Plant lactobacillus plantarum ccfm1283 with anti-glycation and anti-aging functions and postbiotic

Abstract

The application discloses a plant lactiplantibacillus plantarum CCFM1283 with anti-glycation and anti-aging functions and a postbiotic of the plant lactiplantibacillus plantarum CCFM1283, and belongs to the technical field of microorganisms and the technical field of medicines.The plant lactiplantibacillus plantarum CCFM1283 and the prepared postbiotic can be used externally or orally to achieve the purpose of relieving glycation damage and / or resisting aging of an individual.The plant lactiplantibacillus plantarum CCFM1283 serves as a food safety strain, and the strain itself and / or the prepared postbiotic has great application prospects in the fields of food, health products, medicines or cosmetics.

Description

TECHNICAL FIELD

[0001] The present application relates to a plant lactobacillus plantarum CCFM1283 with anti-glycation and anti-aging functions and its postbiotic, belonging to the technical field of microorganisms and the technical field of medicine. BACKGROUND

[0002] Advanced glycation end products (AGEs) are caused by non-enzymatic glycosylation of protein amino groups with glucose and other reducing sugars. AGEs can form both inside and outside cells, and their presence in biomolecules changes their biomechanical and functional properties. Proteins, lipids, and nucleic acids can become targets of advanced glycation, interfering with many physiological functions of the organism by modifying enzyme-substrate interactions, protein-DNA interactions, protein-protein interactions, DNA regulation, and epigenetic regulation. One of the prominent features of aging at the molecular level is the gradual accumulation of proteins modified non-enzymatically, the most common of which is glycation. Reducing sugars react with free amino groups on proteins (and other molecules), leading to the reversible production of reactive intermediates and ultimately to the irreversible production of advanced glycation end products (AGEs).

[0003] At the skin level, glycation is associated with the aging process and affects cells (endothelial cells, fibroblasts) and structural proteins such as collagen, elastin, and glycoproteins. The extracellular matrix (ECM) of the dermis modified by glycation further affects the growth, differentiation, motility, cytokine response, enzyme activity (metalloproteinases) of fibroblasts, and vascular hemostasis. A common consequence of AGE accumulation is the covalent cross-linking of AGEs with proteins, which leads to an increase in the stiffness of the protein matrix, impairs function, and increases resistance to the removal of cross-linked proteins by proteolysis in various tissues and organs, leading to impaired organ function. CN116602977A discloses an active component with antioxidant, anti-glycation, and anti-inflammatory effects, as well as a preparation method and application thereof, and the component includes specnuzhenoside, diosmin, neodiosmin, rosmarinic acid, oleuropein, salvianolic acid B, mongolian flower glycoside, willow leaf glycoside, privet glycoside G13, and 6'-O-trans-cinnamoyl-8-epigallocatechin acid, which has good in vitro antioxidant, anti-glycation, and anti-inflammatory activity.

[0004] In order to develop more efficient and comprehensive anti-glycation products, four anti-glycation strategies can be proposed according to the occurrence and development of glycation damage, and potential effective biological raw materials can be screened based on these paths: (1) reducing the generation of AGE; (2) hindering the combination of AGE-RAGE; (3) destroying the cross-linking of AGE and protein; (4) inhibiting the signal activation after AGE-RAGE combination. At present, the most studied is to compete with the intermediate products of glycation reaction or limit the generation of intermediate reaction to generate AGE, thereby reducing the generation and accumulation of AGE; but it is not enough to limit the generation of AGE, and the research on other anti-glycation pathways also needs to be further studied. SUMMARY

[0005] The application provides a Lactiplantibacillus plantarum CCFM1283 and a postbiotic prepared from the Lactiplantibacillus plantarum CCFM1283, and application of the Lactiplantibacillus plantarum CCFM1283 and the postbiotic in preparation of anti-glycation and anti-aging products.

[0006] The application provides a Lactiplantibacillus plantarum CCFM1283, which is preserved in the Guangdong Microbial Culture Collection Center, has a preservation number of GDMCC No: 62885, and is preserved on October 14, 2022.

[0007] The Lactiplantibacillus plantarum CCFM1283 is derived from feces of healthy people, and a 16S rDNA sequence of the Lactiplantibacillus plantarum CCFM1283 is shown as SEQ ID NO. 1.

[0008] The Lactiplantibacillus plantarum CCFM1283 has a raised colony on a MRS solid culture medium, a smooth and fine surface, a white circular shape, and a diameter of about 3 mm.

[0009] The application further provides a postbiotic prepared from the Lactiplantibacillus plantarum CCFM1283.

[0010] In an embodiment, the postbiotic comprises inactivated or deactivated cells, cell culture and / or bacterial cell lysate.

[0011] In an embodiment, the postbiotic is one or more kinds of powders prepared by drying inactivated or deactivated cells, cell culture and / or bacterial cell lysate.

[0012] In an embodiment, the inactivated or deactivated cells are prepared by culturing the Lactiplantibacillus plantarum CCFM1283 in a culture medium for a period of time, collecting bacterial cells in the cell culture, and obtaining inactivated bacterial cells by heat treatment or freeze-drying.

[0013] In one embodiment, the heat treatment is at 60-70℃ for 25-35 minutes.

[0014] In one embodiment, the preparation of the bacterial lysate is by culturing the B. lactis CCFM1283 in a medium for a period of time, collecting the bacterial cells, high pressure homogenization at 8000 r / min for 30 minutes, and centrifuging to collect the supernatant as the bacterial lysate.

[0015] In one embodiment, the drying includes but is not limited to spray drying, vacuum freeze drying, fluidized bed drying, and vacuum drying.

[0016] The present application also provides a composition comprising the B. lactis CCFM1283 and / or the postbiotic thereof.

[0017] In one embodiment, the composition comprises a pharmaceutical product.

[0018] In one embodiment, the composition is the product of fermentation of the B. lactis CCFM1283 in a medium containing peanut hulls.

[0019] The present application provides the use of the B. lactis CCFM1283, the postbiotic, or the composition in the preparation of a product for resisting glycation and delaying aging.

[0020] In one embodiment, the product comprises a pharmaceutical product.

[0021] In one embodiment, the product comprises at least one of the following effects:

[0022] (1) inhibiting the generation of fluorescent AGEs;

[0023] (2) preventing the damage and functional decline of skin fibroblasts (HSF) caused by high glucose and the formation of AGE intermediates (methylglyoxal);

[0024] (3) reducing the aging characteristics of the individual (blood biochemical indicators, skin appearance);

[0025] (4) reducing the AGE content of the blood and skin tissue of the individual;

[0026] (5) reducing the AGE-RAGE binding in the skin tissue of the individual;

[0027] (6) reducing the inflammatory response and oxidative stress in the skin tissue of the individual;

[0028] (7) alleviating the decrease in skin elasticity and collagen in the aging individual.

[0029] In one embodiment, the symptoms associated with aging are directed to skin aging, accumulation of glycation aging marker AGE in blood and other tissue organs.

[0030] In one embodiment, the skin aging comprises dryness, loss of elasticity, laxity, wrinkle formation, oxidative damage, loss of collagen.

