A Ti3C2-Au nanocomposite based on diazonium ion grafting, its preparation method and application

Abstract

The present invention discloses a Ti3C2-Au nanocomposite based on diazonium ion grafting, its preparation method and application; the nanocomposite includes the following components: Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles; the gold nanoparticles are attached to the surface of the Ti3C2 MXene nanosheets, and the luminol diazonium salt ions are covalently connected through Ti-O-C bonds after reacting with the Ti3C2 MXene nanosheets. The Ti3C2 MXene nanosheets loaded with gold nanoparticles and grafted with luminol diazonium salt ions of the present invention have good fluorescence performance and electrochemiluminescence performance; the biosensor applied to electrochemiluminescence has high sensitivity and high specificity detection.

Description

Technical Field

[0001] The present invention belongs to the technical fields of material chemistry, analytical chemistry and electrochemiluminescence sensing technology, and particularly relates to a diazonium ion grafted Ti3C2-Au nanocomposite, a preparation method thereof and an application thereof. Background Art

[0002] MicroRNAs (miRNAs) are a class of non-coding endogenous single-stranded RNAs that mainly participate in various physiological processes including cell proliferation and apoptosis by regulating the expression of target genes. Their contents are closely related to the occurrence and development of various diseases such as cancer and kidney diseases. Due to their abnormal expression in the early stage of diseases, miRNAs are considered as an attractive biomarker for clinical diagnosis. Therefore, developing accurate, sensitive and simple miRNAs detection methods is of great significance for the early diagnosis of diseases. However, the characteristics of strong sequence similarity, low abundance and small volume of miRNAs have hindered the development of highly specific and sensitive detection methods. Standard methods such as real-time quantitative polymerase chain reaction, Northern hybridization and microarray usually have problems of complex technology, time-consuming and low sensitivity. In recent years, a variety of novel miRNAs detection technologies including electrochemistry, fluorescence, electrochemiluminescence and surface-enhanced Raman spectroscopy have been developed, among which electrochemiluminescence method (ECL) has received extensive attention due to its low cost, wide detection range, fast response and high sensitivity.

[0003] Luminol is one of the most widely studied electrochemiluminescent substances at present. In most current research works, due to its advantages such as good stability and simple operation, it is directly added to the supporting electrolyte solution to obtain electrochemiluminescence signals. However, the detection process based on this strategy relies on the enhancement and weakening processes of the original luminescence signal of the luminescent reagent, which leads to relatively high background noise in the detection process and has a great impact on the improvement of detection sensitivity in the construction process of the sensor. In order to save the dosage of the luminescent reagent, reduce the detection cost and meet the requirements of ultrasensitive detection, immobilizing luminol on the surface of nanomaterials with excellent properties is beneficial to expand its further application in biomarker detection. Summary of the Invention

[0004] Aiming at the problems existing in the above-mentioned prior art, the purpose of the present invention is to provide a diazonium ion grafted Ti3C2-Au nanocomposite, a preparation method thereof and an application thereof.

[0005] The purpose of the present invention is achieved by the following technical solutions:

[0006] A Ti3C2-Au nanocomposite (Au-MXene-luminol) based on diazonium ion grafting, comprising the following components: Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles; the gold nanoparticles are attached to the surface of the Ti3C2 MXene nanosheets, and the luminol diazonium salt ions are covalently linked to the Ti3C2 MXene nanosheets through Ti-O-C bonds after reaction.

[0007] Preferably, the mass molar ratio of the Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles is 5-20 mg: 0.05-0.5 mmol: 0.01-0.1 mmol.

[0008] More preferably, the mass molar ratio of the Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles is 10 mg: 0.05-0.5 mmol: 0.01-0.1 mmol.

