A method for preparing and raising sterile black soldier fly larvae

Abstract

The application discloses a preparation and feeding method of sterile black soldier fly larvae, and comprises the following steps: step 1, preparation of feed; step 2, self-made egg block sterilization device, the device comprises a hollow circular tube, a filter screen is bound to one end of the circular tube, and the pore size of the filter screen is smaller than that of the black soldier fly egg block; the device is sterilized; step 3, the egg block is picked into the device and then immersed in a beaker containing alcohol for sterilization; step 4, the device containing the egg block after sterilization in step 3 is transferred into a beaker containing sodium hypochlorite solution for immersion treatment; step 5, the device containing the egg block after sterilization in step 4 is transferred into a beaker containing new alcohol again for immersion treatment, and then the egg block is washed with sterile water, and the egg block and the filter screen are all transferred into a conical flask containing the feed and sterilized in step 1 for incubation and closed culture. The self-made device can disperse the egg block with hundreds of eggs in one cluster during operation, and more sterile black soldier fly larvae can be produced.

Description

Technical Field

[0001] This invention relates to the field of laboratory animal science, specifically to a method for preparing and raising sterile black soldier fly larvae. Background Technology

[0002] There are two methods for producing sterile insects: one is to feed antibiotics, and the other is to disinfect the egg masses. Feeding antibiotics to produce sterile insects can easily affect the growth and metabolism of black soldier flies, potentially causing harmful delays in development and infertility. Furthermore, it may not completely eliminate microorganisms. Therefore, feeding antibiotics is not the optimal method for cultivating sterile black soldier flies. The main method for disinfecting black soldier fly egg masses is to wash them three times with 70% alcohol, followed by three washes with sterile water (cited from Gold M, Binggeli M, Kurt F, et al. Novel experimental methods for the investigation of Hermetia illucens (Diptera:Stratiomyidae) larvae[J]. Journal of Insect Science, 2020, 20(3):21). Based on this, Gold M et al. conducted experiments and found that washing with 70% alcohol for 2 minutes, followed by washing with 0.6% sodium hypochlorite for 2 minutes, and then repeating the above steps once more, followed by rinsing three times with sterile water, could produce sterile black soldier fly eggs. High-energy electron beam sterilization of the feed ensured the hatching and growth of sterile black soldier fly larvae. However, the sterilization process for black soldier fly egg masses is cumbersome, and the use of 2ml Eppendorf tubes as a carrier during sterilization makes it difficult to ensure egg mass separation when preparing large quantities of sterile black soldier flies, and the operation is also overly complicated. Furthermore, high-energy electron beam sterilization of the feed for sterile black soldier flies is not a common sterilization method, making the operation inconvenient. Summary of the Invention

[0003] In view of this, the purpose of this invention is to provide a method for preparing and raising sterile black soldier fly larvae. Sterile operation can be achieved by three disinfection processes using alcohol and sodium hypochlorite, with a high success rate. A self-made device allows for the dispersion of egg masses of several hundred eggs during the operation, while simultaneously allowing the disinfectant chemicals to treat the entire surface of the eggs without damaging the inner layer carrying the larvae. Compared to a 2ml Eppendorf tube, this method can hold more egg masses at once, enabling the production of more sterile black soldier flies.

[0004] To achieve the above objectives, the present invention provides the following technical solution: a method for preparing and raising sterile black soldier fly larvae, comprising the following steps:

[0005] Step 1, Feed Preparation:

[0006] Step 1.1: Put wheat bran into the conical flask, cover the flask with a sieve, seal it with a breathable sealing film, sterilize at 121℃ for 15 minutes, and place at room temperature for 12 hours;

[0007] Step 1.2: Sterilize the conical flasks from Step 1.1, which have been left for 12 hours, at 121℃ for 15 minutes.

[0008] Step 1.3: After cooling, add yeast extract and ultrapure water to the conical flask, stir well, and let stand at room temperature for 12 hours.

[0009] Step 1.4: Sterilize the conical flask containing the feed at 115℃ for 15 minutes, and then leave it at room temperature for 12 hours.

