 1μL 10×buffer 5μL <![CDATA[10mmol·L -1 dNTPs]]> 5μL <![CDATA[25mmol·L -1 MgSO4]]> 2μL <![CDATA[10μmol·L -1 SEQ ID NO:1]]> 1.5μL <![CDATA[10μmol·L -1 SEQ ID NO:2]]> 1.5μL cDNA 2μL <![CDATA[ddH2O]]> Add to 50 μL

[0071] The KOD-Plus-DNA polymerase was purchased from TOYOBO.

[0072] PCR reaction program: 94℃, 3 minutes; 94℃, 0.5 minutes, 55℃, 0.5 minutes, 72℃, 0.5 minutes, 35 cycles; 72℃, 10 minutes.

[0073] The amplified product (OsASR5-1S gene interference fragment) was detected and verified using 0.8% agarose gel electrophoresis.

[0074] The results are as follows Figure 1 As shown.

[0075] The obtained OsASR5-1S gene interference fragment is consistent with the expected fragment length (approximately 400 bp), indicating that the amplification was correct.

[0076] The obtained PCR products were recovered using a DNA gel recovery kit (Qiagen) and then subjected to Taq enzyme-catalyzed reaction to add A to the ends. The Taq enzyme-catalyzed reaction system is shown in Table 2.

[0077] Table 2 Taq enzyme catalytic reaction system

[0078]

[0079]

[0080] Reaction procedure: React at 70℃ for 20 minutes.

[0081] The reaction product (OsASR5-1S gene interference fragment) catalyzed by Taq polymerase was recovered using a PCR product recovery kit. The reaction product was ligated into the pGEM-Teasy vector (Promega) using T4 DNA ligase (TaKaRa). The ligation system is shown in Table 3.

[0082] Table 3 Connection System

[0083] Components Dosage 10×T4 ligase buffer 1μL reaction products 60ng T4 ligase 1μL pGEM-Teasy vector 2μL (10ng) sterile deionized water Add to 10 μL

[0084] Reaction procedure: overnight at 16°C.

[0085] Preparation of competent *E. coli* cells: *E. coli* DH10B bacterial suspension stored at -80℃ was inoculated onto SOB solid medium and incubated overnight at 37℃. A single colony of *E. coli* DH10B was picked and inoculated into 1 mL of SOB liquid medium and cultured on a shaker at 37℃ with shaking at 200 rpm for approximately 6 hours, until OD550 = 0.6-0.8. The cells were collected by centrifugation at 2500 rpm for 10 minutes, washed with pre-chilled 10% glycerol, and centrifuged again to collect the bacteria.

[0086] The ligation product was transformed into *E. coli* using electroporation: The ligation product was dialyzed in 1 / 3 volume TE buffer (composed of 1M NaCl, 10mM Tris-HCl (pH 8.0), and 1mM EDTA) for 30 minutes. Then, 20 μL of the obtained competent *E. coli* cells were transferred to an electrode cuvette (1 mm pore size), and 1 μL of the dialyzed ligation product was added. Electroporation was performed using a MicroPulser (Bio-RAD) instrument. The electroporation parameters were: resistance 200 Ω, 1800 V, 25 μF. The electroporated cells were transferred to 1 mL of SOC liquid medium and cultured at 37°C with shaking at 200 rpm for 1 hour. Spread 100 μL of bacterial culture onto LB solid medium (containing 100 μg / mL Amp (ampicillin)) containing IPTG (isopropyl-β-D-thiogalactoside) and X-gal (substrate of β-galactosidase), and incubate upside down overnight in an incubator at 37°C.

[0087] (4) Screening and purification of pGEM-OsASR5-1S recombinant plasmid:

[0088] Take the cultured plate. Colonies with blue spots do not contain the inserted fragment. Pick colonies with white spots (positive, i.e., recombinant bacteria) for colony PCR verification.

[0089] Selected positive colonies verified by PCR and inoculated into 2 mL of LB broth containing 100 μg / mL ampicillin. Incubate overnight at 37°C with shaking at 200 rpm. Extract plasmids from 2 mL of the bacterial culture using a plasmid DNA purification kit (Qiagen) and store at 4°C for later use. Perform double digestion of the obtained plasmid with BamHI / HindIII, and analyze the size of the digested fragments using electrophoresis to further identify positive clones.

