Nucleic acid aptamer specifically recognizing cyanogen bromide-activated substrate material and use thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- PEKING UNIV
- Filing Date
- 2022-09-08
- Publication Date
- 2026-07-21
AI Technical Summary
Existing nucleic acid probe immobilization methods suffer from problems such as non-specific adsorption, poor stability, and high cost. In particular, when immobilizing on the surface of substrate materials, it is difficult to achieve high specificity and high affinity binding.
A nucleic acid aptamer sequence (such as 14 and 14-1) that specifically binds to cyanogen bromide-activated substrate material has been developed. Through the interaction between the nucleic acid aptamer and the cyanogen bromide-activated substrate material, a novel immobilization method is adopted, which has a short binding time and low cost.
This method achieves highly specific and high-affinity immobilization of nucleic acid probes, shortens immobilization time, reduces experimental costs, and improves the accuracy and efficiency of detection.
Smart Images

Figure CN117660456B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biochemical analysis, specifically to a nucleic acid aptamer that binds with high specificity and high affinity to a substrate material activated by cyanogen bromide, which has broad application prospects in fields such as biosensing, affinity enrichment and separation, and disease diagnosis and treatment. Background Technology
[0002] Nucleic acid aptamers are single-stranded oligonucleotide sequences that bind to targets with high specificity and high affinity by folding into unique secondary or tertiary structures. Nucleic acid aptamers are chemically synthesized, easily modified, batch-stable, and resistant to repeated denaturation and renaturation, thus possessing unique advantages. Currently reported targets for nucleic acid aptamers mainly focus on small molecules, proteins, cells, and tissues; nucleic acid aptamers that specifically recognize substrate materials have not yet been reported.
[0003] In nucleic acid sensor-based detection, many methods rely on the immobilization of nucleic acid probes on substrate surfaces. Immobilization based on physical adsorption is relatively simple as it eliminates the need for labeling nucleic acid probes with chemical functional groups. However, when probes bind to the substrate surface through physical adsorption, non-specific adsorption occurs, and the probes exhibit poor stability, which can interfere with experimental results. Affinity immobilization based on streptavidin-biotin interactions requires modification of both the substrate and the nucleic acid probe, resulting in higher costs. Immobilization based on covalent coupling requires pretreatment of the substrate or labeling with chemical groups. Furthermore, the nucleic acid probes also need to be modified with chemical functional groups, leading to longer immobilization times and increased experimental costs. Summary of the Invention
[0004] To address the problems existing in current nucleic acid probe immobilization techniques, the purpose of this invention is to provide a nucleic acid aptamer that can specifically bind to cyanogen bromide-activated substrate materials. By utilizing the interaction between the nucleic acid aptamer and the cyanogen bromide-activated substrate materials, a novel nucleic acid probe immobilization method can be developed.
[0005] This invention first provides a nucleic acid aptamer sequence that can bind to cyanogen bromide-activated substrate materials, named sequence number 14, and its sequence is as follows:
[0006] 5'-ACGC TCGGATGCCACTACAGTGCTGAATTTCGATAGAAAGAGGGGATCCGC TAATTGCTAAACCACTCATGGACGTGCTGGTGAC-3' (SEQ ID NO: 1).
[0007] After truncating or mutating sequence 14, the resulting sequences may still bind to cyanogen bromide-activated substrate materials, and these sequences are also within the scope of protection of this invention. Among these sequences, a typical one is named 14-1, which is obtained by truncating sequence 14. Its ability to bind to cyanogen bromide-activated substrate materials is stronger than the original sequence 14. The 14-1 sequence is as follows:
[0008] 5'-TCGGATGCCACTACAGTGCTGAATTTCGATAGAAAGAGGGGATCCGC-3' (SEQ ID NO: 2).
[0009] This invention, through mutation analysis of the bases in sequence 14-1, yielded analogs of 14-1. Some of these analogs of 14-1 exhibit comparable ability to bind cyanogen bromide to activate substrate materials as 14-1. These sequences are also within the scope of this invention, including but not limited to:
[0010] 14-1-G3G4-ATAT:
[0011] (SEQ ID NO:3);
[0012] 14-1-G28T:
[0013] (SEQ ID NO:4).
[0014] Nucleotide sequences derived from any of the nucleotide sequences shown in SEQ ID NO:1 to 4 in the sequence listing by replacing, deleting, inserting and / or chemically modifying one or more nucleotides, if they still have the function of specifically binding cyanogen bromide to activate substrate materials, are also within the scope of protection of this invention.
