Use of imidazole propionic acid in the preparation of a modeling agent for inducing an animal model of ulcerative colitis

Abstract

The present application relates to the use of imidazole propionic acid in the preparation of a model agent for inducing an animal model of ulcerative colitis.

Description

[0001] This application is a divisional application of application number 2022103056198, filed on March 25, 2022, entitled "Application of imidazole propionic acid as a biomarker for predicting ulcerative colitis and a complete set of devices". Technical Field

[0002] This invention relates to the field of diagnostics, and more specifically to the use of imidazole propionic acid in the preparation of a modeling agent for inducing animal models of ulcerative colitis. Background Technology

[0003] Ulcerative colitis (UC) is a chronic inflammatory disease limited to the mucosa and submucosa of the colon and rectum. Its main symptoms include abdominal pain, diarrhea, rectal bleeding, fever, and weight loss. It is characterized by a long course and recurrent, difficult-to-cure symptoms. Long-term UC is a risk factor for colon cancer.

[0004] The human gut is home to a large number of microorganisms that participate in the metabolism and absorption of nutrients such as amino acids from food. Small molecules produced by their metabolism are absorbed into the host body, interacting with various signaling pathways and affecting the homeostasis of intestinal physiology. Histidine, an essential amino acid abundant in meat, is digested and metabolized by the rich gut bacteria in the large intestine to produce a unique gut metabolite—imidazolepropionate (IMP). Reports have indicated that elevated levels of imidazolepropionate in the blood are closely related to the occurrence of diet-induced metabolic diseases (e.g., see Non-Patent Literature 1). However, no studies have yet reported the impact of imidazolepropionate on the occurrence and development of ulcerative colitis (UC).

[0005] Existing technical documents

[0006] Non-patent literature 1: Koh, A., et al., Microbially Produced Imidazole Propionate Impairs Insulin Signaling through mTORC1. Cell, 2018.

[0007] 175(4):p.947-961. Summary of the Invention

[0008] To address the aforementioned issues, the applicant conducted in-depth research. The results showed that animal experiments confirmed that imidazole propionic acid can cause colitis symptoms in mice, such as weight loss, increased disease activity index (DAI), increased expression of inflammatory factors, mucosal tissue damage, and increased intestinal barrier permeability. This suggests that increased IMP levels may be a risk factor for ulcerative colitis, providing a scientific basis for developing IMP as an early diagnostic marker for UC, so that early intervention and treatment can be carried out.

[0009] This invention provides the following aspects:

[0010] 1. Application of imidazole propionic acid in the preparation of modeling agents for inducing animal models of ulcerative colitis.

[0011] 2. The application according to item 1 above, wherein the animal is a mouse.

[0012] 3. The application according to item 1 or 2 above, wherein the dosage of the imidazole propionic acid is 100 mg / kg animal.

[0013] 4. The application according to item 1 or 2 above, wherein the administration method is rectal administration. Attached Figure Description

[0014] Figures 1A to 1E This is a graph showing the effect of IMP on the colon of C57BL / 6 mice. Among them, Figure 1A The image shows the effect of IMP treatment on mouse body weight and DAI (disease activity index); Figure 1B This shows the effect of IMP treatment on colonic permeability; Figure 1C This shows the effect of IMP treatment on the colonic mucosal structure; Figure 1D This shows the changes in colonic tight junction protein expression after IMP treatment; Figure 1E The image shows changes in the expression of inflammatory factors in colon tissue after IMP treatment. * This indicates that compared with the normal group, p < 0.05; ** This indicates that compared with the normal group, p < 0.01; *** This indicates that compared with the normal group, p < 0.001. Detailed Implementation

[0015] The technical solution and beneficial effects of the present invention will be further explained below with reference to specific embodiments.

[0016] Effects of IMP on the colon of C57BL / 6 mice

[0017] (i) Animal husbandry and handling

[0018] Twenty healthy male C57BL / 6 mice (Beijing Vital River Laboratory Animal Technology Co., Ltd.) were acclimatized for one week and then randomly divided into a normal control group and an IMP administration group, with 10 mice in each group. Mice in the IMP administration group were anesthetized by isoflurane inhalation. A paraffin-lubricated infusion needle was inserted approximately 2-3 cm into the anus, and 100 μl of IMP (100 mg / kg) solution was slowly injected. The medication was administered twice daily, morning and evening, for 5 days. On day 6, the mice were given FD-4 (600 mg / kg) by gavage, protected from light. Four hours later, blood was collected from the inner canthus of the eye, and the mice were euthanized by cervical dislocation. The colon was dissected, rinsed with physiological saline, flash-frozen in liquid nitrogen, and stored at -80°C.

[0019] During the experiment, the weight of the mice was measured and recorded daily, and the activity and mental state of the mice were observed. The fecal occult blood and fecal morphology of the mice were recorded, and the disease activity index of the mice was calculated. The mouse serum was fluorescence measured using SpectraMax M5 at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. The colon tissue 1 cm from the cecum was taken, washed with physiological saline, fixed in 4% paraformaldehyde, embedded in paraffin, and H&E staining and AB-PAS staining were performed according to the method reported in reference [1].

[0020] All animal experiments were approved by the Science and Technology Committee and the Animal Use and Care Committee of Tianjin University of Traditional Chinese Medicine.

[0021] References [1]: Y Zhao, Luan H, Gao H, et al. Gegen Qinliandecoctionmaintains colonic mucosal homeostasis in acute / chronic ulcerativecolitis viabidirectionally modulating dysregulated Notch signaling[J]. Phytomedicine, 2020, 68: 153182.