[0031] In one embodiment, the product is applied topically and orally.

[0032] In one embodiment, the content of Lactobacillus plantarum CCFM1283 in the product is not less than 1x10 6 CFU / mL or 1x10 6 CFU / g.

[0033] In one embodiment, the dosage of the prepared metaplast of Lactobacillus plantarum CCFM1283 is not less than 10 mg / kg of body weight.

[0034] The present application provides the use of Lactobacillus plantarum CCFM1283 and / or its metaplast in the preparation of a medicament for preventing and / or alleviating glycation-induced skin aging.

[0035] In one embodiment, the symptoms associated with aging are directed to skin aging, accumulation of glycation aging marker AGE in blood and other tissue organs.

[0036] In one embodiment, the conventional excipients include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and nutritional fortifiers.

[0037] In one embodiment, the conventional excipients include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and nutritional fortifiers.

[0038] In one embodiment, the medicament contains the Lactobacillus plantarum CCFM1283 and / or its metaplast, and a pharmaceutical carrier and / or a pharmaceutical excipient.

[0039] In one embodiment, the pharmaceutical excipients include excipients and additional agents.

[0040] In an embodiment, the pharmaceutical excipient comprises a solvent, a propellant, a solubilizer, a co-solvent, an emulsifier, a colorant, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, a fragrance, an anti-adherent, an integrating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, a defoaming agent, a thickening agent, an inclusion agent, a humectant, an absorbent, a diluent, a flocculating agent and a deflocculating agent, a filter aid, and a release retardant.

[0041] In an embodiment, the cosmetic contains the Lactiplantibacillus plantarum CCFM1283 and / or its postbiotic, a matrix material and / or a conventional excipient.

[0042] In an embodiment, the matrix material includes an oil-based material, a wax-based material, a synthetic oil-based material, a powder-based material, a gum-based material, a coagulant, and a surfactant.

[0043] In an embodiment, the conventional excipient includes one or more of a humectant, a whitening agent, a flavoring agent, a binder, a lubricant, a preservative, a film-forming agent, an antioxidant, an emulsifier, and a cosmetic nutrient additive.

[0044] Beneficial effects

[0045] The Lactiplantibacillus plantarum CCFM1283 of the present application and the postbiotic prepared therefrom have the ability to relieve the host from glycation damage and reduce the corresponding aging problems, which is embodied in the following aspects:

[0046] (1) preventing the decrease in cell viability in the model of acetone damage to skin fibroblasts (HSF);

[0047] (2) preventing abnormal expression of DDOST mRNA and MMP-9 mRNA in skin fibroblasts (HSF) damaged by high glucose culture;

[0048] (3) reducing the content of AGE in the serum and skin of aging mice;

[0049] (4) reducing the content of the inflammation marker TNF-α in the serum and skin of aging mice;

[0050] (5) relieving the decrease in the elastic properties of the back skin of aging mice caused by glycation damage;

[0051] (6) reducing the decrease in the content of collagen type III in the back skin of aging mice caused by glycation damage;

[0052] (7) alleviating the exacerbation of glycation injury in the back skin of aging mice mediated by AGE-RAGE binding;

[0053] (8) alleviating the collagen synthesis, degradation and inflammatory response triggered by glycation injury in aging mice.

[0054] Therefore, Lactiplantibacillus plantarum CCFM1283 and the postbiotic prepared therefrom have great application prospects in products for alleviating glycation injury in a host and reducing the corresponding aging.

[0055] Biological material preservation

[0056] Lactiplantibacillus plantarum CCFM1283, taxonomically named Lactiplantibacillus plantarum, was deposited in the Guangdong Microbial Culture Collection Center on October 14, 2022, with the accession number GDMCC No: 62885, and the address of the deposit is No. 59 Building, Guangzhou Xianlie Middle Road 100 Courtyard. BRIEF DESCRIPTION OF DRAWINGS

[0057] Figure 1 Effects of different postbiotics on the proliferation of HSF cells;

[0058] Figure 2 Effects of different postbiotics on the viability of HSF cells under the action of methylglyoxal, an intermediate in glycation;

[0059] Figure 3 Effects of different postbiotics on the expression of anti-glycation related genes (DDOST mRNA, MMP-9 mRNA) in HSF cells under high glucose culture;

[0060] Figure 4 Flowchart of mouse experiment;

[0061] Figure 5 Effects of Lactiplantibacillus plantarum CCFM1283 and the postbiotic prepared therefrom on the AGE content in the blood and skin tissue of mice;

[0062] Figure 6 Effects of Lactiplantibacillus plantarum CCFM1283 and the postbiotic prepared therefrom on the content of TNF-α, an inflammation marker, in the serum and skin of aging mice;

[0063] Figure 7 Effects of Lactiplantibacillus plantarum CCFM1283 and the postbiotic prepared therefrom on the skin elasticity;

[0064] Figure 8Effects of Lactobacillus plantarum CCFM1283 and its prepared probiotics on skin type III collagen synthesis, degradation and content;

[0065] Figure 9 Effects of Lactobacillus plantarum CCFM1283 and its prepared probiotics on inhibiting AGE-RAGE binding and oxidative stress to relieve skin glycation damage;

[0066] Figure 10 Effects of peanut skin fermented by Lactobacillus plantarum CCFM1283 on improving in vitro anti-glycation ability of peanut skin;

[0067] Figure 11 Effects of peanut skin fermented by Lactobacillus plantarum CCFM1283 on improving peanut skin oral administration to inhibit AGE accumulation in serum and subsequent receptor binding;

[0068] Figure 12 Effects of peanut skin fermented by Lactobacillus plantarum CCFM1283 on improving peanut skin oral administration to relieve skin elasticity decline caused by glycation;

[0069] Figure 13 Effects of peanut skin fermented by Lactobacillus plantarum CCFM1283 on peanut skin oral administration to relieve skin glycation damage target;

[0070] Figure 14 Effects of peanut skin fermented by Lactobacillus plantarum CCFM1283 on peanut skin oral administration to relieve skin inflammation and oxidative stress.

[0071] “*” indicates a statistically significant difference (P<0.05) compared with the Model group, “**” indicates a significant statistically significant difference (P<0.01) compared with the Model group, “***” indicates a very significant statistically significant difference (P<0.001) compared with the Model group, and “****” indicates a very significant statistically significant difference (P<0.0001) compared with the Model group. DETAILED DESCRIPTION

[0072] The application will be further described below in conjunction with specific examples.

[0073] The human skin fibroblasts (HSF) involved in the following examples were purchased from Kunming Cell Bank.

[0074] The BALB / c mice involved in the following examples were purchased from Vantian Lihua Company.

[0075] Lactobacillus plantarum CCFM1283, Lactobacillus plantarum FXJCJ22M3, Lactobacillus plantarum FSCDJY93L1, Lactobacillus plantarum FXJCJ26M6 involved in the following examples are from the Food Biotechnology Center of Jiangnan University.

