Rice thion 22 gene and application thereof in regulating pollen tube growth of rice

Abstract

This invention belongs to the field of plant biotechnology, specifically disclosing a rice THION22 gene and its application in regulating rice pollen tube growth. Experiments show that the THION22 gene can regulate the growth of rice pollen tubes in the pistil, thereby affecting the seed setting rate and ultimately rice yield. This research on the regulation of rice pollen tube growth is of great significance and has application value for rice breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology, specifically the gene that regulates the growth of rice pollen tubes. Background Technology

[0002] Angiosperms require double fertilization to form seeds and complete their reproduction. This double fertilization process involves a complex and continuous interaction between the stamen and pistil. Unlike animals, plant sperm cells cannot swim independently and rely on pollen tubes to transport them to the embryo sac, the female gametophyte. Pollen from the stamen first lands on the stigma of the pistil via a specific medium. After hydration and mutual recognition, it germinates to produce pollen tubes. These pollen tubes grow between the cells of the stigma's papillae and pass through the stigma and style, ultimately reaching the designated embryo sac to complete the transport of sperm cells. During the process of pollen tubes traversing multiple cell structures to complete double fertilization, they receive numerous signaling molecules secreted by the pistil and embryo sac. Previous research has shown that the attraction of these signals is essential for angiosperms to complete double fertilization. Only by continuously receiving signaling molecules secreted by the pistil and embryo sac can the pollen tubes undergo accurate guided growth within the pistil tissue and ultimately enter the embryo sac to complete double fertilization.

[0003] Over the past two decades, researchers both domestically and internationally have used model plants such as Arabidopsis thaliana and *Hemiberlesia javanica* to study the molecular mechanisms of female-male interactions during fertilization, achieving a series of significant breakthroughs in pollen tube guidance research. Extensive experimental data have confirmed that signaling molecules secreted by female tissues and gametophyte cells interact with receptors in the pollen tube, precisely regulating pollen tube guidance. Secretory signals from the pistil include small peptides, glycoproteins, and hormones, among which the signal transduction pathway formed by secreted small peptides and receptor-like protein kinases located on the pollen tube has been found to play a crucial regulatory role in multiple processes of pollen tube guidance. Although significant progress has been made in recent years in the study of pistil-stamen interactions during plant double fertilization, and some key signaling molecules and their regulatory mechanisms have been revealed, these studies have mainly focused on the dicotyledonous model plant *Arabidopsis thaliana*, with very little research on the pollen tube guidance mechanism in important monocotyledonous food crops such as rice. What signals are secreted by rice pistil tissues that promote or attract pollen tube growth? These scientific questions urgently need to be answered. Summary of the Invention

[0004] The purpose of this invention is to provide a gene THION22 that regulates the growth of rice pollen tubes and its application. The function of this gene has important application value for the study of the interaction between rice stamens and pistils.

[0005] This invention is achieved through the following technical solution:

[0006] A rice THION22 gene, the base sequence of which is shown in SEQ ID No.1, is mainly used in regulating rice pollen tube growth.

[0007] This invention employs a CRISPR / Cas9 vector construction method to edit the THION22 gene, obtaining different THION22 mutant lines. Specifically, the method involves integrating a Cas9 protein expression cassette into a binary vector, loading multiple sgRNA expression cassette multiple cloning sites (Bsa I) near the RB position of the binary vector, mounting the sgRNA expression cassette elements onto an intermediate plasmid vector, splicing them together via enzyme digestion, ligation, and PCR, and then assembling them into a binary vector using the Golden Gate or Gibson Assembly cloning method to achieve THION22 gene editing.

[0008] The specific method for constructing the vector for rice THION22 gene replacement lines of this invention is as follows:

[0009] (1) Using the genomic DNA of wild-type rice ZH11 as a template, the promoter 2500 bp upstream of the start codon ATG of the THION22 gene was amplified by PCR using THION22-Pro-F / R primers;

[0010] (2) Using cDNA from mature rice spikelet tissue as a template, the CDS sequence of the THION22 gene was amplified using THION22-CDS-F / R primers, see details;

[0011] (3) Using the two PCR fragments in (1) and (2) as templates, the two fragments are amplified together using primers at both ends, and the fragments are recovered after detection by gel electrophoresis.

