Application of rice grain weight gene ostgw12
By cloning and validating the rice grain weight gene OsTGW12, and knocking out OsTGW12 using the CRISPR-Cas9 system, it was found that its non-synonymous mutation affects grain shape, thus solving the problem of rice grain shape regulation and increasing rice yield.
Patent Information
- Application Number
- CN202311635548.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-01
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2043-12-01
AI Technical Summary
The regulatory mechanisms of rice grain shape and weight are unclear, which affects the breeding progress of high-yield and high-quality rice varieties. It is necessary to explore new grain shape and weight genes to improve rice yield.
The rice grain weight gene OsTGW12 was cloned and validated. The gene was knocked out using the CRISPR-Cas9 gene editing system. By constructing a super rice population and conducting haplotype analysis, it was found that non-synonymous SNP mutations affect grain width and thousand-grain weight, providing an application for OsTGW12 in rice trait prediction and breeding.
The application of OsTGW12 clarified the grain shape regulation mechanism, and achieved effective regulation of grain length, grain width and thousand-grain weight, thereby increasing rice yield.
Smart Images

Figure CN117625829B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, in particular to the application of rice grain weight gene OsTGW12. BACKGROUND
[0002] Rice is one of the most important staple foods in the world, and the increasing world population makes it urgent to improve rice yield. Panicle number, grain number per panicle and 1000-grain weight are the three factors of rice yield, and 1000-grain weight is related to grain type. Grain type includes grain length, grain width and grain thickness, which determines the size of 1000-grain weight.
[0003] In recent years, based on map-based cloning or genome-wide association study (GWAS), researchers have isolated many quantitative trait locus (QTL) genes related to grain type in rice. The molecular regulatory network of the interaction between several grain type and grain weight genes has also been preliminarily explored.
[0004] The mining of these QTL genes and the corresponding molecular regulatory network has promoted the development of high-yield and high-quality rice variety breeding. However, the interaction and mode between many grain type and grain weight genes are still unclear, and the regulation mechanism of rice grain type and grain weight is still not very clear. Therefore, it is necessary to further mine new rice grain type and grain weight genes to further clarify the regulation mechanism. SUMMARY
[0005] Therefore, the application of rice grain weight gene OsTGW12 provided by the present application lays a solid theoretical foundation for further improving rice yield, and has very important theoretical value and practical significance.
[0006] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0007] The present application provides the application of rice grain weight gene OsTGW12 in any of the following:
[0008] (I) rice trait prediction;
[0009] (II) rice breeding;
[0010] (III) preparation of products for predicting rice traits;
[0011] (IV) preparation of products for rice breeding;
[0012] The rice grain weight gene OsTGW12 is located at position 25920639-25927353 on chromosome 12.
[0013] In some specific embodiments of the present application, the rice in the above-mentioned application is Asian rice.
[0014] In some embodiments of the present application, the rice grain weight gene OsTGW12 has the nucleotide sequence as set forth in SEQ ID NO: 1.
[0015] In some embodiments of the present application, the rules for predicting the rice traits in the above-mentioned application include:
[0016] (i) if the deletion of the 86th base of the rice grain weight gene OsTGW12, the grain length of the rice is shorter, the grain width is narrower, and / or the thousand-grain weight is smaller; or
[0017] (ii) if the 2396th base of the rice grain weight gene OsTGW12 is T, the grain length of the rice is longer, the grain width is wider, the thousand-grain weight is larger, and / or the young ear expression amount is smaller; or
[0018] (iii) if the haplotype of the rice grain weight gene OsTGW12 is Hap.2, the grain length of the rice is longer, the grain width is wider, the thousand-grain weight is larger, and / or the young ear expression amount is smaller;
[0019] the 931st base of Hap.2 is T, the 1522nd base is G, the 1843rd base is G, the 1921st-1922nd bases are GT, the 1926th base is A, and the 2396th base is T.
[0020] In some embodiments of the present application, the breeding in the above-mentioned application includes:
[0021] (1) eliminating the rice with shorter grain length, narrower grain width, smaller thousand-grain weight, and / or larger young ear expression amount based on the rice grain weight gene OsTGW12; and / or
[0022] (2) selecting the rice with longer grain length, wider grain width, larger thousand-grain weight, and / or smaller young ear expression amount based on the rice grain weight gene OsTGW12 for breeding.
[0023] In some embodiments of the present application, the rules for breeding in the above-mentioned application include:
[0024] (a) eliminating the rice with frame-shift mutation of the rice grain weight gene OsTGW12;
[0025] the deletion includes the deletion of the 86th base of the rice grain weight gene OsTGW12;
[0026] (b) selecting the rice with T at the 2396th base of the rice grain weight gene OsTGW12 for breeding; or
[0027] (c) selecting the rice with Hap.2 haplotype of the rice grain weight gene OsTGW12 for breeding.