[0015] The chemical modifications include, but are not limited to, fluorescent and quenching groups (such as fluorescent groups FAM, Cy3, TAMRA, etc.; quenching groups BHQ1, BHQ2, MGB, etc.), chemical groups used for linkage (such as amino, carboxyl, aldehyde, biotin, thiol, etc.), steronic modifications (such as C3 steronic (3 CH2), photolytic steronic, tetrahydrofuran modification, etc.), nucleotide variant modifications (such as phosphorylation, thiophosphate, methylcytosine deoxynucleoside, etc.), and other modifications such as digoxigenin, azobenzene, methylene blue, etc.
[0016] Analysis of the secondary structures of sequences 14 and 14-1 in this invention revealed that their key structures include a stem-loop structure (see...). Figure 1 ), where the sequences at the 5' end and the 3' end A stem region formed by base complementarity, which includes an internal loop structure; the loop has two hairpin structures, and the sequence of hairpin 1 is as follows: The sequence of hairpin 2 is In the above sequences, the bases with repeated numbers form complementary pairs. When substitution, insertion, or deletion mutations are made to sequences 14 and 14-1, the secondary structure remains unchanged, as does the hairpin 1 sequence and the internal loop structure of the stem region. Thus, the resulting mutant sequences still have the function of binding cyanogen bromide to activate substrate materials.
[0017] The nucleotide sequence of the nucleic acid aptamer of the present invention can also be coupled with nucleic acid probes, fluorescent and quenching groups (such as fluorescent groups FAM, Cy3, TAMRA, etc.; quenching groups BHQ1, BHQ2, MGB, etc.), chemical groups for connection (such as amino, carboxyl, aldehyde, biotin, thiol, etc.), steric ions (such as C3 steric ions (3 CH2), photolytic cleavage steric ions, tetrahydrofuran modification, etc.), and markers or functional groups such as digoxigenin, azobenzene, methylene blue, isotopes, nanomaterials (such as luminescent nanomaterials) and / or enzymes. Generally, these markers or functional groups are coupled to the 5' end and / or 3' end of the nucleotide sequence, or they can be present in the sequence itself.
[0018] This invention provides a novel nucleic acid probe immobilization method based on the interaction between the nucleic acid aptamer and the cyanogen bromide-activated substrate material. A nucleic acid probe (NP) is coupled to a nucleic acid aptamer sequence (e.g., assembling the nucleic acid probe at the 5' or 3' end of sequence 14-1) to obtain 14-1-NP. The NP can be immobilized on the cyanogen bromide-activated substrate material through the interaction between the nucleic acid aptamer sequence and the cyanogen bromide-activated substrate material. Through hybridization with a complementary sequence, the NP can recognize and capture the complementary target nucleic acid sequence, enabling the detection of the target nucleic acid sequence. This novel immobilization method has the following advantages:
[0019] 1. The fixed time is only 1 hour, saving experimental time;
[0020] 2. The nucleic acid aptamer has a sequence length of several tens of oligonucleotides, resulting in low synthesis costs.
[0021] The above method can also be used to detect single-base mutations in polynucleotide chains, including: designing a capture probe (CP) and a signal probe (SP), wherein the capture probe can be complementary to both the wild-type and mutant target chains, while the signal probe has a single-base mismatch with the wild-type target chain and is completely complementary to the mutant target chain; coupling the nucleic acid aptamer with the capture probe and immobilizing it on a substrate material activated with cyanogen bromide; labeling the signal probe with a fluorescent group; when the mutant target chain is present in the hybridization reaction solution, the capture probe, signal probe, and mutant target chain form a stable DNA ternary complex through hybridization; when the mutant target chain is not present in the hybridization reaction solution, the wild-type target chain cannot be recognized by the signal probe and cannot form a stable complex; after the hybridization reaction, washing away the free signal probe, if a significant fluorescent signal is detected on the cyanogen bromide activated substrate material, it indicates that the mutant target chain is present in the hybridization reaction solution.
[0022] The interaction between the nucleic acid aptamer and the cyanogen bromide activated substrate material can be applied in biosensing, affinity enrichment and separation, and reagent kit development.
[0023] In some embodiments of the present invention, based on an understanding of the secondary structure of the nucleic acid aptamer, it is modified (e.g., the stem region is truncated) while maintaining its key structure. By fusing the modified nucleic acid aptamer with other sequences, a fusion-allotype nucleic acid aptamer is obtained. Upon triggering by a target, the fusion-allotype nucleic acid aptamer is induced to release its functional structure, which then binds to a cyanogen bromide-activated substrate material, enabling the detection of the target. Detectable targets include, but are not limited to, nucleic acids, proteins, small molecules, cells, exosomes, etc. For example, a fusion-allotype nucleic acid aptamer is obtained by assembling fissile ATP nucleic acid aptamers at both ends of a truncated 14-1 nucleic acid aptamer sequence in the stem region; in the absence of ATP, this fusion-allotype nucleic acid aptamer cannot bind to the cyanogen bromide-activated substrate material; when ATP is present, ATP recognizes the ATP nucleic acid aptamer, inducing the fusion-allotype nucleic acid aptamer to release its 14-1 functional structure, which then binds to the cyanogen bromide-activated substrate material.