[0076] The culture medium involved in the following examples is as follows:

[0077] MRS liquid medium: yeast powder 5.0 g / L, beef extract 10.0 g / L, peptone 10.0 g / L, glucose 20.0 g / L, anhydrous sodium acetate 2.0 g / L, citric acid diamine 2.0 g / L, potassium phosphate dibasic 2.6 g / L, manganese sulfate monohydrate 0.25 g / L, magnesium sulfate heptahydrate 0.5 g / L, and Tween-80 1 mL / L, pH 6.2-6.4.

[0078] MRS solid medium: yeast powder 5.0 g / L, beef extract 10.0 g / L, peptone 10.0 g / L, glucose 20.0 g / L, anhydrous sodium acetate 2.0 g / L, citric acid diamine 2.0 g / L, potassium phosphate dibasic 2.6 g / L, manganese sulfate monohydrate 0.25 g / L, magnesium sulfate heptahydrate 0.5 g / L, Tween-80 1 mL / L, and agar 20.0 g / L, pH 6.2-6.4.

[0079] MRS (simplified) liquid medium: glucose 8 g / L, yeast powder 5 g / L, calcium carbonate 6 g / L, anhydrous sodium acetate 2 g / L, citric acid diamine 2 g / L, potassium phosphate dibasic 2.6 g / L, manganese sulfate monohydrate 0.25 g / L, magnesium sulfate heptahydrate 0.5 g / L, and Tween-80 1 mL / L, pH 6.2-6.4.

[0080] Peanut skin fermentation medium: 5 g / L of commercially available peanut skin extract, 4 g / L of glucose, 5 g / L of yeast powder, and 4 g / L of calcium carbonate were added, the pH was adjusted to 6.8-7.2, sterilized at 115°C for 20 min, and a peanut skin fermentation culture solution (abbreviated as hsp) was prepared. The peanut skin extract was purchased from Shaanxi Shengheng Biotechnology Co., Ltd. with batch number SH20220328.

[0081] Cell culture medium: 89% (v / v) DMEM medium, 10% (v / v) fetal bovine serum, and 1% (v / v) 100×penicillin and streptomycin mixed solution (penicillin content 10000 U / mL, streptomycin concentration 10 mg / mL).

[0082] Example 1: Cell recovery and culture

[0083] Firstly, the frozen human skin fibroblast cell strain (HSF) was taken out, quickly melted in a 37°C water bath, then centrifuged at 1000 r / min for 3 min, the supernatant was discarded, and the cells were resuspended in an appropriate volume of cell culture medium and placed in a culture dish, then placed in a 37°C incubator containing 5% CO2 for culture. When the cells grew to 70%-80% confluence, the cells were subcultured.

[0084] Example 2: Screening and preparation of Lactobacillus plantarum CCFM1283

[0085] The sample was derived from healthy human feces, and after pretreatment, the sample was stored in 20% glycerol at -80°C in a refrigerator. After thawing, the sample was mixed and 0.5 mL of the sample was taken and added to 4.5 mL of normal saline. Gradient dilution was performed with normal saline, and the appropriate gradient dilution was coated on the MRS solid culture medium and cultured at 37°C for 48 h. Typical colonies of Lactobacillus plantarum were picked and streaked on MRS solid culture medium, and single colonies were transferred to MRS liquid medium for enrichment. The strain was obtained and named Lactobacillus plantarum CCFM1283. The strain genome was extracted for 16S rDNA amplification and sequencing (performed by Suzhou Jinyuzhi Biological Technology Co., Ltd.). The results were determined as Lactobacillus plantarum by NCBI sequence alignment, and the strain was named Lactobacillus plantarum CCFM1283.

[0086] (1) Lactobacillus plantarum CCFM1283 was streaked from the bacteria preservation tube and cultured on MRS solid medium at 37°C in a water-jacketed incubator for 24-48 h to obtain single colonies; single colonies were picked and inoculated into MRS liquid medium and cultured at 37°C for 12-18 h to obtain culture solution 1;

[0087] Culture solution 1 was inoculated into MRS liquid medium at a 2% (v / v) inoculation amount and cultured at 37°C for 12 h to obtain seed solution;

[0088] The seed solution was inoculated into MRS liquid medium and MRS (simplified) liquid medium at 2% (v / v) respectively for expansion, and cultured at a temperature of 37°C for 18-24 h. The concentrations of the two bacterial solutions were adjusted to the same level (bacterial concentration 1.5×10 9 CFU / mL) to obtain bacterial solution a and bacterial solution b.

[0089] The supernatant obtained by centrifuging bacterial solution a at 8000 r / min for 30 min was heat-treated (65°C, 30 min), and then freeze-dried to obtain a powder for standby. Lactobacillus plantarum CCFM1283 fermentation supernatant (denoted as CCFM1283_M) was prepared.

[0090] The bacterial slurry obtained by centrifugation of the bacterial liquid b at 8000 r / min for 30 min was resuspended in double-distilled water at a volume ratio of 75% of the original bacterial liquid, and the resuspended liquid was heat-treated (65°C, 30 min) and then subjected to high-pressure homogenization (1000-1200 MPa, 10 times) in a high-pressure homogenizer. The supernatant was collected by centrifugation, and the bacterial lysate (denoted as CCFM1283_Z) was obtained. The postbiotic freeze-dried powder was obtained by freeze-drying.

[0091] The preparation method of the live Lactobacillus plantarum CCFM1283 was the same as that of the postbiotic, except that the bacterial slurry obtained by centrifugation of the bacterial liquid b at 8000 r / min for 30 min was resuspended in the freeze-drying protectant at a ratio of 1 g:2 mL and then directly freeze-dried to obtain the live Lactobacillus plantarum CCFM1283 powder, which was denoted as CCFM1283.

[0092] The Lactobacillus plantarum CCFM1283 postbiotic (bacterial lysate CCFM1283_Z and fermentation supernatant CCFM1283_M) was prepared by the above-mentioned means.

[0093] (2) The postbiotics of Lactobacillus plantarum FXJCJ22M3, Lactobacillus plantarum FSCDJY93L1, and Lactobacillus plantarum FXJCJ26M6 were prepared according to the method of step (1).

[0094] Example 3: Preparation of peanut skin fermentation broth by fermentation of peanut skin with Lactobacillus plantarum CCFM1283

[0095] The bacterial liquid of Lactobacillus plantarum CCFM1283 was streaked on MRS solid culture medium using an inoculation loop, and incubated at 37°C for 48 h. A single colony was taken and inoculated in MRS liquid medium, and incubated at 37°C for 18 h. The bacterial liquid was mixed and inoculated in new MRS liquid medium at a concentration of 2% (v / v), and the operation was repeated for three times to obtain the activated bacterial liquid.

[0096] The obtained activated bacterial liquid was inoculated in peanut skin fermentation medium at a concentration of 2% (v / v), and incubated at 37°C with shaking at 200 rpm for 72 h. The fermentation broth was collected at 72 h, and the supernatant was obtained by centrifugation of the bacterial liquid at 8000 r / min for 30 min. The supernatant was heat-treated (65°C, 30 min) and freeze-dried to obtain the powder for use. The Lactobacillus plantarum CCFM1283 peanut skin fermentation supernatant (denoted as CCFM1283_H) was prepared.