[0028] the 931th base of Hap.2 is T, the 1522th base is G, the 1843th base is G, the 1921th and 1922th bases are GT, the 1926th base is A and the 2396th base is T.
[0029] The application also provides a primer set for amplifying a fragment containing the 2396th nucleotide of the rice grain weight gene OsTGW12.
[0030] In some embodiments of the application, the fragment in the primer set described above further contains one or two or more of the 931th base, the 1522th base, the 1843th base, the 1921th base, the 1922th base, the 1926th base or the 2396th base of the rice grain weight gene OsTGW12.
[0031] The application also provides a reagent or kit, which comprises the primer set described above, and acceptable adjuvants or aids.
[0032] The application also provides a method for predicting the traits of rice, which comprises predicting based on the rice grain weight gene OsTGW12.
[0033] The rice grain weight gene OsTGW12 has a nucleotide sequence as shown in SEQ ID NO: 1.
[0034] The rules of the prediction include:
[0035] (i) if the 86th base of the rice grain weight gene OsTGW12 is deleted, the grain length of the rice is shorter, the grain width is narrower and / or the thousand-grain weight is smaller; or
[0036] (ii) if the 2396th base of the rice grain weight gene OsTGW12 is T, the grain length of the rice is longer, the grain width is wider, the thousand-grain weight is larger and / or the young ear expression amount is smaller; or
[0037] (iii) if the haplotype of the rice grain weight gene OsTGW12 is Hap.2, the grain length of the rice is longer, the grain width is wider, the thousand-grain weight is larger and / or the young ear expression amount is smaller.
[0038] the 931th base of Hap.2 is T, the 1522th base is G, the 1843th base is G, the 1921th and 1922th bases are GT, the 1926th base is A and the 2396th base is T.
[0039] In some embodiments of the application, the method for predicting the traits of rice described above further comprises amplifying the rice with the primer set described above, the reagent or kit described above, aligning the sequences and obtaining the prediction results.
[0040] The application further provides a method for breeding rice, comprising breeding based on a rice grain weight gene OsTGW12.
[0041] The rice grain weight gene OsTGW12 has a nucleotide sequence as shown in SEQ ID NO: 1.
[0042] The breeding rules comprise:
[0043] (a) eliminating the rice with a frame-shift mutation of the rice grain weight gene OsTGW12;
[0044] The deletion comprises deletion of the 86th base of the rice grain weight gene OsTGW12.
[0045] (b) selecting rice with the 2396th base of the rice grain weight gene OsTGW12 being T for breeding; or
[0046] (c) selecting rice with a haplotype of the rice grain weight gene OsTGW12 being Hap.2 for breeding.
[0047] The 931st base of the Hap.2 is T, the 1522nd base is G, the 1843rd base is G, the 1921st-1922nd bases are GT, the 1926th base is A, and the 2396th base is T.
[0048] In some specific embodiments of the application, the method for breeding rice described above further comprises amplifying the rice with the primer set, the reagent or the kit described above, aligning the sequences, and selecting the superior rice to complete the breeding.
[0049] The application of the rice grain weight gene OsTGW12 of the application has the following effects:
[0050] 1. Experiments prove that, compared with the wild type, the mutant with OsTGW12 knocked out shows the phenotype of reduced grain length, grain width and thousand-grain weight, proving the function of the gene OsTGW12 in controlling the grain type of rice.
[0051] 2. The pan-genome sequence analysis of the constructed super rice population (including Asian wild rice, Asian cultivated rice, African short-tongue wild rice and African cultivated rice) finds that the gene can be divided into 5 haplotypes according to the non-synonymous mutation in the coding region, wherein Hap.1 and Hap.2 exist in Asian rice, and Hap.3-Hap.5 exist in African rice. The phenotype and expression amount analysis of the Asian cultivated rice with a corresponding phenotype group and young ear transcriptome finds that only the non-synonymous SNP mutation at the +2396 position exists in the Asian rice population, and the mutation can lead to smaller young ear expression amount of Hap.2 compared with Hap.1, wider grain width and larger thousand-grain weight. BRIEF DESCRIPTION OF DRAWINGS
[0052] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings required to be used in the embodiments or the prior art description will be briefly introduced below.