[0024] The various terms and phrases used in this invention have their general meanings known to those skilled in the art.
[0025] This invention utilizes an exponentially enriched ligand system evolution technique to screen for nucleic acid aptamers that specifically bind to cyanogen bromide-activated substrate materials. These substrate materials include, but are not limited to, cyanogen bromide-activated agarose gel 4B (CNBr-S4B), cyanogen bromide-activated agarose gel 4FF (CNBr-4FF), and magnetic CNBr-S4B. A novel nucleic acid probe immobilization method is developed by leveraging the interaction between the nucleic acid aptamers and the cyanogen bromide-activated substrate materials. Furthermore, by constructing fusion allosteric nucleic acid aptamers, their interaction can be used as a signal output strategy. Attached Figure Description
[0026] Figure 1 Secondary structures of sequence 14 (A) and sequence 14-1 (B) simulated by .IDT OligoAnalyzer.
[0027] Figure 2 Comparison of the binding affinity of sequences 14 and 14-1 to cyanide-activated substrate materials.
[0028] Figure 3 The results of the experiment investigating the binding specificity of the nucleic acid aptamer to CNBr-S4B in Example 3.
[0029] Figure 4 In Example 4, the binding specificity of CNBr-S4B after mutating the G base site on sequence 14-1 is shown in the experimental results. A shows the G base site on sequence 14-1; B shows the binding effect after the mutation of the G base on sequence 14-1. Taking sequence G7C as an example, it refers to mutating the G base at position 7 (from 5' to 3') of sequence 14-1 to C.
[0030] Figure 5 In Example 5, static adsorption experiments and data fitting were used to determine the equilibrium dissociation constants of sequence 14-1 and the cyanide-activated substrate material.
[0031] Figure 6 The feasibility analysis results of the immobilization method based on the interaction between sequence 14-1 and cyanide bromide activated substrate material in Example 6 for capturing the target sequence.
[0032] Figure 7 A signal output strategy for detecting single-base mutations based on the interaction between the 14-1 sequence and the cyanogen bromide-activated substrate material and the self-assembly of nucleic acid sequences.
[0033] Figure 8 The experimental results of distinguishing WT and MT using CP-14-1 in Example 7.
[0034] Figure 9Example 8 shows a schematic diagram of the construction of a fusion-alliance nucleic acid aptamer and its principle for detecting ATP. In this diagram, A is a schematic diagram of assembling the split ATP nucleic acid aptamer at both ends of the truncated 14-1 sequence; B is a schematic diagram of the principle of fusion-alliance nucleic acid aptamer for detecting ATP; the black solid lines represent the truncated 14-1 sequence, and the white unfilled lines represent the nucleic acid aptamer sequences of ATP split into two segments.
[0035] Figure 10 Example 8: Experimental results of detecting ATP using fusion-alloy nucleic acid aptamers.
[0036] Figure 11 The results of the optimization experiment on the 14-1 stem region length in the fusion allosteric nucleic acid aptamer in Example 8. Detailed Implementation
[0037] The present invention is described in detail below through embodiments, but the present invention is not limited to the following embodiments.
[0038] Example 1: Binding characterization of nucleic acid aptamer sequences to cyanide bromide-activated substrate materials
[0039] Table 1. Materials and Reagents
[0040]
[0041] The sequence of nucleic acid aptamer 14 was synthesized, and a fluorescent group was labeled at the 5' end of the sequence. A certain mass of cyanogen bromide-activated substrate material was weighed and dissolved in binding buffer. The binding buffer was either phosphate buffer (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.47 mM KH2PO4, pH 7.4) or 25 mM Tris-HCl buffer (pH 7.4). The nucleic acid aptamer sequence was labeled with a FAM fluorescent group. The sequence was dissolved in binding buffer and incubated separately with cyanogen bromide-activated substrate material (spheres with a diameter of approximately 100 μm) in a reaction volume of 200 μL. The reaction concentration of the nucleic acid aptamer was 200 nM, and the reaction concentration of the cyanogen bromide-activated substrate material was 5 mg / mL. After reacting for 30 min, the incubated mixture was transferred to a self-made filter column (i.e., a filter column was obtained by adding a filter cartridge to a 200 μL pipette tip). The filter column was placed in a 1.5 mL EP tube, which was then placed in a centrifuge. Centrifugation allowed the solution to pass through the filter column, while the cyanogen bromide-activated substrate material and the nucleic acid aptamer sequences bound to it remained on the filter column. The sample was carefully washed with washing buffer (a binding buffer containing 0.05% Tween 20), and non-specifically bound sequences were removed by centrifugation. The nucleic acid aptamer sequences were eluted with 100 μL of 0.1 M NaOH, while the cyanogen bromide-activated substrate material remained on the filter column. The eluent was collected and mixed, and 90 μL of the eluent was added to a microplate. The fluorescence value was detected using a Synergy H1 microplate reader. In this experiment, the cyanogen bromide-activated substrate material used was CNBr-S4B.