[0097] Example 4: Determination of the generation of fluorescent AGE in the fructose-bovine serum albumin system in vitro

[0098] 10 mg / mL bovine serum albumin and 0.5 M d-(+)-fructose in 0.1 M phosphate buffer (pH 7.4) was prepared and passed through a 0.22 μm water system filter to obtain a sterile fructose-bovine serum albumin glycation system. Different samples of the postbiotic to be tested were added to the fructose-bovine serum albumin glycation system and incubated at 37°C for 7 days. The incubated samples were used to detect the formation of fluorescent AGEs after 7 days of incubation.

[0099] After completion of the incubation, the fluorescent AGEs in the glucose-modified BSA were detected using an excitation wavelength of 370 nm and an emission wavelength of 440 nm, and the percentage of inhibition of the generation of fluorescent AGEs was calculated as 1 minus the difference in the fluorescence intensity of the sample compared to the control (BSA+ / glucose+).

[0100] Example 5: Effect of the postbiotic prepared by Lactobacillus plantarum CCFM1283 on the proliferation of HSF cells

[0101] The specific steps are as follows:

[0102] (1) 100 μL of human skin fibroblasts (HSF cells) in the logarithmic growth phase were inoculated in a 96-well plate at a concentration of 3 x 10 4 cells / well, with the outermost circle filled with PBS solution to prevent edge effects. After 24 h of culture for the cells to adhere, blank, control, and postbiotic treatment groups were set up.

[0103] The blank group contained only cell culture medium without HSF cells.

[0104] The control group contained cell culture medium and HSF cells without postbiotics.

[0105] The treatment group used cell culture medium to resuspend the postbiotics (the amount of resuspended postbiotics was equivalent to the amount of postbiotics prepared from bacteria with a concentration of 5.0 x 10 7 CFU / mL), and 100 μL of postbiotics prepared from Lactobacillus plantarum CCFM1283, Lactobacillus plantarum FXJCJ22M3, Lactobacillus plantarum FSCDJY93L1, or Lactobacillus plantarum FXJCJ26M6 was added, respectively.

[0106] (2) The above-mentioned well plates were incubated at 37°C for 24 h, and then 10 μL of CCK8 solution was added to each well for 2 h of incubation to measure the absorbance (OD) at 450 nm.

[0107] The cell viability was calculated according to the following formula: cell viability (%) = (OD value of the treatment group - OD value of the blank group) / (OD value of the control group - OD value of the blank group) x 100%.

[0108] The effect on cell proliferation was as follows Figure 1The cell proliferation rates were 102.90%, 133.10%, 108.48%, 105.30%, 98.50%, 97.90%, 99.99%, 94.76%, and 107.73%, respectively, when the inactivated bacteria concentration was 5.0 x 10 7 CFU / mL.

[0109] According to the toxicity grading evaluation method in ISO 10993-5:2009, the cell viability can be considered as non-toxic if it is greater than 70%. The above results show that the HSF cell viability was higher than 90% at the postbiotic concentration of 5.0 x 10 7 CFU / mL, which is considered as non-toxic, the inactivated bacteria concentration of 5.0 x 10 7 CFU / mL is a suitable postbiotic concentration for subsequent cell experiments.

[0110] Example 6: Effect of the postbiotic prepared from Lactiplantibacillus plantarum CCFM1283 on preventing the glycation damage of HSF cells caused by methylglyoxal

[0111] The specific steps are as follows:

[0112] (1) 100 μL of HSF cells in the logarithmic growth phase were inoculated in a 96-well plate at a concentration of 3 x 10 4 cells / well, with the outermost circle filled with PBS solution to prevent edge effects. After 24 h of culture for cell adhesion, blank, control group 1, and treatment group 1 were set up.

[0113] Blank group: only containing cell culture medium without HSF cells;

[0114] Control group 1: containing cell culture medium and HSF cells without postbiotics;

[0115] Treatment group 1: containing cell culture medium and HSF cells, and containing postbiotics at the same time,

[0116] Probiotics include Lactobacillus plantarum CCFM1283, Lactobacillus plantarum FXJCJ22M3, Lactobacillus plantarum FSCDJY93L1, and probiotics prepared from Lactobacillus plantarum FXJCJ26M6. The probiotics are resuspended in cell culture medium (the amount of resuspended probiotics is equivalent to the amount of probiotics prepared from bacterial solution with a concentration of 5.0 x 10 7 CFU / mL).

[0117] (2) Incubate the above-mentioned well plates in an incubator at a temperature of 37°C for 24 hours, and then discard the old culture medium of the control group and the modeling agent group, and rinse with PBS for 3 times to set the control group, the model group, and the treatment group:

[0118] Control group: The control group 1 contains cell culture medium and HSF cells, and is not treated with probiotics and does not contain methylglyoxal modeling agent.

[0119] Model group: The control group 1 is replaced with cell culture medium containing methylglyoxal modeling agent, and contains original HSF cells, and is not treated with probiotics.

[0120] The cell culture medium containing methylglyoxal modeling agent is prepared by mixing methylglyoxal in ordinary cell culture medium and sterilizing it through a 0.22 μm water system filter. The final concentration of methylglyoxal in the cell culture medium is 400 μmol / L.

[0121] Treatment group: The treatment group 1 is replaced with cell culture medium containing methylglyoxal modeling agent, and contains original HSF cells, and is treated with probiotics.

[0122] (3) Incubate the above-mentioned well plates in an incubator at a temperature of 37°C for 24 hours, and then add 10 μL of CCK8 solution to each well for 2 hours of incubation to measure the absorbance (OD) at 450 nm.

[0123] The cell viability is calculated according to the following formula: Model group cell viability (%) = (model group OD value-blank group OD value) / (control group OD value-blank group OD value) x 100%; Treatment group cell viability (%) = (treatment group OD value-blank group OD value) / (control group OD value-blank group OD value) x 100%.

[0124] The results of the effect of preventing methylglyoxal from causing damage to HSF cells are shown in Table 1. Figure 2 Compared with the control group (cell viability 100%), the cell viability of the model group is 54.93%, and methylglyoxal modeling causes significant damage to HSF cells.

[0125] The cell viability of the treatment groups after adding CCFM1283_M and CCFM1283_Z was 70.70% and 69.97%, respectively, compared with 54.93% of the model group. CCFM1283_Z and CCFM1283_M significantly improved the HSF cell viability compared with the model group, indicating that the probiotics of plantaricin CCFM1283 could effectively prevent the glycation damage of HSF cells caused by methylglyoxal;

[0126] The HSF cell viability of other treatment groups of plantaricin FXJCJ22M3 (FXJCJ22M3_M and FXJCJ22M3_Z), plantaricin FSCDJY93L1 (FSCDJY93L1_M and FSCDJY93L1_Z), and plantaricin FXJCJ26M6 (FXJCJ26M6_M and FXJCJ26M6_Z) was 37.99%, 43.54%, 42.92%, 35.04%, 49.72%, and 36.02%, respectively, indicating that the probiotics of other plantaricin did not have the ability to significantly prevent the damage of HSF cells caused by methylglyoxal, which was not as good as the probiotics of plantaricin CCFM1283.

[0127] Example 7: Effect of probiotics prepared from plantaricin CCFM1283 on the expression of related genes in HSF cells cultured with high glucose.