[0053] Figure 1 For OsTGW12 gene function verification, wherein A shows the first exon single base deletion; B shows the frameshift mutation leading to loss of protein function; C shows the phenotype comparison of wild type and mutant; D shows the comparison of thousand kernel weight of wild type and mutant; E shows the comparison of kernel length of wild type and mutant; F shows the comparison of kernel width of wild type and mutant;
[0054] Figure 2 For haplotype analysis of genes in natural population, wherein A shows that OsTGW12 gene is divided into 5 haplotypes according to non-synonymous mutations in coding region; B shows phenotype and expression amount analysis. DETAILED DESCRIPTION
[0055] The present application discloses the application of rice grain weight gene OsTGW12, and those skilled in the art can refer to the content of the present application to improve the process parameters. It should be particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.
[0056] The present application belongs to the technical field of plant genetic engineering. Specifically, it relates to the cloning, function verification and application of rice grain weight gene OsTGW12, and the cloning of new rice grain weight gene and the study of its genetic and developmental mechanism can lay a solid theoretical foundation for further improving rice yield, and has very important theoretical value and practical significance. The present application knocks out OsTGW12 based on the CRISPR-Cas9 gene editing system, and verifies the function of the gene. In order to tap the breeding potential of the gene, the haplotype of the gene is analyzed by using the super pan-genome and transcriptome constructed by 251 rice micro-core germplasm. Specifically:
[0057] 1. The sequence of the rice grain weight gene OsTGW12 is shown in SEQ ID NO: 1, which is located on the 12th chromosome of rice, and the gene controls the grain type of rice plants.
[0058] 2. It is found that the above-mentioned rice grain weight gene OsTGW12 has non-synonymous SNP mutations in the Asian rice population, which can lead to an increase in kernel width and thousand kernel weight, thereby improving rice yield.
[0059] The application provides use of a rice candidate gene OsTGW12: knocking out the gene OsTGW12 in a parent, and the parent shows phenotypes of decreased grain length, grain width and 1000-grain weight.
[0060] As an improvement of use of the rice grain type control gene OsTGW12 in the application: a new breeding scheme for the non-coding region of the gene is proposed.
[0061] The application also provides functional verification of knocking out the gene OsTGW12 in the parent 9311, due to the deletion of a single base in the first exon, which finally leads to frame shift mutation of the protein and early termination of expression in the mutant, resulting in loss of protein function, as shown in B of Figure 1 .
[0062] The application also provides functional verification of knocking out the gene OsTGW12 in the parent 9311, and compared with the wild type, the mutant shows phenotypes of decreased grain length, grain width and 1000-grain weight, as shown in C to F of Figure 1 .
[0063] The application also provides that the OsTGW12 gene can be divided into five haplotypes according to non-synonymous mutations in the coding region, as shown in A of Figure 2 .
[0064] The application also provides phenotype and expression amount analysis of the OsTGW12 gene in O. sativa, as shown in B of Figure 2 .
[0065] The verification process of the application is as follows:
[0066] 1. Functional verification of the candidate gene OsTGW12
[0067] In order to verify the function of the candidate gene OsTGW12, OsTGW12 is knocked out in 9311. OsTGW12 is knocked out in the 9311 background by CRISPR-Cas9, and a homozygous mutant with 1bp deletion at the first exon is obtained (as shown in A of Figure 1 ). Due to the deletion of a single base in the first exon, the protein finally undergoes frame shift mutation and early termination of expression in the mutant, resulting in loss of protein function (as shown in B of Figure 1 ). At the same time, compared with the wild type, the mutant shows phenotypes of decreased grain length, grain width and 1000-grain weight (as shown in C to F of Figure 1 ), which proves the function of the gene OsTGW12 in controlling the grain type of rice.
[0068] 2. A non-synonymous SNP variation in the OsTGW12 gene region can lead to increased grain width and 1000-grain weight
[0069] Using the constructed super rice population (including O. meridionalis, O. sativa, O. glumaepatula and O. sativa) pan-genome sequence analysis, it can be found that the gene can be divided into 5 haplotypes according to the non-synonymous mutation of the coding region. Among them, Hap.1 and Hap.2 exist in Asian rice, and Hap.3-Hap.5 exist in African rice. The phenotype and expression amount of the Asian cultivated rice with corresponding phenotype group and young ear transcriptome are analyzed, and it is found that only the non-synonymous SNP mutation at the position +2396 exists in the Asian rice population, which can cause the young ear expression amount to be smaller compared with Hap.2 and Hap.1, and the grain width to be wider and the thousand-grain weight to be larger.