[0042] The strength of the interaction between the screened nucleic acid aptamer sequences and the cyanogen bromide-activated substrate material was determined based on the fluorescence intensity. Sequence 14 showed the strongest binding affinity to the cyanogen bromide-activated substrate material.
[0043] Example 2: Truncation and Optimization of Sequence No. 14
[0044] The secondary structure of sequence 14 was simulated using IDT OligoAnalyzer software. Based on the predicted structure, sequence 14 was truncated to obtain sequence 14-1. The configurations of sequence 14 and sequence 14-1 are as follows: Figure 1 As shown in A and B in the table. The fluorescently labeled sequences 14 and 14-1 were incubated with the cyanogen bromide-activated substrate material, and the binding affinity of these two sequences to the cyanogen bromide-activated substrate material was determined by comparing the intensity of the fluorescence signals. In this experiment, the cyanogen bromide-activated substrate material used was CNBr-S4B. The reagents used in the experiment are shown in Table 1.
[0045] The specific experimental steps are as follows: Sequence 14 and sequence 14-1 were incubated with 5 mg / mL CNBr-S4B in binding buffer for 30 min. The concentration of the nucleic acid aptamer sequence was 200 nM. The reaction mixture was transferred to a self-made filter column, and the subsequent washing and elution steps were the same as in Example 1. The results are as follows: Figure 2 As shown, sequence 14-1 has a stronger binding affinity to cyanide-activated substrate materials than sequence 14.
[0046] Example 3: Investigation of the binding specificity of nucleic acid aptamers to CNBr-S4B
[0047] Table 2. Materials and Reagents
[0048]
[0049] The truncated sequence, i.e., sequence 14-1, was incubated with different types of agarose gels, and the strength of the binding was determined by the fluorescence intensity. Figure 3 These agarose gels include: streptavidin-modified agarose gel (SA-Sepharose), epoxy-activated agarose gel 6B (Epoxy-S6B), unmodified agarose gel 4B (S4B), cyanogen bromide-activated agarose gel 4B (CNBr-S4B), cyanogen bromide-activated agarose gel 4FF (CNBr-S4FF), and magnetic cyanogen bromide-activated agarose gel 4B (mCNBr-S4B).
[0050] The specific experimental steps are as follows:
[0051] 1. Weigh appropriate amounts of Epoxy-S6B, CNBr-S4B, and mCNBr-S4B and dissolve them in binding buffer, and measure appropriate amounts of SA-Sepharose, S4B, and CNBr-S4FF and dissolve them in binding buffer.
[0052] 2. 200 nM of aptamer sequence 14-1 was incubated with Epoxy-S6B, CNBr-S4B, SA-Sepharose, S4B, and CNBr-S4FF in binding buffer for 30 min. The concentration of the aptamer sequence was 200 nM, and the concentration of the agarose gel was 5 mg / mL. After the reaction, the mixture was transferred to a self-made filter column. The subsequent washing, elution, and detection steps were the same as in Example 1. Specifically, after incubating the 200 nM aptamer sequence 14-1 with mCNBr-S4B, the mixture was transferred to a magnetic rack, and the free aptamer sequence 14-1 and the aptamer sequence bound to mCNBr-S4B were separated by magnetic separation. After washing three times with washing buffer, the aptamer sequence 14-1 was eluted with 100 μL of 0.1 M NaOH. The subsequent detection steps were the same as in Example 1.
[0053] In the experiment, the control sequence used was A5-45, which does not bind to CNBr-S4B. From Figure 3 It can be seen that sequence 14-1 does not bind to SA-Sepharose, Epoxy-S6B, or unmodified S4B, but only to CNBr-S4B. This result indicates that the binding of sequence 14-1 to CNBr-S4B is specific. Furthermore, the experimental results show that sequence 14-1 also has a certain affinity for cyanide-activated agarose gel 4FF (CNBr-S4FF) and magnetic cyanide-activated agarose gel 4B (mCNBr-S4B). The surfaces of CNBr-S4B, CNBr-S4FF, and mCNBr-S4B all possess cyanate ester (-OC≡N) or cyclic imidocarbonate functional groups, while the composition of the agarose gel portion differs. The agarose gels of CNBr-S4B and CNBr-S4FF contain 4% agarose and highly cross-linked 4% agarose, respectively; the agarose gel of mCNBr-S4B contains 4% agarose, while the core is a magnetic material. Based on the experimental results, it is speculated that the interaction between sequence 14-1 and the cyanide-activated substrate material originates from the surface groups of the agarose gel, and the specific mechanism of action is still under investigation.