[0012] (4) Ligate the PCR fragment from (3) to pENTR TM The / D-TOPO vector was verified by sequencing, and then recombined into the target vector pGWB504 via LR reaction. The resulting rice reintroduced lines were then transformed into the thion22 mutant using Agrobacterium tumefaciens transformation.

[0013] This invention relates to the observation and statistical analysis of the grain filling rate of mature rice panicles. Different rice varieties were grown in a greenhouse under the following conditions: temperature 26℃~28℃, air humidity 50%, 14 hours of light, and 10 hours of darkness. Once the rice matured, the panicles were cut off for grain filling rate analysis. At least 30 rice plants of each variety were counted, with 1-2 panicles on each main stem.

[0014] The specific operation method for observing the growth of pollen tubes regulated by the THION22 gene in the pistil according to the present invention is as follows:

[0015] (1) Prepare FAA fixative: 50% ethanol, glacial acetic acid and formaldehyde are prepared in a volume ratio of 89:6:5, and 10mol / L NaOH solution is prepared for later use;

[0016] (2) Take naturally flowering or artificially pollinated flowers 1.5-2 hours after artificial pollination and fix them with FAA fixative;

[0017] (3) After fixing for 24 hours, place it in a series of 70%, 50%, and 30% alcohols for dehydration, each step for 10-12 minutes. Finally, rehydrate it in distilled water and rinse it 2-3 times.

[0018] (4) Then place it in a pre-prepared 10mol / L NaOH solution, soak it in a 56℃ water bath for 5-8 minutes, rinse it several times with distilled water, and then stain it with 0.1% aniline blue for 10-12 hours.

[0019] (5) Finally, observe the attachment and germination of pollen on the stigma and the elongation of pollen tubes under a laser confocal microscope.

[0020] The beneficial effects of this invention are as follows: The rice THION22 gene of this invention can regulate the growth of rice pollen tubes in the pistil, thereby affecting the seed setting rate of rice and ultimately affecting the yield. It is of great significance to the study of rice pollen tube growth regulation and has certain application value for rice breeding work. Attached Figure Description

[0021] Figure 1 This invention presents the results of the structure and gene editing identification of the THION22 gene, which regulates rice pollen tube growth. The figure shows homozygous mutants with three editing methods, named thion22-9, thion22-14, and thion22-16.

[0022] Figure 2 This is a statistical chart showing the seed setting observation and seed setting rate of panicles at maturity for different rice varieties. Figure A shows the seed development in panicles of wild-type Zhonghua 11 (ZH11), thion22 mutants (thion22-9 and thion22-14), and the reintroduced line (Com#); Figure B shows the statistical chart of seed setting rate for ZH11, thion22 mutants (thion22-9 and thion22-14), and Com#.

[0023] Figure 3Figures show the growth of pollen tubes in the pistil of different rice varieties. Figures A, B, and C show the aniline blue staining results of the pistils of the ZH11 and thion22 mutants (thion22-14) and the reintroduced lines 2 hours after self-pollination, respectively; Figure D is a statistical chart showing the probability that the pollen tubes can grow normally in the pistil and reach the bottom of the ovule 2 hours after pollination. Detailed Implementation

[0024] The present invention is illustrated by the following embodiments, but these are not intended to limit the scope of the invention.

[0025] Example

[0026] I. Construction of the carrier

[0027] 1. Construction of CRISPR / Cas9 vector:

[0028] The gene editing system used in this study is the CRISPR / Cas9 system modified by Professor Liu Yaoguang's research group at South China Agricultural University in 2015. This system utilizes a binary system, integrating the Cas9 protein expression cassette into a binary vector. Multiple sgRNA expression cassette multiple cloning sites (Bsa I) are loaded near the RB position of the binary vector. The sgRNA expression cassette elements are mounted on an intermediate plasmid vector, which can be spliced ​​together using enzyme digestion ligation and PCR methods. Then, using the Golden Gate or Gibson Assembly cloning method, it is assembled into a binary vector, ultimately achieving gene editing of the THION22 gene. The specific operation is as follows:

[0029] (1) Target site selection and primer design: Selecting appropriate target sites is crucial. Enter the locusID of the THION22 gene on the CRISPR-GE online website (http: / / skl.scau.edu.cn / targetdesign / ), click "Design Target Sites," and the system will automatically output candidate target sites. Select two target sites with low off-target probability and suitable GC content from the output results. The sequences are Target1 (TGTCCAGGATCTGCAGATGC) and Target2, respectively.