[0090] The purified recombinant plasmid obtained was named pGEM-OsASR5-1S and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequence is as follows:

[0091] 5'-TGAAATAGAGGAAGCAATAACATCCACAACAAAAAGAGTGGATCC CGGCGGCCAGGACGAGTACG AGAGGTACAAGAAGGAGGAGAAGCAGCACAAGCACAAGCAGCACCTCGGCGAGGCCGGCGCCCTCGCCCGCGGCGC CTTCGCCCTGTATGAGAAGCACGAGGCGAAGAAGGACCCGGAGAACGCGCACAGGCACAAGATCACGGAGGAGATC GCGGCCACGGCGGCGGTCGGCGCCGGCGGCTACGCCTTCCACGAGCACCACGAGAAGAAGAAGGACCACAAGAGCG CCGAGGAGTCCCACCGGCGAGAAGAAGCACCACC TTGGCCAGATTAAGGTCCTCAAGACACAAATGCCTG-3' (SEQ ID NO: 3).

[0092] The underlined portion represents the target gene fragment, OsASR5-1. This OsASR5-1 gene fragment was only detected and found to be located between 126 bp and 406 bp within the open reading frame of the OsASR5 gene.

[0093] Construction of the plant interference vector (pYLRNAi-OsASR5-1-Ri) for the OsASR5-1 gene

[0094] The recombinant bacteria obtained in the above examples were cultured and propagated by shaking, and the pGEM-OsASR5-1S recombinant plasmid was extracted. The pGEM-OsASR5-1S recombinant plasmid was digested with restriction endonucleases BamHI and HindIII, purified and recovered to obtain the OsASR5-1S gene interference fragment.

[0095] The pYLRNAi interference vector was digested with restriction endonucleases BamHI and HindIII, and the resulting large vector fragment was recovered. This large vector fragment was ligated with the OsASR5-1S gene interference fragment (ligation method as described in the previous example), and the constructed recombinant interference vector was named pYLRNAi-OsASR5-1S. Top10F competent cells were transformed using pYLRNAi-OsASR5-1S, following the method described in the previous example.

[0096] Positive clones were screened, and the pYLRNAi-OsASR5-1S plasmid was extracted from the positive clones. Using the pYLRNAi-OsASR5-1S plasmid from the positive clones as a template, the reverse fragment was specifically amplified using universal primers MluI-F and Pst IR.

[0097] The sequence of MluI-F is 5'-CACCCTGACGCGTGGTGTTACTTCTGAAGAGG-3' (SEQ ID NO: 4); the sequence of PstI-R is 5'-ACTAGAACTGCAGCCTCAGATCTACCATGGTCG-3' (SEQ ID NO: 5).

[0098] After recovering the reverse fragment, it was double-digested with Mlu I and Pst I. Simultaneously, the pYLRNAi-OsASR5-1S plasmid was double-digested with Mlu I and Pst I. The digested target fragment was recovered, and the two were ligated according to the method in the above embodiment before being transformed into E. coli.

[0099] The ligation status of the recombinant plasmid was verified using BamHI enzyme digestion.

[0100] The results are as follows Figure 2 As shown.

[0101] BamHI digestion revealed a fragment size of approximately 960 bp (forward, reverse, and intron-containing fragments), indicating successful construction of the interference vector. The resulting vector was named pYLRNAi-OsASR5-1-Ri (see schematic diagram of the expression cassette of the plant interference vector pYLRNAi-OsASR5-1-Ri). Figure 3 (As shown).

[0102] Construction and Molecular Detection Verification of Transgenic Rice

[0103] (1) The emergence of genetically modified rice:

[0104] The specific steps for introducing pYLRNAi-OsASR5-1-Ri into Agrobacterium tumefaciens EHA105 are as follows:

[0105] Competent cells were obtained according to the standard technical manual in this field (J. Sambrook, DW. Russell, Sambrook, et al. Molecular Cloning: A Laboratory Manual (3rd Edition) [M]. Science Press, 2002.): Agrobacterium tumefaciens EHA105 was streaked onto MYB plates and cultured at 28°C for 48 hours. Single colonies were picked and inoculated into 50 mL of SOC liquid medium and cultured overnight at 28°C. 0.5 mL of the bacterial culture was transferred to 500 mL of fresh SOC liquid medium and cultured at 28°C for 6-8 hours until the OD600 reached approximately 0.6. The culture was then cooled on ice for 10 minutes. The bacterial culture was transferred to sterile 200 mL centrifuge tubes, equilibrated, and centrifuged at 4°C and 4000 rpm for 10 minutes. The bacterial cells were collected, and the SOC liquid medium was removed. Invert the cells onto a paper towel to drain excess water. Add 50 mL of 10% glycerol and shake on ice to suspend the cells. Centrifuge at 4000 rpm for 15 min at 4°C. Collect the cells, discard the 10% glycerol, and repeat the washing process once. Add 2 mL of 10% glycerol to suspend the cells again. Aliquot the cells (20-25 μL / tube), freeze quickly in liquid nitrogen, and obtain Agrobacterium tumefaciens EHA105 competent cells. Store at -80°C.