[0054] Example 4: G base mutation analysis on sequence 14-1
[0055] Table 3. Nucleic acid sequences used in Example 4
[0056]
[0057]
[0058] By mutating the G base of sequence 14-1, the core region of interaction between sequence 14-1 and the cyanogen bromide-activated substrate material was determined. In this experiment, the cyanogen bromide-activated substrate material used was CNBr-S4B. The specific experimental procedure was as follows: 200 nM of the mutated nucleic acid aptamer sequence was incubated with 5 mg / mL CNBr-S4B at 25°C for 1 h. After incubation, the reaction mixture was transferred to a self-made filter column, and the subsequent washing, elution, and detection processes were the same as in Example 1. Figure 4 As shown in Figure A, the secondary structure of sequence 14-1 is divided into four regions: hairpin 1, hairpin 2, a multi-branched loop region, and a stem region, with the stem region including an internal loop structure. The binding strength of the mutated sequence (Table 3) to the cyanide-activated substrate material is as follows: Figure 4 As shown in Figure B, the low fluorescence signal indicates that the sequence has a very weak binding ability to the cyanide-activated substrate material.
[0059] After mutating the G bases at positions 16 and 18 on hairpin 1 to T and A, respectively, the conformations of sequences G16T and G18A remained unchanged compared to 14-1, but they lost their ability to bind to the cyanogen bromide-activated substrate material, indicating that G16 and G18 are key bases for the interaction. Mutating the G at position 21 to A caused the structure of hairpin 1 to be unable to be maintained, resulting in the loss of binding. Experimental results indicate that hairpin 1 is the core region for recognition.
[0060] Mutation analysis of the G base sites in the hairpin 2 and multi-branched circular regions showed that the hairpin 2 and multi-branched circular regions mainly play a role in stabilizing the aptamer configuration during recognition.
[0061] Mutating G at sites 3 and 4 of the stem region to A simultaneously yielded the sequence G3AG4A. This sequence exhibits two base mismatches at the stem region's end, resulting in a loss of binding ability. Replacing the base pairing at these two sites from CG to AT yielded the sequence G3G4-ATAT, which restored binding to the cyanogen bromide-activated substrate material. In summary, the bases at the stem region's end are not critical binding sites in the interaction, but primarily serve to stabilize the stem region's structure. To further enhance the stability of the stem region's structure, G at site 7 was mutated to C, yielding the sequence G7C, forming a completely complementary structure within the stem region. Although G7C maintained some binding ability, its fluorescence signal was significantly weaker compared to sequence 14-1, indicating that the internal loop structure of the stem region plays a crucial role in the mutual recognition process.
[0062] Example 5: Determination of the equilibrium dissociation constant of sequence 14-1 and CNBr-S4B.
[0063] This embodiment uses the classic Scatchard method to characterize the equilibrium dissociation constant of sequence 14-1 with CNBr-S4B. The Scatchard equation is Q. max / K d -Q / K d =Q / C e Where Q represents the adsorption amount of sequence 14-1 by a unit mass of CNBr-S4B. max This represents the maximum adsorption capacity of CNBr-S4B per unit mass for sequence 14-1, in nmol / g; C e The concentration of sequence 14-1 in the supernatant after adsorption reaches equilibrium, in nmol / L; K d This is the equilibrium dissociation constant, expressed in nmol / L.
[0064] The specific implementation process is as follows: 5 mg / mL CNBr-S4B was incubated with sequence No. 14-1 at different initial concentrations in binding buffer for 1 h. The initial reaction concentrations of sequence No. 14-1 were 50, 200, 750, 1500, and 1750 nM. Unbound sequence No. 14-1 was removed by washing, and then the sequence No. 14-1 bound to CNBr-S4B was eluted. The eluent was collected, and the fluorescence intensity of the eluent was detected. The concentration of sequence No. 14-1 bound to CNBr-S4B was determined by the fluorescence intensity of the eluent. Specific washing, elution, and detection steps are detailed in Example 1. The data was fitted using the Scatchard equation (…). Figure 5 ), calculate K d The value was 1.18 μM, which further demonstrates the strong binding ability between 14-1 and CNBr-S4B.
[0065] Example 6: Development of a novel immobilization method based on the interaction between nucleic acid aptamers and cyanogen bromide-activated substrate materials
[0066] Table 4. Nucleic acid sequences used in Example 6
[0067]
[0068] The purpose of this embodiment is to develop a novel nucleic acid probe immobilization method by utilizing the interaction between the 14-1 sequence and the cyanogen bromide-activated substrate material. The nucleic acid probe (NP) is coupled to the 3' end of the 14-1 sequence to obtain 14-1-NP. The specific experimental procedures are as follows:
[0069] 1. DNA pretreatment: 14-1-NP was denatured at 95℃ for 5 min, then placed on ice for 15 min, and then placed at 25℃ for 5 min.