[0030] (AGTTGGGCAAGCATTCGTG).

[0031] (2) The two primers of the target gene were paired complementaryly by PCR: 2 μL of each primer was added, and 46 μL of water was added to a 50 μL system. The PCR reaction program was: 95℃, 5 min; 25℃, 20 min. The target site fragment was installed on the sgRNA vector by using restriction endonuclease BsaI and T4DNALigase through a ligation method of cutting and ligating simultaneously.

[0032] (3) Using specific adapter primers UF / gR-R and pps-GGL / pps-GGR (see Table 1), the cassette fragment of the sgRNA expression cassette was amplified by two rounds of nested PCR and the adapter with the BsaI restriction site was added. The products of the two rounds of nested polymerase chain reaction were detected by 1% agarose gel electrophoresis. The correct target band was obtained within 750 bp, and the PCR reaction products were recovered.

[0033] (4) The PCR product obtained in step (3) is ligated into the Cas9 vector by restriction endonuclease BsaI and T4DNALigase through a ligation method of cutting and ligating simultaneously. After verification, the plasmid is extracted and the recombinant plasmid is introduced into Agrobacterium EHA105 by electroporation.

[0034] (5) Using the Agrobacterium-mediated rice genetic transformation system, the constructed crispr recombinant plasmid was transferred into the callus induced by mature seeds of wild-type Zhonghua 11 (ZH11). Gene-edited positive seedlings were obtained after screening, differentiation and PCR identification.

[0035] (6) Primers (THION22T1-YZ-F / R, THION22T2-YZ-F / R) were designed approximately 250 bp before and after the target site of the THION22 gene. The fragment containing the target site was amplified by PCR and sequenced. Comparative analysis revealed two homozygous mutant lines (thion-9 and thion-14) at target site Target1, and one homozygous mutant line (thion-16) at target site Target2. All three homozygous mutant lines exhibited frameshift mutations leading to premature termination of translation. Figure 1 As shown in the figure. Through careful analysis, it was found that the protein sequence differences between the thion-14 and thion-16 mutants were small. Therefore, the thion-9 and thion-14 lines were subsequently selected for experimental analysis.

[0036] Table 1 Primers used in this invention

[0037]

[0038] 2. Construction of carriers for reintroduced strains

[0039] (1) Using the genomic DNA of wild-type ZH11 as a template, the promoter 2500 bp upstream of the start codon ATG of the THION22 gene was amplified by PCR using the THION22-Pro-F / R primers in Table 1.

[0040] (2) Using cDNA from mature spikelet tissue as a template, the CDS sequence of the THION22 gene was amplified using the THION22-CDS-F / R primers in Table 1, as detailed in SEQ ID No. 1;

[0041] (3) Using the two PCR fragments in (1) and (2) as templates, the two fragments are amplified together using primers at both ends, and the fragments are recovered after detection by gel electrophoresis.

[0042] (4) Ligate the PCR fragment from (3) to pENTR TM The / D-TOPO vector (Invitrogen) was validated by sequencing, then recombined into the target vector pGWB504 via LR reaction, and transformed into the thion22 mutant using Agrobacterium tumefaciens transformation to obtain the complemented line (Com#).

[0043] SEQ ID No. 1: CDS sequence of the rice THION22 gene

[0044] ATGGAGGTGAAGAAGGTGGCCATGGTTGCTGTCTGCTGCATGTTCATACTGCTGTTTCCAGGCCAGCAGCAGCAGGCTGGCTGCCATGTCCAGGATCTGCAGATGCTACCACGAATGCTTGCCCAACTGCGGCCTGCGCAATTCTCGCTCCTTCTGCAAGGTGTTCTGCGGCAGCTGCTGC GTCTTCAATCCAGTTCACAATTGCACTAGCACCGATGCGGCGGCCGCGGCGCCAGCGATCGCCGGAGACGACTGCAGAATGATCTGCCTGAACTCCTTCTGCGGCGAGGCAGCTACAGGCTACTCGGGGCGAAACGATGCTGATGCTGCAGCTTGTCTCGATGGCTGCAGCAAAGGATGA