[0009] The preparation method of the above-mentioned Ti3C2-Au nanocomposite based on diazonium ion grafting comprises the following steps:

[0010] (1) Disperse the Ti3C2 MXene nanosheets and luminol diazonium salt ions in anhydrous acetonitrile, stir, centrifuge and wash, and freeze-dry to obtain MXene-luminol powder;

[0011] (2) Disperse the MXene-luminol powder prepared in step (1) in deionized water, ultrasonically treat, then drop in HAuCl4 solution, stir, centrifuge and wash, and freeze-dry to obtain the Ti3C2-Au nanocomposite based on diazonium ion grafting.

[0012] Preferably, the mass molar ratio of the Ti3C2 MXene nanosheets to the luminol diazonium salt ions in step (1) is 5-20 mg: 0.05-0.5 mmol; the mass volume ratio of the Ti3C2 MXene nanosheets to anhydrous acetonitrile is 5-100 mg: 5-50 mL;

[0013] Preferably, the temperature of the stirring treatment in step (1) is 25-40 °C, the speed is 100-1000 rpm, and the time is 0.5-5 h;

[0014] Preferably, the centrifugation speed in step (1) is 5000-9000 rpm, the time is 1-5 min, and the solvents used for washing include but are not limited to acetonitrile, ethanol, acetone, and ether.

[0015] Preferably, the mass volume ratio of the MXene-luminol powder to deionized water in step (2) is 5-20 mg: 5-40 mL;

[0016] Preferably, the time of the ultrasonic treatment in step (2) is 0.5 - 15 min;

[0017] Preferably, the mass molar ratio of the MXene-luminol powder to HAuCl4 in step (2) is 5 - 20 mg: 0.01 - 0.1 mmol;

[0018] Preferably, the time of the stirring treatment in step (2) is 0.5 - 4 h.

[0019] Preferably, the preparation method of the Ti3C2 MXene nanosheets comprises the following steps: dispersing lithium fluoride into a hydrochloric acid solution and performing a stirring treatment; then adding Ti3AlC2 powder and performing a stirring etching; after centrifuging and washing until the pH is neutral, performing ultrasonic treatment in water under a protective atmosphere, and taking the supernatant after centrifuging and performing freeze-drying to obtain the Ti3C2 MXene nanosheets.

[0020] Further preferably, the mass volume ratio of the lithium fluoride to the hydrochloric acid is 0.5 - 4 g: 10 - 80 mL, and the mass ratio of the lithium fluoride to the Ti3AlC2 powder is 2:1 - 1:1; the concentration of the hydrochloric acid is 6 - 12 M.

[0021] Further preferably, the temperature of the stirring treatment is 30 - 45 °C, the time is 0.5 - 1 h, the time of the stirring etching is 12 - 36 h, and the temperature is 30 - 45 °C; the protective atmosphere is high-purity argon, and the time of the ultrasonic treatment is 1 - 2 h.

[0022] Preferably, the preparation method of the luminol diazonium salt ions comprises the following steps:

[0023] (a) Dissolving luminol in a hydrochloric acid solution, dropping a sodium nitrite solution into the above solution under continuous stirring, and performing a stirring reaction;

[0024] (b) Adding sodium tetrafluoroborate to the solution obtained in step (a), performing a stirring reaction, filtering to collect the precipitate, and obtaining the luminol diazonium salt ions after vacuum drying.

[0025] Further preferably, the molar volume ratio of the luminol to the hydrochloric acid in step (a) is 1 - 10 mmol: 1 - 10 mL, and the concentration of the hydrochloric acid is 1 - 3 M;

[0026] Further preferably, the sodium nitrite in step (a) is dissolved in ice water; the molar ratio of sodium nitrite to luminol is 1:1 - 1.5:1;

[0027] Further preferably, the speed of the continuous stirring in step (a) is 100 - 1000 rpm, and the temperature of the continuous stirring is 0 - 5 °C;

[0028] Further preferably, the stirring reaction in step (a) is carried out for 0.5 - 2 h at a temperature of 0 - 10 °C;

[0029] Further preferably, the molar ratio of sodium tetrafluoroborate to luminol in step (b) is 1:1 - 5:1. The stirring reaction is carried out for 0.5 - 1 h at a temperature of 0 - 10 °C.