[0128] (1) HSF cells were inoculated in a 6-well plate at 1×10 5 cells / mL, and the cells were cultured overnight to adhere. The old culture medium was discarded, and the cells were washed with PBS for 3 times. Control and treatment groups were set up;

[0129] The control group 1 was the group without adding probiotics;

[0130] The treatment groups were divided into plantaricin CCFM1283 lysate (CCFM1283_Z), plantaricin FXJCJ22M3 lysate (FXJCJ22M3_Z), plantaricin FSCDJY93L1 lysate (FSCDJY93L1_Z), and plantaricin FXJCJ26M6 lysate (FXJCJ26M6_Z). After treatment, the probiotics were resuspended in the cell culture medium (the amount of resuspended probiotics was equivalent to the amount of probiotics prepared from bacteria liquid with a concentration of 5.0×10 7 CFU / mL).

[0131] 2 mL of Lactobacillus plantarum CCFM1283 lysate (CCFM1283_Z), Lactobacillus plantarum FXJCJ22M3 lysate (FXJCJ22M3_Z), Lactobacillus plantarum FSCDJY93L1 lysate (FSCDJY93L1_Z), and Lactobacillus plantarum FXJCJ26M6 lysate (FXJCJ26M6_Z) were added to 6-well plates, and cultured for 24 h, with three parallel samples for each sample.

[0132] (2) The above-mentioned hole plates were incubated in an incubator at a temperature of 37°C for 24 h, and after the incubation, the old culture medium of the control group and the modeling agent group was discarded, and the PBS was washed for 3 times. The control group, the model group, and the treatment group were set as follows:

[0133] The control group was the original HSF cells of the control group 1 after the liquid change, without probiotic treatment, and 2 mL of ordinary cell culture medium was added.

[0134] The model group was the original HSF cells of the control group 1 after the liquid change into a cell culture medium containing 35 mmol / L glucose, without probiotic treatment.

[0135] The treatment group was the original HSF cells of the control group 1 after the liquid change into a cell culture medium containing 35 mmol / L glucose, with probiotic treatment.

[0136] (2) The above-mentioned hole plates were incubated in an incubator at a temperature of 37°C for 24 h, and after the incubation, the old culture medium of the control group and the modeling agent group was discarded, and the PBS was washed for 3 times. The control group, the model group, and the treatment group were set as follows: -△△Ct The expression of DDOST mRNA and MMP-9 mRNA was calculated by the formula, with β-actin as the internal reference. The primers are described in Table 1 below, and the results are shown in Figure 3 .

[0137] Table 1 Primer sequence

[0138] Oligo name Sequence Description F-qPCR-DDOST GAGACTCATTCGCTTTTCTTCCG Competes for binding site with RAGE (AGER1) R-qPCR-DDOST CTCCAAAATCTTCTACCGAAGGG Competes for binding site with RAGE (AGER1) F-qPCR-MMP9 AGACCTGGGCAGATTCCAAAC Matrix metalloproteinase 9 (MMP-9) R-qPCR-MMP9 CGGCAAGTCTTCCGAGTAGT Matrix metalloproteinase 9 (MMP-9)

[0139] AGER1 (also known as DDOST) is a protein with strong AGE-specific binding ability, which has been proved to directly accelerate the absorption and clearance of AGE, prevent the increase of active oxygen and pro-inflammatory cytokines mediated by cell AGE-RAGE, and inhibit RAGE signaling by competing with AGE; glycation damage can cause a decrease in the expression of DDOST mRNA, and aggravate AGE-RAGE binding, so the target alleviates AGE-RAGE damage and strengthens the anti-glycation function of DDOST by increasing the expression of DDOST mRNA. The results are shown inFigure 3 As can be seen, the expression of DDOST mRNA in the control group is about 1, and the expression of DDOST mRNA in the model group after intervention of high-glucose medium is reduced to 0.58; the postbiotic prepared from B. lactis CCFM1283 (CCFM1283_Z) significantly increases the expression of DDOST mRNA in HSF cells to 1.15 (110.7% higher than the model group); and the expression of DDOST mRNA after treatment with other postbiotics prepared from B. lactis (FXJCJ22M3_Z, FSCDJY93L1_Z, and FXJCJ26M6_Z) is only 0.71, 0.45, and 0.77, respectively, which does not show a significant up-regulation of DDOST mRNA expression compared with the model group.

[0140] Matrix metalloproteinase 9 (MMP-9) is a kind of enzyme belonging to the zinc-metalloproteinase family, which is an enzyme mainly degrading type IV collagen and elastin, and is involved in the degradation of extracellular matrix in normal physiological processes and pathological processes; under high-glucose conditions, the expression of MMP-9 is increased, which causes the proliferation of skin fibroblasts to slow down, the activity to decrease, and the migration and collagen secretion capacity to decrease. Figure 3 As can be seen, the expression of MMP-9 mRNA in the control group is about 1, and the expression of MMP-9 mRNA in the model group after intervention of high-glucose medium is increased to 2.16; the postbiotic prepared from B. lactis CCFM1283 (CCFM1283_Z) significantly reduces the expression of MMP-9 mRNA in HSF cells to 0.75 (70.5% lower than the model group); and the expression of MMP-9 mRNA after treatment with other postbiotics prepared from B. lactis (FXJCJ22M3_Z, FSCDJY93L1_Z, and FXJCJ26M6_Z) is about 6.11, 2.49, and 1.07, respectively, which does not show a down-regulation of MMP-9 mRNA expression compared with the model group.

[0141] As can be seen from the experimental results, the postbiotic (bacterial lysate) prepared from B. lactis CCFM1283 can down-regulate the expression of MMP-9 mRNA to alleviate the abnormal function of proteins caused by glycation under high-glucose culture conditions, and up-regulate the expression of DDOST mRNA to hinder the combination of AGE-RAGE, thereby preventing the sugar damage to HSF cells caused by high-glucose culture conditions.

[0142] Example 8: Effect of B. lactis CCFM1283 and the postbiotic prepared therefrom on the AGE level in blood and skin of aging mice

[0143] In this example, the preparation method of the postbiotic (CCFM1283_M and CCFM1283_Z) of B. lactis CCFM1283 is the same as that in Example 2, except that the bacterial slurry is collected after centrifugation of the bacterial liquid, and high-pressure homogenization is not performed.

[0144] The specific steps are as follows:

[0145] (1) Take 45 healthy 8-week-old male BALB / c mice, and randomly divide them into 9 cages, 5 mice per cage. The 9 cages are as follows: 2 cages for the model group (Model), 1 cage for the blank group, and 1 cage for each of the remaining groups, which are:

[0146] The blank group (Control): physiological saline is used as a control.

[0147] The model group (Model): physiological saline is used as a control.

[0148] The CCFM1283 group: live Lactobacillus plantarum CCFM1283 is used, with a dose of 5x10 9 CFU / kg of mouse body weight.

[0149] The CCFM1283_Z group: Lactobacillus plantarum CCFM1283 postbiotic (bacterial lysate) is used, with a dose of 500 mg / kg of mouse body weight.