[0070] The sequence information related to the present application is as follows:
[0071] SEQ ID NO:1 is the DNA sequence of the OsTGW12 gene of 9311 variety, and the sequence length is 6711 bp:
[0072]
[0073]
[0074]
[0075] SEQ ID NO:2 is the amino acid sequence of OsTGW12:
[0076]
[0077] Unless otherwise specified, the raw materials, reagents, consumables and instruments related to the present application are ordinary market products, which can be purchased from the market.
[0078] The present application will be further described below in combination with examples:
[0079] Example 1: Cloning and function verification of gene OsTGW12
[0080] 1. Cloning of candidate gene OsTGW12
[0081] (1) Extract the total DNA of 9311, and use the forward primer 163-OsTGW12-F and the reverse primer 163-OsTGW12-R of the OsTGW12 gene to perform PCR amplification of the OsTGW12 coding sequence with the DNA as a template. The sequences of the forward and reverse primers are as follows:
[0082] 163-OsTGW12-F (SEQ ID NO:3):
[0083] ggagaggacagcccaagcttATGTGAAGACCAGAGAGAAG,
[0084] 163-OsTGW12-R (SEQ ID NO: 4):
[0085] cccttgctcaccatggatccTTGCTCAAAGCATACACACA.
[0086] (2) PCR reaction system: 10x buffer 10.0 μL, 2.5 mM dNTPs 8.0 μL, Primer STARTaq enzyme (Takara) 1.0 μL, template cDNA 4.0 μL, 5.0 μL of forward and reverse primers (primer concentration 10 μM) respectively, add water to 100 μL.
[0087] (3) PCR amplification program: 98°C pre-denaturation 3 min; 98°C denaturation 30 s, 60°C annealing 30 s, 72°C extension 1 kb / 1 min, cycle 34 times; 72°C extension 6 min again.
[0088] (4) The PCR amplification product was subjected to nucleic acid electrophoresis separation on a 1% agarose gel, and the result was recorded after staining with nucleic acid dye under ultraviolet light. The OsTGW12 gene PCR product was recovered by cutting the gel. The electrophoresis band was recovered by Axygen gel recovery Kit.
[0089] (5) The recovered product was recombined with pJIT163-GFP vector digested with HindIII and BamHI, and Escherichia coli transformation, plating, colony selection and sequencing were performed, and the OsTGW12 gene was successfully cloned.
[0090] 2. Construction of OsTGW12 gene editing vector and genetic transformation and verification
[0091] (1) A pair of target adapter primers OsTGW12-gRNA-F1 and OsTGW12-gRNA-R1 were designed using Beijing Weishanglidesheng Biological Technology Co., Ltd. Cas9 / gRNA plasmid construction kit (Catalog. No. VK005-01).
[0092] The target adapter primer pair includes: OsTGW12-gRNA-F1 and OsTGW12-gRNA-R1.
[0093] OsTGW12-gRNA-F1 sequence is as follows (SEQ ID NO: 5):
[0094] CAGCGTGTACCGGACGTACTTCC;
[0095] OsTGW12-gRNA-R1 sequence is as follows (SEQ ID NO: 6):
[0096] AACGGAAGTACGTCCGGTACACG.
[0097] (2) oligo dimer preparation: OsTGW12-gRNA-F1 and OsTGW12-gRNA-R1 were dissolved in ddH2O to 10 μM stock solution, respectively, 5 μL of each was added to the same container, ddH2O was added to make up the volume to 25 μL, then 90℃ treatment for 30 min, 95℃ to 25℃ slow cooling (for example -1℃ / 20s or the sample tube was placed in 95℃ water), natural cooling to room temperature, 16℃ for 5 min, to obtain oligo dimer.
[0098] (3) oligo dimer insertion into the vector: Cas9 / gRNA Vector 1 μL, oligo dimer 1 μL, Solution 1 and Solution 2 1 μL each, ddH2O was added to make up the volume to 10 μL, the reaction system was placed in PCR instrument, 16℃ reaction for 2h, after the reaction, the ligation product was obtained.
[0099] (4) transformation: 5-10 μL of ligation product was added to 50 μL of just thawed DH5a competent cells, mixed gently, ice bath for 30 min, 42℃ heat shock for 90s, ice for 2 min, then add 500 μL of LB without antibiotics, placed in 37℃ constant temperature incubator, 170 rpm, recovered for one hour, then plated on kanamycin-resistant plates.
[0100] (5) identification of positive clones: 3 to 5 white colonies were selected for shaking culture, and sequencing was performed.