[0010] Step 1.5: Sterilize at 115℃ for 15 minutes, spray the sterilized feed with alcohol and place it in a clean bench to cool.

[0011] Step 2: Self-made egg mass sterilization device, which includes a hollow circular tube. One end of the circular tube is bound with a filter screen using an elastic element. The pore size of the filter screen is smaller than that of black soldier fly egg masses.

[0012] The egg mass sterilization device should be sterilized at 121°C for 20 minutes. Other items used in the aseptic operation, except for disposable laboratory supplies, should also be sterilized at 121°C for 20 minutes.

[0013] Transfer all sterilized experimental supplies to the laminar flow hood and sterilize with ultraviolet light for at least 20 minutes. Then, light the alcohol lamp in the laminar flow hood, spray the surface of the wood paper containing fresh egg masses with 75% alcohol, pick out the eggs and put them into the laminar flow hood, and prepare a 1% sodium hypochlorite solution in the laminar flow hood.

[0014] Step 3: Using a dissecting needle next to an alcohol lamp, pick up the egg mass into the egg mass sterilization device and immerse it in a beaker containing 75% alcohol. Soak the surface for 3 minutes for disinfection. During the operation, use a dissecting needle to disperse the egg mass.

[0015] Step 4: Transfer the sterilization device containing egg masses, which has been disinfected in Step 3, to a beaker containing 1% sodium hypochlorite solution and immerse it for 3 minutes.

[0016] Step 5: Transfer the sterilized egg mass containing the egg mass, which was sterilized in Step 4, to a new beaker containing 75% alcohol and soak it for 3 minutes. Then, wash it thoroughly in a beaker containing sterile water. Transfer the egg mass and filter screen to the sterilized conical flask containing feed prepared in Step 1 for incubation and closed culture.

[0017] Optionally, the circular tube includes, but is not limited to, glass tubes and plastic tubes; the filter screen includes, but is not limited to, nylon cloth and cotton cloth; and the elastic element includes, but is not limited to, rubber bands.

[0018] Optionally, the disposable laboratory supplies include multiple beakers, forceps, dissecting needles, and sterile water.

[0019] Preferably, the alcohol used in all steps is not reused.

[0020] Preferably, all operations in steps 2 to 5 are performed with the assistance of sterile forceps.

[0021] Preferably, during the soaking process in steps 4 and 5, the beaker needs to be gently shaken by hand.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] 1. It can achieve large-scale sterilization of egg masses.

[0024] 2. During the process, the egg mass can be rapidly dispersed using a dissecting needle.

[0025] 3. The operation process is simpler than traditional methods.

[0026] 4. High success rate of sterile black soldier fly preparation.

[0027] 5. Disinfecting egg masses causes minimal harm to the insects themselves. Attached Figure Description

[0028] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments of this application and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0029] Figure 1 Schematic diagram of a black soldier fly egg mass sterilization device Figure 1 ;

[0030] Figure 2 Schematic diagram of a black soldier fly egg mass sterilization device Figure 2 ;

[0031] Figure 3 This is a schematic diagram of the egg mass disinfection process in Example 1;

[0032] Figure 4 This is a schematic diagram of the 16S rRNA detection results. The primers are: 338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT. Detailed Implementation

[0033] The principles and features of the present invention are described below with reference to the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0034] Example 1

[0035] A method for preparing and raising sterile black soldier fly larvae, comprising the following steps:

[0036] Step 1, Feed Preparation:

[0037] Step 1.1: Add 30g of wheat bran to a 250ml conical flask, cover the flask with a sieve, seal it with a breathable sealing film, sterilize at 121℃ for 15min, and leave at room temperature for 12h.

[0038] Step 1.2: Sterilize the conical flasks from Step 1.1 after 12 hours at 121℃ for 15 minutes.

[0039] Step 1.3: After cooling, add 3g of yeast extract and 70g of ultrapure water to the conical flask and stir well. Let it stand at room temperature for 12 hours. The yeast extract is from Oxoid YEAST EXTRACT.

[0040] Step 1.4: Sterilize the conical flask containing the feed at 115°C for 15 minutes, and then leave it at room temperature for 12 hours. The feed refers to wheat bran, water, and yeast extract.