[0150] The CCFM1283_M group: Lactobacillus plantarum CCFM1283 metabolite (fermentation supernatant) is used, with a dose of 500 mg / kg of mouse body weight.

[0151] Among the above groups, the lysate or metabolite: dead bacteria or metabolites prepared from the bacterial liquid after fermentation of the corresponding amount of live bacteria.

[0152] The experiment lasted for 7 weeks: after one week of adaptation, the mice in the blank group were subcutaneously injected with 0.1 mL of D-galactose (1000 mg / kg) per mouse per day, and from the second week, the mice in the intervention groups were gavaged with the corresponding strain of freeze-dried powder or postbiotic freeze-dried powder (lysate and fermentation liquid) prepared from the strain at the corresponding dose dissolved in physiological saline at a volume of 0.1 mL per mouse per day. The blank group and the model group were gavaged with an equal amount of physiological saline as a control, and the experiment was continued until the end. All groups were allowed to drink and eat freely, and the experimental process is shown in Figure 4 .

[0153] After the experiment, the mice were sacrificed, and the eyeball blood was collected. After standing for 40 min, the blood supernatant was centrifuged at 3000 r / min for 20 min, and the skin tissue was cut from the back and ground to prepare a homogenate with a weight-to-volume ratio of 1:10 with PBS. The homogenate was centrifuged at 3000 r / min for 20 min, and the skin supernatant was collected and detected by an ELISA kit.

[0154] The AGE content in the mouse serum and skin was detected by an ELISA kit as shown in Figure 5 .

[0155] Serum AGE content: Compared with the control group (262.70 ng / L), the AGE content in the serum of the model group was significantly increased to 406.22 ng / L. Oral administration of plant lactobacillus CCFM1283 and its prepared metaplasma significantly reduced the content of AGE, a marker of glycation and aging in the serum of mice compared with the model group. The CCFM1283_Z group, the CCFM1283_M group, and the CCFM1283 live bacteria group reduced the AGE content in the serum to 329.72 ng / L, 267.61 ng / L, and 184.27 ng / L, respectively, which was 18.8%, 34.1%, and 54.6% lower than the model group, respectively. That is, oral administration of plant lactobacillus CCFM1283 and its prepared metaplasma (lysate and supernatant) can reduce the content of AGE in the serum of aging mice and reduce the accumulation of glycation loss.

[0156] Skin AGE content: Compared with the control group (336.76 ng / L), the AGE content in the serum of the model group was significantly increased to 463.21 ng / L. Oral administration of plant lactobacillus CCFM1283 and its prepared metaplasma significantly reduced the content of AGE, a marker of glycation and aging in the skin of mice compared with the model group. The CCFM1283_Z group and the CCFM1283_M group reduced the AGE content in the skin to 403.80 ng / L and 413.09 ng / L, respectively, which was 12.8% and 10.8% lower than the model group, respectively. Oral administration of plant lactobacillus CCFM1283 and its prepared metaplasma (lysate and supernatant) can reduce the content of AGE in the skin of aging mice and reduce the accumulation of glycation loss.

[0157] The above results show that plant lactobacillus CCFM1283 and its prepared metaplasma have the ability to alleviate the accumulation of AGE in the serum and skin of aging mice, and the improvement is obvious compared with the model group.

[0158] Example 9: Effect of plant lactobacillus CCFM1283 and its prepared metaplasma on the content of inflammatory markers in the serum and skin of aging mice

[0159] The animal experiment design and gavage group in this example are the same as those in Example 8. The TNF-α content in the serum and skin of aging mice is shown in Table 8. Figure 6

[0160] ​(1) Serum TNF-α content: compared with the control group (297.24 ng / L), the serum TNF-α content of the model group was significantly increased to 382.15 ng / L. Oral administration of the postbiotic prepared from Lactobacillus plantarum CCFM1283 significantly reduced the content of TNF-α in the serum of mice. The CCFM1283_Z group, the CCFM1283_M group and the CCFM1283 live bacteria group made the serum TNF-α content reach 278.78 ng / L, 468.95 ng / L and 346.62 ng / L, respectively. The CCFM1283_Z group and the CCFM1283 live bacteria group reduced the content of inflammatory factor TNF-α in the serum of the model group by 27.0% and 9.3%, respectively, but the CCFM1283_M group increased the content of TNF-α in the serum.

[0161] (2) Skin TNF-α content: compared with the control group (351.25 ng / L), the skin TNF-α content of the model group was significantly increased to 486.73 ng / L. Oral administration of the postbiotic prepared from Lactobacillus plantarum CCFM1283 significantly reduced the content of TNF-α in the skin of mice. The CCFM1283_Z group, the CCFM1283_M group and the CCFM1283 live bacteria group made the skin TNF-α content reach 383.09 ng / L, 426.98 ng / L and 434.11 ng / L (decreased by 21.3%, 12.3% and 10.8% compared with the model group, respectively).

[0162] From the results of related biochemical indicators in the serum of animals, it can be known that the postbiotic prepared from Lactobacillus plantarum CCFM1283 can reduce the content of inflammatory factor TNF-α in the serum and skin of aging mice, and alleviate inflammation to resist the overall aging of the host.

[0163] The animal experiment design and gavage group in this example were the same as those in Example 8. At the end of the experiment, the skin elasticity tester MPA580 instrument of Germany CK Company was used to detect the skin elasticity performance of the back of each mouse. The results are shown in Figure 7

[0164] (1) Skin elasticity performance R2 was calculated by Figure 7 ​It can be seen that compared with the blank group (82.42%), the skin elasticity of the model group was significantly reduced to 53.7%, the skin elasticity of the Lactobacillus plantarum CCFM1283_Z group (74.03%) was increased by 37.9% compared with the model group, and the skin elasticity of the CCFM1283_M group (68.95%) was increased by 28.4% compared with the model group. The Lactobacillus plantarum CCFM1283 live bacteria group also had a significant effect of restoring elasticity, and the skin elasticity was restored to 82.12%.

[0165] From the experimental results, it can be seen that the postbiotic prepared from Lactobacillus plantarum CCFM1283 significantly increases the skin elasticity of the back of the aging mouse. During the aging process, the concentration of AGE gradually increases, the synthesis of collagen is reduced after being affected by the interaction of AGE and its receptor, the function of the original structural protein is damaged, and the ability to support the cell skeleton and cell space is decreased. Exogenous supplementation of anti-glycation functional products can alleviate the changes in skin texture during the aging process, so that the postbiotic prepared from Lactobacillus plantarum CCFM1283 significantly increases the skin elasticity of the back of the aging mouse.

[0166] Example 11: Effect of Lactobacillus plantarum CCFM1283 and the postbiotic prepared therefrom on the synthesis and content of type 3 collagen in the skin of sugar-damaged aging mice

[0167] The animal experiment design and gavage groups in this example are the same as those in Example 8, and the synthesis of type 3 collagen in the skin of aging mice, the expression of genes related to the degradation of type 3 collagen, and the specific content of type 3 collagen are as shown in Figure 8 .

[0168] The skin RNA was extracted by Trizol method, and the key target gene expression in the synthesis and degradation process of type 3 collagen in the skin was detected by reverse transcription into cDNA. The primers of COL3A1 mRNA and MMP-2 mRNA are described in Table 2 below.