[0070] 2. Assembly of nucleic acid probes: 14-1-NP and cyanogen bromide activated substrate material (such as CNBr-S4B) were incubated in binding buffer (10mM phosphate buffer or 25mM Tris-HCl buffer) at 25°C for 1 h. The reaction concentration of 14-1-NP was 50-500 nM, and the concentration of cyanogen bromide activated substrate material was 5 mg / mL.
[0071] 3. Washing: Transfer the reactants to the filter column and centrifuge to allow the solution to pass through the filter, removing any 14-1-NPs not assembled on the cyanogen bromide-activated substrate material. The cyanogen bromide-activated substrate material and its bound 14-1-NPs remain on the filter column. Wash thoroughly three times with washing buffer, removing the solution by centrifugation after each wash.
[0072] 4. Redissolution of cyanogen bromide-activated substrate material: The cyanogen bromide-activated substrate material assembled with 14-1-NP was redissolved in binding buffer to a final concentration of 20 mg / mL.
[0073] 5. Capture of target sequence by nucleic acid probe: Add fluorescently labeled target sequence (FAM-probe) and hybridize at 25℃ for 2h.
[0074] 6. Washing: Transfer the reactants to the filter column and centrifuge to allow the solution to pass through the filter, removing the target sequences not captured by NPs. The cyanogen bromide-activated substrate material, its bound 14-1-NPs, and the captured target sequences remain on the filter column. Wash thoroughly three times with washing buffer, removing the solution by centrifugation after each wash.
[0075] 7. Elution: Disrupt the base pairing between the target sequence and the nucleic acid probe with 100 μL of alkaline eluent (0.1 M NaOH, 0.2 M NaCl) to elute the target sequence from the cyanogen bromide-activated substrate. Collect the eluent in a 1.5 mL EP tube, vortex thoroughly, and then add it to the microplate. Detect the fluorescence signal using a microplate reader; quantify the concentration of the target sequence based on the intensity of the fluorescence signal.
[0076] The results are as follows Figure 6As shown, due to the perfect complementary pairing of NP and FAM-probe, the 14-1-NP assembled on CNBr-S4B can specifically hybridize with FAM-probe, and the fluorescence intensity increases with increasing FAM-probe concentration. In the control group, only the 14-1 sequence is immobilized on CNBr-S4B without NP, and therefore cannot hybridize with FAM-probe, and FAM-probe cannot be captured on CNBr-S4B. Consequently, the fluorescence signal of the eluent is very weak. This result indicates that FAM-probe cannot be recognized and captured when the capture probe is absent, thus proving that the fluorescence signal in the experimental group originates from the capture ability of NP on FAM-probe.
[0077] Example 7: Application of the interaction between nucleic acid aptamers and cyanogen bromide-activated substrate materials to the detection of single-base mutations.
[0078] Table 5. Nucleic acid sequences used in Example 7
[0079]
[0080]
[0081] The design approach for detecting single-base mutations based on the interaction between sequence 14-1 and cyanide bromide-activated substrate material, and nucleic acid sequence self-assembly, is as follows: Figure 7 As shown. In this experiment, the cyanogen bromide-activated substrate material used was CNBr-S4B. Two probes were designed with sequences complementary to the target gene: a capture probe (CP) and a signal probe (SP). The CP sequence can pair with both the wild-type target (WT) and the mutant-type target (MT) strands, thus recognizing and capturing both. SP has the ability to recognize single-base mismatches; it has one single-base mismatch with WT but is perfectly paired with MT, therefore it can only recognize MT. Furthermore, SP is labeled with a fluorescent group. CP was fused to the 5' end of 14-1 to obtain the sequence CP-14-1. CP-14-1 was immobilized on CNBr-S4B through the interaction between 14-1 and CNBr-S4B. When SP and MT are present in the reaction, CP, SP, and MT form a stable DNA ternary complex through hybridization. When SP and WT are added to the reaction, WT cannot be recognized by SP, therefore a stable complex cannot be formed. After the hybridization reaction was complete, the reaction solution was transferred to a filter column, and excess SP was removed by washing. Finally, a strongly alkaline solution was used to disrupt the interaction between the CNBr-S4B and 14-1 DNA ternary complex, and the eluent was collected for detection.
[0082] The specific experimental procedures are as follows:
[0083] 1. Assemble CP-14-1 on CNBr-S4B, as detailed in Example 6.
[0084] 2. Mix 50 nM SP chain and 10 nM MT in binding buffer at pH 7.4, add CNBr-S4B immobilized with CP-14-1, to a reaction volume of 200 μL, and react at 25 °C for 2 h. The subsequent washing, elution, and detection processes are the same as in Example 1.