[0101] 3, function verification of candidate gene OsTGW12: in order to verify the function of candidate gene OsTGW12, the positive knockout vector obtained above was transformed in 9311 rice to knockout OsTGW12. By CRISPR-Cas9, OsTGW12 was knocked out in 9311 background, and a homozygous mutant with 1 bp deletion at the first exon was obtained (as shown by A in Figure 1 Due to this single base deletion of the first exon, the protein eventually undergoes frameshift mutation and premature termination of expression in the mutant, resulting in loss of protein function (as shown by B in Figure 1 At the same time, compared with the wild type, the mutant showed the phenotype of decreased grain length, grain width and thousand-grain weight (C to F in Figure 1 , corresponding data are shown in Table 1). This also proves the function of gene OsTGW12 in controlling the grain type of rice.
[0102] Table 1
[0103] Thousand Kernel Weight Kernel Length Kernel Width 93111-1 30 9.3 2.8 93111-2 31 9.1 2.7 93111-3 30.5 8.8 2.6 93111-4 30.5 9.1 2.8 93111-5 29.5 9.1 2.7 93111-6 29.25 8.9 2.8 93111-7 30.25 8.9 2.8 93111-8 29.75 9.2 2.7 93111-9 30.25 9 2.8 93111-10 29 9.1 2.9 ostgw12-1 19 8.5 2.2 ostgw12-2 18.75 8.4 2.1 ostgw12-3 18.75 8.5 2.0 ostgw12-4 19.5 8.5 2.0 ostgw12-5 21 8.6 2.1 ostgw12-6 20.75 8.4 2.1 ostgw12-7 20.25 8.6 2.2 ostgw12-8 20.25 8.8 2.1 ostgw12-9 20 8.6 2.1 ostgw12-10 20.75 8.7 2.0
[0104] Example 2: OsTGW12 haplotype analysis in natural populations
[0105] The present application uses the constructed super rice population (including O. meridionalis, O. sativa, O. glumaepatula and O. sativa) pan-genome sequence analysis, which can find that the gene can be divided into five haplotypes according to the non-synonymous mutations in the coding region (as shown in A of Figure 2 , wherein Hap.1 and Hap.2 exist in Asian rice, and Hap.3-Hap.5 exist in African rice. Phenotype and expression analysis of O. sativa with corresponding phenotype group and young panicle transcriptome shows that only the non-synonymous SNP mutation at position +2396 exists in the Asian rice population, which can cause the young panicle expression to be smaller compared with Hap.2 and Hap.1, and the grain width to be wider and the thousand-grain weight to be larger (as shown in B of Figure 2 and Table 2).
[0106] Table 2
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Use of rice grain weight gene OsTGW12 in any of the following: (I) rice trait prediction; (II) rice breeding; (III) preparation of a product for predicting rice traits; (IV) preparation of a product for rice breeding; said rice grain weight gene OsTGW12 has a nucleotide sequence as shown in SEQ ID NO: 1; said rules for rice trait prediction comprise: if the haplotype of the rice grain weight gene OsTGW12 is Hap.2, the rice has longer grain length, wider grain width, larger 1000-grain weight and / or less spikelet expression; the Hap.2 has a T at position 931, a G at position 1522, a G at position 1843, GT at positions 1921-1922, an A at position 1926 and a T at position 2396; said rules for breeding comprise: selecting rice with the haplotype of the rice grain weight gene OsTGW12 being Hap.2 for breeding; the Hap.2 has a T at position 931, a G at position 1522, a G at position 1843, GT at positions 1921-1922, an A at position 1926 and a T at position 2396.
2. Use according to claim 1, wherein said rice is Asian rice.
3. A method of predicting a trait in rice, characterized by, prediction based on rice grain weight gene OsTGW12; said rice grain weight gene OsTGW12 has a nucleotide sequence as shown in SEQ ID NO: 1; said rules for prediction comprise: if the haplotype of the rice grain weight gene OsTGW12 is Hap.2, the rice has longer grain length, wider grain width, larger 1000-grain weight and / or less spikelet expression; the Hap.2 has a T at position 931, a G at position 1522, a G at position 1843, GT at positions 1921-1922, an A at position 1926 and a T at position 2396.
4. A method for breeding rice, characterized by, breeding based on rice grain weight gene OsTGW12; said rice grain weight gene OsTGW12 has a nucleotide sequence as shown in SEQ ID NO: 1; said rules for breeding comprise: selecting rice with the haplotype of the rice grain weight gene OsTGW12 being Hap.2 for breeding; the Hap.2 has a T at position 931, a G at position 1522, a G at position 1843, GT at positions 1921-1922, an A at position 1926 and a T at position 2396.
Citation Information
Patent Citations
Rice semi-dominant rolled leaf regulating gene ERL1 and application thereof
CN107163112A