[0041] Step 1.5: Sterilize at 115℃ for 15 minutes, spray the sterilized feed with alcohol and place it in a clean bench to cool.

[0042] The technical measures in step 1 ensure that sterile black soldier fly larvae receive sufficient feed at once, and that the rearing conditions are sealed to prevent interference from external microorganisms.

[0043] Step 2: Homemade egg mass sterilization device, such as... Figure 1 , Figure 2 As shown, the egg mass sterilization device includes a hollow circular tube, with a filter screen attached to one end of the circular tube by an elastic element. The pore size of the filter screen is smaller than that of the black soldier fly egg mass.

[0044] The circular tube is made of materials including but not limited to glass tubes, plastic tubes, and any other round tubes that can be sterilized. In this embodiment, a 50ml plastic tube is preferred. The filter screen includes but is not limited to nylon cloth, cotton cloth, and other fabrics that can be sterilized and have a pore size smaller than that of black soldier fly eggs. In this embodiment, nylon cloth is preferred. The elastic element includes but is not limited to rubber bands.

[0045] The egg mass sterilization device was sterilized at 121°C for 20 minutes. All other items used in the aseptic operation, except for disposable laboratory supplies, also needed to be sterilized at 121°C for 20 minutes. The disposable laboratory supplies included four 100ml beakers, forceps, dissecting needles, sterile water, 75% alcohol, and 1% sodium hypochlorite solution. The four 100ml beakers were labeled a, b, c, and d, respectively.

[0046] Transfer all sterilized experimental supplies to the laminar flow hood and sterilize with ultraviolet light for at least 20 minutes. Then, light the alcohol lamp in the laminar flow hood, spray the surface of the wood paper containing fresh egg masses with 75% alcohol, pick out the eggs and put them into the laminar flow hood, and prepare a 1% sodium hypochlorite solution in the laminar flow hood.

[0047] The self-made egg mass sterilization device of this invention can sterilize a large number of egg masses at one time, and at the same time facilitates the collection of sterilized egg masses.

[0048] Step 3: Using a dissecting needle near an alcohol lamp, pick 2-3 egg masses into an egg mass sterilization device, then immerse them in beaker a containing 75% alcohol. Surface sterilization is performed for 3 minutes. Figure 3 As shown.

[0049] During this process, the egg masses are dispersed using a dissecting needle, and the alcohol used in each step cannot be reused.

[0050] Step 4: Transfer the sterilization device containing egg masses, which was disinfected in Step 3, to beaker b containing 1% sodium hypochlorite solution and soak for 3 minutes. During the soaking process, gently shake the beaker by hand to ensure that the egg masses and the disinfectant are in full contact, so as to improve the disinfection effect.

[0051] Step 4 allows for more thorough disinfection, eliminating microorganisms that alcohol cannot kill.

[0052] Step 5: Transfer the sterilized egg mass containing the egg mass from Step 4 back to beaker c containing new 75% alcohol and immerse it for 3 minutes. During immersion, gently shake the beaker by hand. Then, thoroughly wash it in beaker d containing sterile water. Transfer the egg mass and filter screen to a sterilized conical flask containing feed for incubation and closed culture. When adding the egg mass, use sterilized tweezers to pull the rubber band off the round tube, allowing the filter screen and egg mass to slide into the conical flask.

[0053] Step 5 uses closed culture to ensure no microbial interference, and the entire operation is completed in a clean bench to avoid microbial interference.

[0054] Note: All operations are performed with the assistance of sterile forceps. Do not touch the egg mass sterilization device with your hands.

[0055] like Figure 4As shown, the black soldier fly larvae raised in Example 1 were ground up (using a sterile grinding stick and test tube), and total DNA was extracted using a soil testing kit. PCR was then performed using 16S primers. The results showed that sterile black soldier fly larvae did not produce any bands, indicating the absence of bacteria. The negative control, using sterile water, indicated the absence of bacteria, similar to the sterile water. The positive control, showing the emergence of bacterial black soldier fly larvae, indicated the presence of bacteria.