[0106] Thaw on ice, and pre-cool the electroporation cuvette (0.2 cm inner diameter) on ice. In a clean bench, add 1.5 μL of pYLRNAi-OsASR5-1-Ri plasmid (20 ng / μL) to 20 μL of thawed competent cells, gently tap the tube wall to mix, incubate on ice for 1 minute, then transfer to the electroporation cuvette and place it in the electrode compartment of an electroporator (MicroPulser, Bio-RAD). Select the Agr program and perform electroporation. After electroporation, quickly pour 1 ml of YEB liquid medium into the electroporation cuvette in the clean bench, then transfer it to a shaker tube using a pipette. Incubate at 28°C with gentle shaking for 2 hours. Pipette 0.3 mL of the bacterial culture onto a YEB plate (containing 35 mg / L chloramphenicol and 50 mg / L kanamycin). Incubate upside down at 28°C for 48 hours.

[0107] Single colonies were picked from the plate for colony PCR detection. PCR-positive colonies were transferred to 3 mL of YEB liquid medium (containing 35 mg / L chloramphenicol and 50 mg / L kanamycin) and incubated at 28°C with shaking for 40 hours. 2 mL of the bacterial culture was used to extract plasmids using the alkaline lysis method. Restriction endonucleases BamHI and HindIII were used for digestion to confirm the presence of the plant interference vector pYLRNAi-OsASR5-1-Ri in the positive clones. 0.8 mL of the confirmed Agrobacterium culture was mixed with 0.2 mL of 80% glycerol and stored at -80°C for later use (Agrobacterium EHA105 stock solution containing the expression vector pYLRNAi-OsASR5-1-Ri).

[0108] Select plump, healthy, mature seeds of Zhonghua 11, remove the husk, soak in 70% alcohol for 1 minute, wash once with distilled water, and then seal with 0.1% mercuric chloride (HgCl solution) for 15 minutes, shaking continuously on a shaker. Then, in a clean bench, discard the mercuric chloride, wash 4-5 times with sterile distilled water, and air dry on three sheets of sterile filter paper. Finally, evenly place the sterilized seeds on NB induction medium and induce callus tissue at 25℃ in the dark. Incubate the induced seeds in the dark for approximately 15-25 days. Once pale yellow granular callus appears, transfer the callus tissue to a subculture medium to continue inducing callus formation.

[0109] Streaking Agrobacterium EHA105 stock solution containing the expression vector pYLRNAi-OsASR5-1-Ri onto YEB plates (containing 35 mg / L chloramphenicol and 50 mg / L kanamycin) and incubating at 28°C. Pick well-isolated single colonies and inoculate them into 2 mL of YEB liquid medium (containing 35 mg / L chloramphenicol and 50 mg / L kanamycin), and incubate in the dark with shaking at 28°C for 24-48 hours. Take 20-50 μL of the bacterial culture and spread it onto YEB plates containing the same antibiotics, and incubate upside down in the dark at 28°C for 24-36 hours. Scrape off newly grown Agrobacterium and resuspend and dilute it with MS liquid medium to achieve an OD600 of 0.06–0.08.

[0110] Inside a clean bench, pre-dried callus tissue and Agrobacterium infection solution were mixed (ensuring the callus tissue was submerged in the infection solution). Acetyleugenol was then added to a final concentration of 100 μM. The mixture was then inoculated on a shaker at 150 rpm in the dark at 28°C for 20 min. The infection solution was poured out, and the callus tissue was placed on a small petri dish with multiple layers of sterile filter paper to dry for approximately 5-10 min. The callus tissue was then transferred to a large petri dish with three layers of sterile filter paper and dried under a fan for approximately 1.5-2 h. The callus tissue was then inoculated onto a solid co-culture medium with a new sterile filter paper and dried under a fan for 2-3 h. After drying, the callus tissue was further dried under a fan for 0.5-1 h, then inoculated onto selection medium, sealed, and incubated in the dark at 25°C for 2 weeks for selection. A total of two selections were performed.