[0169] Table 2: Primer sequences

[0170]

[0171] The content of type III collagen in the skin of the mouse back is as shown in Figure 8As shown, compared with the blank group (7.17 μg / L), the collagen type III content of the model group was significantly reduced to 6.09 μg / L, the collagen type III content of the CCFM1283_M group (7.99 μg / L) was increased by 31.2% compared with the model group, but the collagen type III content of the CCFM1283_Z group was only 5.34 μg / L. The live bacteria of the plantaricin CCFM1283 also had a similar function of maintaining the collagen type III content (6.66 μg / L, increased by 9.4% compared with the model group), but not as good as the effect of the spontaneous fermentation supernatant of CCFM1283 (CCFM1283_M).

[0172] It can be known from the detection of the expression of COL3A1 mRNA that the plantaricin CCFM1283 and the metaplasma CCFM1283_Z prepared therefrom can significantly up-regulate the expression of the collagen type III synthesis enzyme COL3A1 mRNA, so that the relative expression amount is 1.23 and 1.86 (increased by 180.1% and 323.2% respectively compared with the model group 0.44), alleviate the abnormal decrease of the collagen type III synthesis caused by the glycation loss, and maintain the normal function of the collagen.

[0173] It can be known from the detection of the expression of MMP-2 mRNA that the plantaricin CCFM1283 and the metaplasma CCFM1283_Z prepared therefrom can significantly down-regulate the expression of the matrix metalloproteinase MMP-2 mRNA, so that the relative expression amount is 0.08 and 0.31 (decreased by 97.1% and 88.7% respectively compared with the model group 2.77), alleviate the abnormal increase of the matrix metalloproteinase 2 caused by the glycation loss, and maintain the normal function of the protein.

[0174] Example 12: Effect of the use of the plantaricin CCFM1283 and the metaplasma prepared therefrom on relieving the multi-angle glycation damage of the skin

[0175] The animal experiment design, gavage group, and RNA extraction and detection involved in this example are the same as those in Example 11, and the primers of the key genes DDOST and Cu / Zn-SOD in the skin of the aging mice are described in Table 3 below. The gene expression results of the effect of inhibiting the AGE-RAGE combination to relieve the glycation damage of the skin and the effect of inhibiting the downstream sugar damage inflammation pathway and oxidative stress pathway are shown in Figure 9 .

[0176] Table 3: Primer sequences

[0177]

[0178] (1) Effect of the metaplasma prepared from the plantaricin CCFM1283 on inhibiting the AGE-RAGE combination to relieve the glycation damage of the skin

[0179] By detecting the expression of DDOST mRNA, it is known that the metaplast CCFM1283_Z prepared by Lactobacillus plantarum CCFM1283 can increase the expression of DDOST mRNA to 1.35 (increased by 139.8% compared with the model group 0.56), and the expression of DDOST mRNA after the live bacteria CCFM1283 is still only 0.99, without obvious improvement effect. That is, the metaplast (lysis solution) prepared by oral administration of Lactobacillus plantarum CCFM1283 can compete with the binding site of RAGE and AGE by increasing the expression of DDOST, inhibit the combination of AGE-RAGE, and thus alleviate the impact of skin glycation damage.

[0180] (2) Effect of metaplast prepared by Lactobacillus plantarum CCFM1283 on inhibition of downstream sugar damage oxidative stress pathway

[0181] By detecting the expression of Cu / Zn-SOD mRNA, it is known that the metaplast CCFM1283_Z prepared by Lactobacillus plantarum CCFM1283 can increase the expression of Cu / Zn-SOD mRNA to 1.71 (increased by 204.4% compared with the model group 0.49); the live bacteria CCFM1238 group has no treatment effect on this target. That is, the metaplast (lysis solution) prepared by oral administration of Lactobacillus plantarum CCFM1283 can alleviate the subsequent glycation damage of the skin by inhibiting the impact of the downstream sugar damage oxidative stress pathway.

[0182] Example 13: Effect of Lactobacillus plantarum CCFM1283 fermented peanut skin on improving the anti-glycation ability of peanut skin for external use

[0183] The preparation of peanut skin fermentation culture solution (hsp) and Lactobacillus plantarum CCFM1283 fermented peanut skin supernatant (CCFM1283_H) is as shown in the foregoing. The construction of in vitro fructose-bovine serum albumin system and the detection of fluorescent AGE generation are as shown in Example 4.

[0184] The detection of preventing the glycation damage of HSF cells caused by methylglyoxal is as shown in Example 6.

[0185] (1) Lactobacillus plantarum CCFM1283 fermented peanut skin supernatant improves the ability of peanut skin to inhibit the generation of fluorescent AGE in vitro:

[0186] Peanut skin extract mainly contains flavonoids such as proanthocyanidins, resveratrol, and quercetin. Oligomeric proanthocyanidins possess bioactivities including free radical scavenging, antioxidant activity, cardiovascular protection, anti-inflammation, and tumor inhibition; their ability to resist glycation damage has been verified in cell experiments. However, the content of anti-glycation active substances in peanut skin is low, and their bioavailability is not high. To better utilize the anti-glycation properties of peanut skin, *Lactobacillus plantarum* CCFM1283 was used to ferment peanut skin to prepare *Lactobacillus plantarum* CCFM1283 fermented peanut skin supernatant (CCFM1283_H). The effect of *Lactobacillus plantarum* CCFM1283 on the anti-glycation ability of peanut skin was verified using a peanut skin fermentation culture medium of 100 μg / mL and the fermented peanut skin supernatant concentration.

[0187] Depend on Figure 10 It can be seen that the original inhibition rate of the fluorescent AGE formation of the fructose-bovine serum albumin system by peanut skin was 61.70%, while the inhibition rate of the supernatant after fermentation with Lactobacillus plantarum CCFM1283 reached 75.05%, which was 21.6% higher than that of the unfermented group, and the ability to inhibit AGE formation was significantly increased.

[0188] (2) Fermentation of peanut skin supernatant by Lactobacillus plantarum CCFM1283 enhances the ability of peanut skin to prevent acetone-induced decrease in HSF cell viability in vitro:

[0189] Depend on Figure 10 It was found that the original HSF cell viability after peanut skin treatment was 52.23% (an increase of 5.5% compared to the model of 54.93%), but after fermentation with *Lactobacillus plantarum* CCFM1283 and treatment with CCFM1283_H, the HSF cell viability reached 78.43% (an increase of 47.3% compared to the model of 54.93%). The anti-glycation effect of peanut skin was significantly enhanced by *Lactobacillus plantarum* CCFM1283.

[0190] Example 14: Effect of *Lactobacillus plantarum* CCFM1283 fermentation of peanut skin on enhancing the inhibition of AGE accumulation in serum and skin by oral administration of peanut skin.

[0191] The experimental setup for aging mice is as shown in Example 8. The preparation of peanut skin fermentation culture medium (hsp) and peanut skin fermentation supernatant (CCFM1283_H) by Lactobacillus plantarum CCFM1283 is as shown in Example 3. The group that was gavaged with the peanut skin synthetic preparation (live Lactobacillus plantarum CCFM1283 and peanut skin fermentation culture medium (hsp) is denoted as CCFM1283+hsp).