[0085] Experimental results are as follows Figure 8 As shown, when WT is added to the reaction, the fluorescence signal is weak because SP cannot recognize WT. When MT is added, MT can be recognized by SP, thus producing a significant fluorescence signal. This result indicates that single-base mutations can be detected using the interaction between the 14-1 sequence and CNBr-S4B and oligonucleotide self-assembly.
[0086] In Example 6, NP was assembled at the 3' end of sequence 14-1, while in this example, CP was assembled at the 5' end of sequence 14-1. The results show that both ends of sequence 14-1 can assemble with functional nucleic acid sequences. Therefore, nucleic acid sequences can be rationally assembled onto sequence 14-1 according to specific experimental requirements.
[0087] Example 8: Signal output strategy based on the interaction between sequence 14-1 and cyanide bromide activated substrate material
[0088] Table 6. Reagents used in Example 8
[0089]
[0090]
[0091] Table 7. Nucleic acid sequences used in Example 8
[0092]
[0093] By coupling the 14-1 sequence with other nucleic acid sequences, the functional secondary structure of the 14-1 sequence is blocked (e.g., through hybridization with complementary sequences). This strategy allows for the construction of fusion-variant nucleic acid aptamers based on the 14-1 sequence. Upon triggering by the target analyte, the 14-1 sequence is released from the fusion-variant aptamer, restoring its functional secondary structure, and then binds to a cyanogen bromide-activated substrate, achieving signal output and simultaneously enabling the capture and detection of the target analyte. Target analytes include, but are not limited to, characteristic nucleic acid sequences, proteins, small molecules, cells, exosomes, etc.
[0094] The pattern for coupling sequence 14-1 with other sequences to form a fusion-variant nucleic acid aptamer is as follows (taking the ATP nucleic acid aptamer as an example): For example... Figure 9 As shown in Figure A, the stem region of sequence 14-1 was truncated (by cutting it at the loop structure inside the stem region). The fissile ATP aptamers were then assembled at both ends of the truncated 14-1 sequence to form a fusion allosteric aptamer, named 64-3bp (Table 7). A fluorescent group was then labeled on the fusion allosteric aptamer. The principle of using this fusion allosteric aptamer to detect ATP is as follows: Figure 9 As shown in Figure B, without the addition of ATP, the 14-1 sequence and the ATP nucleic acid aptamer sequence form a partial base pairing, thus blocking the functional structure of 14-1 and preventing it from binding to the cyanogen bromide-activated substrate material, resulting in a very low fluorescence signal. Upon the addition of ATP, ATP and its nucleic acid aptamer recognize each other, inducing a conformational change in the fusion allosteric nucleic acid aptamer, thereby activating the stable functional structure of 14-1 and enabling binding to the cyanogen bromide-activated substrate material, resulting in a significant increase in fluorescence signal.
[0095] The specific implementation process is as follows:
[0096] DNA was dissolved in Tris buffer (25 mM Tris, 120 mM NaCl, 4 mM KCl, 1 mM MgCl2, pH 7.4) before use. The washing buffer was Tris buffer supplemented with 0.02% Tween 20, and the alkaline elution buffer was 0.1 M NaOH (containing 0.2 M NaCl). Before the experiment, the DNA was denatured at 95 °C for 5 min, incubated on ice for 15 min, and then placed at 25 °C for 5 min. 500 nM of 64-3 bp was dissolved in 25 mM Tris-HCl buffer, and 1 mM freshly prepared ATP was added to the solution. After reacting at 25 °C for 30 min, CNBr-S4B was added to a final concentration of 5 mg / mL, and the reaction was continued at 25 °C for another 30 min. No ATP was added in the control group. After the reaction, the mixture was transferred to a filter column. The filter column was placed in a 1.5 mL EP tube, and the reaction solution was removed by centrifugation. CNBr-S4B and the DNA sequence bound to CNBr-S4B were retained on the filter column. Subsequent washing, elution, and detection procedures were the same as in Example 1.
[0097] Experimental results are as follows Figure 10As shown, in the absence of ATP, due to partial base pairing between the ATP aptamer and 14-1, 14-1 cannot form a stable conformation that can bind to CNBr-S4B, thus failing to bind to CNBr-S4B and resulting in a very low background signal in the control group. When ATP is added to the reaction, ATP can bind to its aptamer, thereby inducing a conformational change in the fusion allosteric nucleic acid aptamer, thereby restoring the functional structure of 14-1, which then binds to CNBr-S4B, generating a strong fluorescent signal. In summary, by fusing other nucleic acid aptamer sequences with 14-1, fusion allosteric nucleic acid aptamers based on 14-1 can be constructed. The interaction between 14-1 and the cyanogen bromide-activated substrate material can be used as a signal output method to achieve the detection of target analytes.