[0111] Select healthy, resistant callus tissues and inoculate them into predifferentiation medium (NB medium + 0.5 g / L L-glutamine + 0.5 g / L L-proline + 0.3 g / L acid-hydrolyzed casein + 30 g / L sucrose + 20 g / L D-sorbitol + 1 mg / L NAA + 5 mg / L 6-BA + 2.5 mg / L CuSO4·5H2O + 5 mg / L ABA (abscisic acid) + 50 mg / L hygromycin B + 200 mg / L cephalosporin + 200 mg / L carbenicillin + 10 g / L agar powder, pH 5.8). Culture at 25°C under alternating light and dark conditions until new callus grows; predifferentiation takes approximately 3-4 weeks. Transfer callus tissues with green spots to differentiation medium for further differentiation and seedling emergence. When the differentiated seedlings reach 3-5cm in length, transfer them from the differentiation medium to a rooting and seedling-strengthening medium (MS plant salt mixture (containing vitamins) 2.37g, acid-hydrolyzed casein 1g, 1mg / mL NAA 0.5ml, sucrose 15g, pH=5.8, prepared by adding 5g of Agar before high-temperature and high-pressure sterilization (121℃, 15min), and adding 1mL of carbenicillin (Carb 250mg / mL) after cooling to about 50℃ after sterilization) in 100mL Erlenmeyer flasks. Culture at 25℃ with alternating light and dark conditions for 3-4 weeks until new roots emerge. If the seedlings grow well and new roots develop rapidly, they can be transplanted earlier to harden them off. When new roots have grown from the seedlings, remove them from the medium, rinse the roots thoroughly, and transplant them individually into pots. Culture in Kimura B nutrient solution under natural light conditions for 2-3 weeks. Finally, transplant them into soil and cultivate them under natural conditions outdoors in a greenhouse.

[0112] (2) PCR detection verification of transgenic rice:

[0113] A rapid micro-extraction method was used to extract DNA from transgenic rice: A leaf sample (about the size of a 1.5 mL centrifuge tube cap) was placed in a 1.5 mL centrifuge tube, and 400 μL of DNA extraction buffer (200 mM Tris-HCl (pH 8.0), 250 mM NaCl, 25 mM EDTA, 0.5% SDS) preheated to 80 °C was added. The mixture was thoroughly ground with a small mortar and pestle, incubated in a 70 °C water bath for 10 min, and then placed on ice for 2 min. The mixture was centrifuged at 13000 rpm for 1 min. 300 μL of the supernatant was collected, and an equal volume of isopropanol was added. The mixture was mixed and allowed to stand at room temperature for 5 min. The mixture was then centrifuged at 13000 rpm for 2 min, and the supernatant was discarded. The DNA precipitate was air-dried and dissolved in 50 μL of TE buffer (1 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA) and stored at -20 °C.

[0114] Since the vector pYLRNAi that infects plants also carries the homomycin (HPT) resistance gene in its left and right boundary regions, primers HyF: 5'-CGAAATTGCCGTCAACCAAGCTCT-3' (SEQ ID NO: 6) and HyR: 5'-CAGCGTCTCCGACCTGATGCAGCT-3' (SEQ ID NO: 7), which can specifically recognize this gene, are used to detect whether the target gene has been successfully transferred into the plant genome.

[0115] The PCR system used for detection is shown in Table 4. The extracted DNA was used as a template, and the pYLRNAi-OsASR5-1-Ri recombinant plasmid was used as a positive control (the amount of pYLRNAi-OsASR5-1-Ri plasmid used in the positive control was 20 ng).

[0116] Table 4. PCR system used for detection

[0117] Components Dosage Taq DNA polymerase 0.1μL 10×PCR buffer 2μL 10mM dNTPs 1.6μL DNA template 1μL 10μM HyF 0.5μL 10μM HyR 0.5μL <![CDATA[ddH2O]]> Add to 20μL

[0118] PCR reaction program: 94℃, 2 min; 94℃, 0.5 min, 57℃, 0.5 min, 72℃, 30 s, 35 cycles; 72℃, 5 min. PCR products were detected by 1% agarose gel electrophoresis.