[0192] (1) Accumulation of AGEs in serum: by Figure 11It can be seen that although the peanut skin itself can reduce the AGE content in the serum of the aging mice to 246.95 ng / L (control group 262.70 ng / L, model group 406.22 ng / L), which is significantly reduced by 39.2% compared with the model group; but the peanut skin fermentation broth of plant lactobacillus CCFM1283 has better effect, the AGE content is reduced to 219.98 ng / L, which is reduced by 45.85% compared with the model group; the effect of peanut skin synthetic preparation group is not as good as the other two groups, which can only reduce the model group by 41.04% (AGE content 239.52 ng / L).

[0193] (2) Accumulation of AGE in the skin: from Figure 11 It can be seen that although the peanut skin itself can reduce the AGE content in the skin of the aging mice to 376.40 ng / L (control group 336.76 ng / L, model group 456.72 ng / L), which is reduced by 17.59% compared with the model group; but the peanut skin fermentation broth of plant lactobacillus CCFM1283 has better effect, the AGE content is reduced to 352.38 ng / L, which is reduced by 17.59% compared with the model group; the effect of peanut skin synthetic preparation group is not as good as the other two groups, which can only reduce the model group by 14.63% (AGE content 389.92 ng / L).

[0194] Example 15: Effect of peanut skin fermented by plant lactobacillus CCFM1283 on improving peanut skin oral administration to relieve inflammation and oxidative stress of skin caused by glycation

[0195] The experiment of aging mice was constructed as shown in Example 8; the peanut skin fermentation broth (hsp), the supernatant of peanut skin fermented by plant lactobacillus CCFM1283 (CCFM1283_H), and the peanut skin synthetic preparation gavage group (the experimental group of live plant lactobacillus CCFM1283 and peanut skin fermentation broth (hsp, referred to as CCFM1283+hsp)) were set as shown in Example 14; the detection method was shown in Example 12.

[0196] (1) Skin elasticity:

[0197] From Figure 12 It can be seen that although the peanut skin itself can increase the skin elasticity R2 of the back of the aging mice to 63.98% (control group 74.90%, model group 53.7%), which is significantly increased by 19.13% compared with the model group; but the peanut skin fermentation broth (CCFM1283_H) fermented by plant lactobacillus CCFM1283 has better effect, the skin elasticity R2 reaches 76.03% (increased by 41.6%); the effect of peanut skin synthetic preparation group is also improved, the elasticity performance reaches 74.96% (increased by 39.6% compared with the model).

[0198] (2) Skin glycation target point:

[0199] From Figure 13 It can be seen that the expression of DDOST mRNA in the control group was 1.20, and the expression of DDOST mRNA in the hsp group was increased to 0.66 (17.87% higher than the model group 0.56), but after the participation of plant lactobacillus CCFM1283, the expression of skin DDOST mRNA after oral administration of CCFM1283_H and CCFM1283+hsp was 1.18 and 1.47 (109.9% and 161.0% higher than the model group), respectively.

[0200] The content of type III collagen in the back skin of mice showed that compared with the blank group (7.17 μg / L), the content of type III collagen in the model group was significantly reduced to 6.09 μg / L, and after gavage of the hsp group, the content of type III collagen in the back skin of mice reached 7.43 μg / L (22.0% higher than the model group), and after the fermentation of plant lactobacillus CCFM1283, the content of type III collagen in the back skin of mice after gavage of CCFM1283_H and CCFM1283+hsp was 7.51 μg / L and 7.49 μg / L (23.2% and 22.9% higher than the model group), respectively.

[0201] From the above two aspects, it can be seen that the fermentation of plant lactobacillus CCFM1283 peanut skin has a positive effect on improving the oral peanut skin to relieve the skin elasticity caused by glycation and the corresponding target.

[0202] Example 16: Effect of plant lactobacillus CCFM1283 fermented peanut skin on improving the oral peanut skin to relieve the skin elasticity and oxidative stress caused by glycation

[0203] The construction of the experiment on the aging mice was as shown in Example 8; the determination of the content of skin IL-6 was imitated from the determination of the content of skin TNF-α in Example 9; the method of Cu / Zn-SOD mRNA detection was as shown in Example 12. The preparation of peanut skin fermentation broth (hsp) and plant lactobacillus CCFM1283 fermented peanut skin supernatant (CCFM1283_H) was as shown above; the gavage group of peanut skin synthetic preparation (live bacteria plant lactobacillus CCFM1283 and peanut skin fermentation broth (hsp), denoted as CCFM1283+hsp.

[0204] From Figure 14It can be seen that the expression of Cu / Zn-SOD mRNA in the hsp group was increased to 0.67 (36.94% higher than 0.49 of the model group), but after the participation of P. acnes CCFM1283, the expression of Cu / Zn-SOD mRNA in the skin after oral administration of CCFM1283_H and CCFM1283+hsp was 0.86 and 1.04, respectively (76.4% and 113.2% higher than the model group). P. acnes CCFM1283 can improve the ability of peanut coat to alleviate oxidative stress after skin glycation through fermentation.

[0205] The content of IL-6 in the skin was significantly increased to 106.01 ng / L compared with the control group (74.84 ng / L), as shown in Table 6. Figure 14 The content of IL-6 in the skin was significantly increased to 106.01 ng / L compared with the control group (74.84 ng / L), as shown in Table 6.

[0206] Although the present application has been disclosed in the above with preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, and therefore the protection scope of the present application should be defined by the claims.

Claims

1. A composition, characterized in that, The composition is *Lactobacillus plantarum* (… Lactiplantibacillus plantarum The fermentation broth of CCFM1283 after fermentation in a culture medium containing peanut skins; the Lactobacillus plantarum CCFM1283 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 14, 2022, with accession number GDMCCNo: 62885.

2. The use of *Lactobacillus plantarum* CCFM1283 or its metagenes, or the composition of claim 1, in the preparation of an anti-aging drug; wherein the anti-aging refers to alleviating the decline in skin elasticity and collagen in aging individuals; wherein the metagenes are cell cultures and / or cell lysates of *Lactobacillus plantarum* CCFM1283; wherein *Lactobacillus plantarum* CCFM1283 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on October 14, 2022, with accession number GDMCC No: 62885.

3. The application according to claim 2, characterized in that, The content of *Lactobacillus plantarum* CCFM1283 in the drug is not less than 1×10⁻⁶. 6 CFU / mL or 1×10 6 CFU / g.

4. The application according to claim 3, characterized in that, The drug contains *Lactobacillus plantarum* CCFM1283 and / or its postgenes, as well as a drug carrier.

5. The application according to claim 3, characterized in that, The drug contains *Lactobacillus plantarum* CCFM1283 and / or its postgenes, as well as pharmaceutical excipients.

6. The application according to claim 5, characterized in that, The pharmaceutical excipients include one or more of the following: fillers, flavoring agents, binders, disintegrants, lubricants, and antacids.

7. The application according to claim 5, characterized in that, The pharmaceutical excipients are excipients.

Images