[0098] After truncating the stem region of sequence 14-1 near the inner loop structure, the number of base pairs in the stem region affects the stability of the nucleic acid aptamer. Therefore, the length of the 14-1 stem region in the fusion allosteric nucleic acid aptamer was optimized. In this experiment, 6, 8, and 10 bases were truncated from the 14-1 stem region, respectively, resulting in sequences 68-5bp, 66-4bp, and 64-3bp with 14-1 stem region lengths of 5bp, 4bp, and 3bp, respectively. In the optimization experiment, Mg in the buffer was... 2+ The concentration was 0.4 mM, and the other implementation procedures were the same as those described in Example 8.
[0099] Optimization results are as follows Figure 11 As shown, without ATP, the background signal of the fusion allosteric aptamer binding to CNBr-S4B gradually decreased with the reduction of the stem region length of 14-1. This is because the reduction of the stem region length of 14-1 leads to a decrease in the stability of the 14-1 structure, thus the binding ability of 14-1 to CNBr-S4B weakens with the reduction of the stem region length. When ATP was added to the reaction system, the signal of the fusion allosteric aptamer binding to CNBr-S4B was higher than that of the corresponding control group. This is because the binding of ATP to the ATP aptamer allows the ATP aptamer to form a stable stem region structure. This stem region sequence can stabilize the truncated stem region of 14-1, thereby promoting the formation of a stable functional structure of the truncated 14-1 and binding to CNBr-S4B. With the reduction of the stem region length of 14-1, F ATP / F control The ratio gradually increases. Therefore, in the construction of fusion-variant nucleic acid aptamers based on 14-1, it is more advantageous for the stem region of 14-1 to retain three base pairs, including the internal loop structure.
[0100] The embodiments described above are not intended to limit the present invention. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the scope of the claims.
Claims
1. A nucleic acid aptamer, characterized in that, This nucleic acid aptamer can specifically bind to cyanogen bromide-activated substrate materials, and its nucleotide sequence is selected from any one of SEQ ID NO: 1~4 in the sequence listing.
2. The nucleic acid aptamer as described in claim 1, characterized in that, The secondary structure of the nucleotide sequence of the nucleic acid aptamer includes a stem-loop structure, wherein the stem region contains an inner loop structure with two hairpin structures on the loop.
3. The nucleic acid aptamer as described in claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer is coupled with one or more markers or functional groups.
4. The nucleic acid aptamer as described in claim 3, characterized in that, The marker or functional group is coupled to the 5' or 3' end of the nucleotide sequence, or in the sequence itself.
5. A biological detection kit, characterized in that, It includes the nucleic acid aptamer as described in any one of claims 1 to 4.
6. The application of the nucleic acid aptamer according to any one of claims 1 to 4 in biological detection.
7. The application as described in claim 6, characterized in that, The method of capturing and detecting target nucleic acid sequences using the nucleic acid aptamer includes: coupling a nucleic acid probe to the nucleic acid aptamer, then immobilizing the nucleic acid probe on the cyanogen bromide activated substrate material through the interaction between the nucleic acid aptamer and the substrate material, and then having the nucleic acid probe recognize and capture the complementary target nucleic acid sequence to achieve the detection of the target nucleic acid sequence.
8. The application as described in claim 6, characterized in that, The method for detecting single-base mutations in polynucleotide chains using the aforementioned nucleic acid aptamers includes: designing a capture probe and a signal probe, wherein the capture probe can be complementary to both wild-type and mutant target chains, while the signal probe has a single-base mismatch with the wild-type target chain and is completely complementary to the mutant target chain; coupling the nucleic acid aptamer with the capture probe and immobilizing it on a cyanogen bromide-activated substrate material; labeling the signal probe with a fluorescent group; when the mutant target chain is present in the hybridization reaction solution, the capture probe, signal probe, and mutant target chain form a stable DNA ternary complex through hybridization; when the mutant target chain is not present in the hybridization reaction solution, the wild-type target chain cannot be recognized by the signal probe and cannot form a stable complex; after the hybridization reaction, washing away the free signal probe, and if a significant fluorescent signal is detected on the cyanogen bromide-activated substrate material, it indicates the presence of a mutant target chain in the hybridization reaction solution.
9. The application as described in claim 6, characterized in that, The splitting ATP nucleic acid aptamers are assembled at both ends of the truncated nucleic acid aptamer sequence of claim 2 in the stem region to obtain a fusion allosteric nucleic acid aptamer. The nucleotide sequence of the fusion allosteric nucleic acid aptamer is shown in SEQ ID NO: 22 or SEQ ID NO: 23 in the sequence listing. In the absence of ATP, the fusion allosteric nucleic acid aptamer cannot bind to the cyanogen bromide activated substrate material. When ATP is present, ATP recognizes the ATP nucleic acid aptamer, inducing the fusion allosteric nucleic acid aptamer to release a functional structure, which then binds to the cyanogen bromide activated substrate material.