[0119] Southern hybridization of genetically modified rice

[0120] Take 1g of the transgenic rice tender leaves from the above examples, grind them into powder in liquid nitrogen, transfer to a 50mL centrifuge tube, and immediately add 6mL of 1.5×CTAB extraction buffer (1.5% CTAB, 75mM Tris-HCl (pH 8.0), 1M NaCl, 15mM EDTA) preheated to 70℃. Vortex for 10 seconds to mix. Incubate at 70℃ for 1 hour, mixing intermittently. After the water bath, add 5mL of chloroform, tighten the cap, and mix by inverting for 10 minutes. Centrifuge at 5000rpm for 15 minutes. Carefully pipette the supernatant into a 50mL centrifuge tube using a 1mL pipette tip with the tip cut off, and record the volume. Add 1 / 10 volume of 10% CTAB solution and shake well. Add 4 / 5 volume of chloroform and mix by inverting for 10 minutes. Centrifuge at 5000rpm for 15 minutes. Carefully pipette the supernatant into a 50 mL centrifuge tube using a 1 mL pipette tip with the tip cut off, and record the volume. Add an equal volume of precipitation buffer (1% CTAB, 50 mM Tris-HCl (pH 8.0), 10 mM EDTA), gently invert to mix, and incubate at room temperature for 15 min (or in a 55°C water bath for 10 min) to precipitate the DNA. Centrifuge at 5000 rpm for 10 min, carefully discard the supernatant, and then centrifuge at 6000 rpm for 1 min, aspirating the supernatant completely with a pipette. Add 2 mL of high-salt TE buffer (1 M NaCl, 10 mM Tris-HCl (pH 8.0), 1 mM EDTA) and 5 μL of 10 mg / mL RNase (prepared with 10 mM Tris-HCl pH 7.5 and 15 mM NaCl solution, and inactivated by incubating at 100°C for 15 min). Gently shake in a 55°C shaker until the precipitate is completely dissolved (30-40 min). Add 2 volumes of anhydrous ethanol and gently invert to mix. Use a pipette tip to pick out the flocculent DNA, rinse in 70% ethanol, and then transfer to a 1.5 mL centrifuge tube. Centrifuge briefly, discard the supernatant, and air-dry the precipitate appropriately. Dissolve the precipitate in 0.1–0.2 mL of TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA). Take 2 μL of the 10-fold diluted DNA solution and perform 0.8% agarose gel electrophoresis to assess DNA quality, measuring OD260 nm and OD280 nm to determine DNA purity and concentration.

[0121] DNA digestion and electrophoresis can be performed according to the instructions of DIG High Prime DNA Labeling and Detection Starter Kit II (Roche). After electrophoresis, the gel is briefly rinsed, denatured, and neutralized. Then, DNA is transferred to a nylon membrane HybondN+ (Amersham) using a 20×SSC capillary transfer method. The membrane is placed on filter paper moistened with 20×SSC and subjected to UV cross-linking at 800 s, twice. After a brief rinse with double-distilled water, the membrane is air-dried, wrapped in plastic wrap, labeled, and stored at 4°C for later use.

[0122] Using the primers HyF and HyR, the pYLRNAi-OsASR5-1-Ri recombinant plasmid was used as a template to amplify a partial sequence of the hygromycin gene. The PCR product was purified and recovered using a kit (refer to the instruction manual) and used as a probe template for hybridization, followed by electrophoresis quantification. The probe was labeled with DIG-High Prime (1 μg template DNA and autoclaved double-distilled water were added to the reaction tube, bringing the final volume to 16 μL. The DNA was denatured by boiling in a water bath for 10 min, and then quickly immersed in an ice-water mixture. 4 μL of DIG-High Prime was added to the denatured DNA, mixed, and then centrifuged briefly. The reaction was incubated overnight at 37°C, and then terminated by heating at 65°C for 10 min).

[0123] Transgenic interference rice was detected by PCR (using primer pairs HyF and HyR). Positive plants amplified a specific band of 500 bp, which was consistent with the size of the specific band amplified using the plant expression vector pYLRNAi-OsASR5-1-Ri (positive control) as a template. Wild-type control plants could not amplify this specific band. Figure 4 This demonstrates that the OsASR5-1 interference fragment has been introduced into transgenic rice.