[0022] (ii) q-PCR detection of inflammatory factor expression in colon tissue

[0023] Following the methods reported in references [2,3], inflammatory factors in colon tissue were detected. Specifically, 30 mg of colon tissue was weighed, and 1 ml of TRIzol reagent (Beijing TransGen Biotech Co., Ltd.) was added to extract total RNA. The RNA concentration was measured using NanoDrop 2000. cDNA was synthesized by reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Kangwei Century Biotechnology Co., Ltd.). PCR amplification was performed using the SYBR Green PCRMaster Mix kit (Kangwei Century Biotechnology Co., Ltd.) and the Applied Biosystems 7500 Real-time PCR System, with GAPDH as an internal control.

[0024] The primer sequences used are

[0025] NF-κB: Forward CCTCTCTCGTCTTCCTCCAC; Reverse GTTGCGGAAGGATGTCTCC;

[0026] iNOS:Forward GGGTCACAACTTTACAGGGAGT; Reverse GAGTGAACAAGACCCAAGCG;

[0027] IL6:Forward GTCCTTCCTACCCCAATTTCCA; Reverse TAACGCACTAGGTTTGCCGA;

[0028] GAPDH: Forward GGTGAAGGTCGGTGTGAACG; Reverse CTCGCTCCTGGAAGATGGTG.

[0029] The reaction conditions were: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 15 s, 60℃ annealing for 60 s, and 72℃ extension for 5 min, for a total of 40 cycles. Application 2 -ΔΔ The relative abundance of each gene was calculated using the CT method, with n=6 for each experimental group.

[0030] Reference [2]: Vivinus-Nébot M, Frin-Mathy G, Bzioueche H et al. Functionalbowel symptoms in quiescent inflammatory bowel diseases: role of epithelialbarrier disruption and low-grade inflammation. [J]. Gut, 2014, 63:744-52.

[0031] Reference [3]: Gu Guangli, Lv Xiaodan, Liu Gengfeng et al. Tnfaip6 Secretedby Bone Marrow-Derived Mesenchymal Stem Cells Attenuates TNBS-Induced Colitis by Modulating Follicular Helper T Cells and Follicular Regulatory T CellsBalance in Mice.[J].Front Pharmacol, 2021,12:734040.

[0032] (iii) Western blot detection of tight junction protein expression in colon tissue

[0033] Referring to the method reported in reference [4], tight junction proteins in colon tissue were detected. The specific method was as follows: 30 mg of colon tissue was weighed, 300 μl of RIPA protein lysis buffer was added, and the protein was extracted. The protein content of the sample was detected by BCA (Bicinchoninic Acid) protein quantification method. SDS-PAGE electrophoresis was performed according to the predetermined program (80 V, 50 min; 110 V, 50 min). After electrophoresis, the protein was transferred to a PVDF membrane. After blocking with 5% skim milk powder, the primary antibody was incubated overnight at 4 °C (Occludin 1:5000; ZO-11:1000; β-actin 1:1000). After incubation with secondary antibody (HRP goat anti-rabbit polyclonal antibody 1:10000) for 1 h, the expression of the target protein was detected by chemiluminescence method.

[0034] Reference [4]: ​​Yang Mingyue, Jia Wenxiu, Wang Dong et al. Effects and Mechanism of Constitutive TL1A Expression on Intestinal Mucosal Barrier in DSS-Induced Colitis. [J]. Dig Dis Sci, 2019, 64: 1844-1856.

[0035] Statistical processing

[0036] The experimental results were analyzed using SPSS 20.0 statistical software. Quantitative data were expressed as mean ± standard deviation (X ± SEM). Independent samples t-tests were used for sample comparisons, and a p-value less than 0.05 was considered to indicate a significant difference between samples.

[0037] Experimental results

[0038] Figures 1A to 1E The results showed that IMP treatment induced colitis-like symptoms in mice, including weight loss, increased DAI index, increased colonic permeability, and damage to the intestinal mucosal structure accompanied by neutrophil infiltration and goblet cell reduction. Furthermore, IMP significantly reduced the levels of tight junction proteins (Occludin, ZO-1) in colonic tissue and significantly increased the expression of inflammatory factors NF-κB, iNOS, and IL6. Animal experiments indicate that IMP can induce colonic inflammation and intestinal barrier damage, serving as an early diagnostic marker for ulcerative colitis. Moreover, animal experiments also suggest that IMP can be used as a modeling agent for ulcerative colitis animal models.

[0039] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other modifications may be made without exceeding the technical solutions described in the claims. It is understood that the above embodiments are merely exemplary embodiments used to illustrate the principles of this disclosure; however, this disclosure is not limited thereto. For those skilled in the art, various modifications and improvements can be made without departing from the spirit and substance of this disclosure, and these modifications and improvements are also considered to be within the scope of protection of this disclosure.

Claims

1. The application of imidazole propionic acid in the preparation of modeling agents for inducing animal models of ulcerative colitis, wherein, Imidazole propionate treatment induced weight loss, increased disease activity index (DAI), increased colonic permeability, and damage to the intestinal mucosal structure with neutrophil infiltration and goblet cell reduction in the animals. Furthermore, imidazole propionate treatment led to a decrease in the tight junction proteins Occludin and ZO-1 in the colonic tissue, and an increase in the expression of inflammatory factors NF-κB, iNOS, and IL-6. The animal in question is a mouse.

2. The application according to claim 1, wherein, The dosage of imidazole propionic acid is 100 mg / kg animal.

3. The application according to claim 1, wherein, The administration method is rectal administration.

Images