[0045] II. Phenotypic Observation and Statistics

[0046] 1. Observation and statistics of seed setting rate:

[0047] Wild-type ZH11, thion22 mutants (thion22-9 and thion22-14), and the reintroduced line (Com#) rice were planted in a controlled intelligent greenhouse with the following conditions: temperature 26℃~28℃, air humidity 50%, 14h light and 10h darkness. After the rice matured, the panicles were cut and the seed setting rate was statistically analyzed (e.g., ...). Figure 2As shown in the figure, at least 30 rice plants of each variety should be counted, and only 1 to 2 panicles on each main stem should be counted.

[0048] Depend on Figure 2 It was found that the thion22 mutant rice had fewer grains at maturity and matured slower than the wild-type ZH11 rice, with most of the grains remaining green and not fully turning color. The grain setting rate of thion22-9 was 42% (n=35), and that of thion22-14 was 45% (n=34), which were significantly lower than the 90% (n=30) grain setting rate of the wild-type ZH11. After reintroducing pTHION22::THION22 into the mutant (introduced line Com#), normal grain setting was achieved, and the morphology and color at maturity were no different from the wild type. The grain setting rate was restored to normal, reaching 88% (n=45).

[0049] 2. Observation of pollen tube growth in the pistil

[0050] It takes about 45 minutes for rice pollen to fall onto the stigma and for the pollen tube to elongate and reach the ovule. Therefore, it is necessary to closely observe the flowering time of the material and mark it.

[0051] (1) Prepare the FAA fixative: (V50% ethanol:Vglacial acetic acid:Vformaldehyde = 89:6:5), and 10mol / L NaOH solution for later use;

[0052] (2) The spikelets of wild-type ZH11, thion22 mutant (thion22-14) and reintroduced line (Com#) rice were fixed with FAA fixative about 2 hours after natural flowering;

[0053] (3) After fixing for 24 hours, place it in a series of 70%, 50%, and 30% alcohols for dehydration, each step for about 10 minutes. Finally, rehydrate it in distilled water and rinse it 2-3 times.

[0054] (4) Then place it in a pre-prepared 10mol / L NaOH solution, soak it in a 56℃ water bath for 5-8 minutes, rinse it several times with distilled water, and then stain it with 0.1% aniline blue for 10-12 hours (it can be left overnight).

[0055] (5) Finally, observe and photograph the attachment and germination of pollen on the stigma and the elongation of pollen tubes under a laser confocal microscope (Leica SP2). Figure 3 As shown, the probability of pollen tubes growing normally in the pistil and reaching the bottom of the ovule is calculated.

[0056] Figure 3The figures show the pollen tube growth in the pistils of wild-type ZH11, thion22 mutants, and the replacement line Com# two hours after pollination (white arrows indicate the location of pollen tube growth). Results showed that in the wild-type ZH11 pistil, 91% (n=104) of pollen tubes germinated from the stigma and reached the ovule (Figures A and D). In the thion22 mutant, only 63% (n=138) of pollen tubes reached the ovule, and 37% (n=138) of pollen tubes remained at the style, resulting in a decreased seed set rate (Figures B and D). When pTHION22::THION22 was replaced in the thion22 mutant, 85% of pollen tubes reached the ovule, significantly increasing the proportion of normally growing pollen tubes in the thion22 mutant (Figures C and D). Experimental results show that the deletion of the THION22 gene affects the elongation of rice pollen tubes. After pTHION22::THION22 was reintroduced into the mutant (introduced line Com#), the pollen tubes were able to resume normal growth.

[0057] The above observation experiments on rice seed setting rate and pollen tube growth in the pistil show that the THION22 gene has a regulatory effect on rice pollen tube growth, which affects the seed setting rate of rice. The THION22 gene can be edited according to experimental requirements to regulate rice pollen tube growth, thereby obtaining rice varieties needed for production and experimental research.

Claims

1. Use of a rice THION22 gene characterized in that, The rice THION22 The base sequence of the gene is shown as SEQ ID No. 1, and the application thereof in regulating pollen tube growth of rice.