[0056] Table 1 shows experimental examples of black soldier fly larvae cultured using the preparation and rearing method of Example 1, and the success rate of the culture results is statistically analyzed, with a success rate of 100%.

[0057] Table 1 shows the success rate statistics for the preparation and feeding methods in Example 1.

[0058] name Number of repetitions Identification Standards Pollution count Success rate Experiment 1 3 LB coating board 0 100％ Experiment 2 3 LB coating board 0 100％ Experiment 3 3 LB coating board 0 100％

[0059] In summary, the specific embodiments have provided a detailed description of the present invention, but the present invention is not limited to the detailed embodiments described above. It is obvious to those skilled in the art that modifications or improvements made to the specific embodiments based on the present invention fall within the scope of the claimed invention. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. A method of preparing and rearing sterile black soldier fly larvae, characterized by, The method comprises the following steps: Step 1, feed preparation: Step 1.1, put the wheat bran into the conical flask, cover the bottle screen, seal with a breathable sealing film, sterilize, the sterilization temperature is 121℃, the sterilization time is 15min, and the conical flask is placed at room temperature for 12h; Step 1.2, the conical flask placed in step 1.1 is sterilized again, the sterilization temperature is 121℃, the sterilization time is 15min; Step 1.3, after cooling, yeast extract and ultrapure water are added to the conical flask, stirred uniformly, and placed at room temperature for 12h; Step 1.4, sterilize the conical flask containing the feed, the sterilization temperature is 115℃, the sterilization time is 15min, and the conical flask is placed at room temperature for 12h again; Step 1.5, sterilize again, the sterilization temperature is 115℃, the sterilization time is 15min, spray the sterilized feed with alcohol, and place it in a clean bench to cool; Step 2, self-made egg block sterilization device, the egg block sterilization device comprises a hollow circular tube, one end of the circular tube is bound with a filter screen by an elastic member, and the pore size of the filter screen is smaller than that of the black soldier fly egg block; The egg block sterilization device is sterilized at 121℃ for 20min, and other articles used in the sterile operation process except for disposable experimental articles also need to be sterilized at 121℃ for 20min; All sterilized experimental articles are transferred to the clean bench, and the ultraviolet lamp is sterilized for at least 20min, then the alcohol lamp in the clean bench is ignited, the surface of the wood paper sheet containing fresh egg block is sprayed with 75% alcohol, and the insect eggs are picked into the clean bench, and a 1% sodium hypochlorite solution is configured in the clean bench; Step 3, immerse the egg block into the beaker containing 75% alcohol after picking it into the egg block sterilization device by the dissection needle beside the alcohol lamp, and surface soak disinfection for 3min, and the egg block is dispersed during the operation process; Step 4, the egg block sterilization device containing the egg block sterilized in step 3 is transferred to the beaker containing 1% sodium hypochlorite solution for soaking treatment for 3min; Step 5, the egg block sterilization device containing the egg block sterilized in step 4 is transferred to the beaker containing new 75% alcohol again for soaking treatment for 3min, then washed thoroughly in the beaker containing sterile water, and the egg block is transferred to the conical flask containing the feed and sterilized in step 1 for incubation and closed culture.

2. The method of claim 1, wherein the sterile black soldier fly larvae are produced and reared in a controlled environment. The circular tube comprises a glass tube and a plastic tube, the filter screen comprises nylon cloth and cotton cloth, and the elastic member comprises a rubber band.

3. The method of claim 1, wherein the sterile black soldier fly larvae are produced and reared in a controlled environment. The disposable experimental articles comprise a plurality of beakers, tweezers, dissection needles and sterile water.

4. The method for preparing and rearing sterile black soldier fly larvae according to claim 1, wherein The alcohol in all steps cannot be reused.

5. The method for preparing and rearing sterile black soldier fly larvae according to claim 1, wherein All operations in steps 2 to 5 are completed under the assistance of sterile tweezers.

6. The method for preparing and rearing sterile black soldier fly larvae according to claim 1, wherein, The beaker needs to be slightly shaken by hand during the soaking process in steps 4 and 5.

Images