[0124] The membrane prepared in the above examples was then placed on Whatman No. 3 qualitative filter paper that had been impregnated with 10×SSC. After UV crosslinking, the membrane was briefly rinsed in double-distilled water. An appropriate volume of hybridization buffer (10 mL / 100 cm³) was then added. 2 Preheat the filter membrane to the hybridization temperature (37-42℃). Place the NC membrane in the hybridization buffer and pre-hybridize in a hybridization oven for 1 hour. Place the prepared probe in a boiling water bath for 5 minutes, then quickly cool it in an ice-water mixture. Add the denatured digoxigenin-labeled probe to the preheated digoxigenin hybridization buffer (per 100 cm³). 2Add the membrane to 3.5 mL of hybridization buffer and mix thoroughly to obtain a probe hybridization solution mixture. Pour out the pre-hybridization solution, add the probe hybridization solution mixture, and incubate overnight in a hybridization oven at 42 °C. Wash twice with 2×SSC and 0.1% SDS, shaking continuously for 5 min each time, at 15-20 °C. Incubate in 80 mL of blocking solution for 45 min, incubate in 20 mL of antibody solution for 30 min, wash twice with 100 mL of washing buffer for 15 min each time, and equilibrate in 20 mL of detection buffer for 2-5 min. Place the membrane flat on plastic wrap, evenly add 500 μL of CSPD chromogenic solution, cover with another layer of plastic wrap, gently spread the chromogenic solution from the inside out, squeeze out excess chromogenic solution, and absorb with paper. Place the prepared membrane in a dark room for 5 min, then place it in 37 °C in the dark for 1 h, and scan with imaging software for imaging.

[0125] Southern hybridization results showed that no specific hybridization signal for the HPT gene was observed in wild-type rice, while the transgenic interference rice plants did exhibit a specific hybridization signal for the HPT gene, indicating that the OsASR5-1 interference fragment had been integrated into the genome of the transgenic interference rice. Figure 5 A). Real-time quantitative PCR was used to further detect the interference of the OsASR5-1 gene. The results showed that the expression level of the OsASR5-1 gene in the transgenic rice with interference was significantly lower than that in wild-type rice plants, indicating that the interference was successful. Figure 5 B).

[0126] Morphological analysis of transgenic rice

[0127] (1) Statistics on height and number of tillers:

[0128] When the genetically modified rice grows to 120 days, the length from the root to the longest leaf when it is upright (to the leaf) is measured as the plant height, and the number of tillers is counted.

[0129] The results are as follows Figure 6 As shown.

[0130] Measurements were taken from 25 wild-type and 25 transgenic interference plants, and the average values ​​were calculated. It was found that decreased OsASR5-1 expression dwarfed rice and increased the number of tillers.

[0131] (2) Chlorophyll determination:

[0132] Take fresh leaves from genetically modified rice, wipe the surface clean, chop (remove the midrib), and mix well. Weigh 0.2g of the chopped fresh sample into three portions, place each portion in a mortar, add a small amount of quartz sand and calcium carbonate powder, and 2-3mL of 95% ethanol, grind into a homogeneous paste, then add 10mL of ethanol and continue grinding until the tissue turns white. Let stand for 3-5 minutes. Take a filter paper, place it in a funnel, moisten it with ethanol, and pour the extract into the funnel along a glass rod. Filter into a 25mL brown volumetric flask. Rinse the mortar, rod, and residue several times with a small amount of ethanol, and finally pour the rinsing and residue into the funnel. Use a dropper to draw ethanol to wash all the chloroplast pigments on the filter paper into the volumetric flask. Continue until there is no green color in the filter paper and residue. Finally, make up to 25mL with ethanol and shake well. Pour the chloroplast pigment extract into a cuvette with a 1cm optical diameter. Using 95% ethanol as a blank, absorbance was measured at wavelengths of 665 nm and 649 nm.

[0133] The results are as follows Figure 7 As shown.

[0134] Decreased expression of OsASR5-1 stunted the chlorophyll content and chlorophyll a / b ratio in rice.

[0135] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of products that silence or reduce the expression level of the OsASR5 gene in dwarfing plants or increasing plant tillering, characterized in that, The product contains at least one of the following (1) to (3): (1) An expression vector containing the reverse fragment of the sequence shown in SEQ ID NO: 8; (2) A transformed product containing the reverse segment of the sequence shown in SEQ ID NO: 8; (3) A transformant containing the expression vector described in (1); The plant in question is rice.

2. The application according to claim 1, characterized in that, The product has the effects of dwarfing plants, increasing plant tillering, and lightening leaf color.