2. The rice plant of claim 1 THION22 application of the gene, characterized in that, The CRISPR / Cas 9 vector was constructed by the method of gene editing, and different THION22 gene deletion mutant strains were obtained. thion 22 gene deletion mutant strains were obtained.

3. The rice plant of claim 2 THION22 application of the gene, characterized in that, The specific method for constructing the CRISPR / Cas 9 carrier is as follows: the Cas9 protein expression box is integrated into the binary carrier, and multiple sgRNA expression boxes are loaded into the multiple cloning site Bsa I near the RB of the binary carrier, the sgRNA expression box elements are installed on the intermediate plasmid carrier, which are spliced by enzyme cutting and connection and PCR method, and then assembled into the binary carrier by Golden Gate or Gibson Assembly cloning method, so as to realize the gene editing of the sgRNA expression box elements to the target gene. THION22 gene editing.

4. The rice plant of claim 2 THION22 application of the gene, characterized in that, Rice THION22 The vector construction of the gene back-supplying line is carried out by the following specific method: (1) The genomic DNA of wild-type rice ZH11 was used as a template, and the promoter 2500 bp upstream of the start codon ATG of the gene was amplified by PCR using the primers THION22-Pro-F / R THION22 The promoter 2500 bp upstream of the start codon ATG of the gene was amplified by PCR using the primers​ (2) The CDS sequence of the gene was amplified by using the cDNA of rice spikelet tissue at the mature stage as template and the primers THION22-CDS-F / R THION22 ​​ (3) The two PCR fragments in (1) and (2) are simultaneously used as templates, and the two fragments are amplified together by using primers at both ends, and after gel electrophoresis detection, the fragments are recovered; (4) The PCR fragment in (3) is ligated into pENTRTM / D-TOPO vector and verified by sequencing, then recombined into the destination vector pGWB504 by LR reaction, and transformed into Agrobacterium tumefaciens by Agrobacterium tumefaciens transformation method thion22 Rice backcross lines are obtained in the gene deletion mutants.

5. The rice plant of claim 4 THION22 application of the gene, characterized in that, The THION22-Pro-F The primer is GGCCGCCCCCTTCACCGCGCAGTGATGCTTACAGAT; The THION22-Pro- R The primer is CTTCTTCACCTCCATTGATGCGATTCTTCT.

6. The rice plant of claim 4 THION22 application of the gene, characterized in that, The THION22-CDS-F The primer is AGAAGAATCGCATCAATGGAGGTGAAGAAG; the THION22-CDS- R The primer is CGGCGCGCCCACCCTTCCTTTGCTGCAGCCATCGAGAC.

7. The rice plant of claim 4 THION22 application of the gene, characterized in that, The observation and statistics of the seed setting rate of mature rice panicles of rice are carried out by planting different strains of rice in a greenhouse environment, and the conditions are set as follows: temperature 26-28℃, air humidity 50%, light 14h, and darkness 10h; after the rice grows to maturity, the panicles are cut off for seed setting rate statistics.

8. The rice plant of claim 7 THION22 application of the gene, characterized in that, At least 30 rice plants of each strain are counted, and 1-2 panicles on each main stem are counted.

9. The rice plant of claim 4 THION22 application of the gene, characterized in that, THION22 The growth of pollen tube in the pistil was observed by gene regulation. (1) Prepare FAA fixing solution: 50% ethanol, glacial acetic acid, and formaldehyde are configured according to the volume ratio of 89:6:5, and 10 mol / L NaOH solution is prepared; (2) The legume flowers after natural flowering or artificial pollination for 1.5-2 hours are fixed with FAA fixing solution; (3) After 24 hours of fixation, they are sequentially placed in 70%, 50%, and 30% series of alcohol for dehydration, each step for 10-12 minutes, and finally rehydrated in distilled water, washed for 2-3 times; (4) Then put into the pre-prepared 10 mol / L NaOH solution, soak in the 56℃ water bath for 5-8 minutes, then wash several times with distilled water, and then dye with 0.1% aniline blue for 10-12 hours; (5) Finally, observe the pollen adhesion and germination on the stigma and the pollen tube elongation under the laser confocal microscope.

Images