[0030] An electrochemiluminescent biosensor, comprising a working electrode loaded with a capture probe and the above-mentioned diazonium ion-grafted Ti3C2-Au nanocomposite loaded with a signal probe.

[0031] Preferably, the working electrode loaded with the capture probe is a gold electrode directly loaded with the capture probe; or the capture probe is loaded on the working electrode through Ti3C2-Au;

[0032] Further preferably, the method for preparing the gold electrode directly loaded with the capture probe comprises the following steps: polishing the gold electrode with α-Al2O3 slurry, performing electrochemical activation in a sulfuric acid solution, after the gold electrode is dried, dropping the capture probe solution on the surface of the gold electrode, and performing the first incubation, rinsing and drying the electrode, and then performing the second incubation with a blocking agent mercaptoethanol solution, and obtaining the gold electrode directly loaded with the capture probe after rinsing and drying.

[0033] More preferably, the concentration of the sulfuric acid solution is 0.5 - 1.0 M; the electrochemical activation is cycled 5 - 20 times between -0.1 V and +1.60 V, and the scanning rate is 0.05 - 0.1 V·s -1 ;

[0034] More preferably, the concentration of the capture probe solution is 1 - 10 μM, and the volume dosage is 2.5 - 10 μL / 3.14 mm 3 (drop-coated surface area of the gold electrode).

[0035] More preferably, the temperature of the first incubation is 0 - 4 °C, and the time is 6 - 20 h;

[0036] More preferably, the concentration of the blocking agent mercaptoethanol solution is 0.1 - 2 mM.

[0037] More preferably, the temperature of the second incubation is 25 - 40 °C, and the time is 0.5 - 1.5 h;

[0038] Preferably, the capture probe is a DNA capture probe modified with a thiol at the end; further preferably, the sequence of the DNA capture probe modified with a thiol at the end is 5’-CTTTGTGTGATTAC(SH)-3’;

[0039] Preferably, the signal probe is a DNA signal probe modified with a thiol group at the end; more preferably, the sequence of the DNA signal probe modified with a thiol group at the end is 5'-(SH)GATACAAAAGTTGC-3'.

[0040] Preferably, the biosensor electrode further includes a counter electrode and a reference electrode; more preferably, the counter electrode is a platinum electrode and the reference electrode is an Ag / AgCl electrode.

[0041] Preferably, the method for preparing the diazonium ion grafted Ti3C2-Au nanocomposite loaded with a signal probe comprises the following steps: dispersing the diazonium ion grafted Ti3C2-Au nanocomposite in deionized water, adding a signal probe solution, stirring, centrifuging and collecting the precipitate to obtain the diazonium ion grafted Ti3C2-Au nanocomposite loaded with a signal probe.

[0042] More preferably, the volume ratio of the aqueous solution of the diazonium ion grafted Ti3C2-Au nanocomposite to the signal probe solution is 100 - 500 μL:50 - 200 μL, the concentration of the aqueous solution of the diazonium ion grafted Ti3C2-Au nanocomposite is 0.1 - 2 mg / mL, and the concentration of the signal probe solution is 1 - 10 μM;

[0043] More preferably, the stirring speed is 50 - 500 rpm, the temperature is 0 - 4 °C, and the time is 6 - 20 h;

[0044] More preferably, the diazonium ion grafted Ti3C2-Au nanocomposite loaded with a signal probe is dispersed in a TE buffer solution, and the concentration of the diazonium ion grafted Ti3C2-Au nanocomposite loaded with a signal probe is 0.5 - 5 mg / mL;

[0045] The application of the above electrochemiluminescence biosensor in the electrochemiluminescence detection of miRNA includes the following steps: dropping a miRNA solution onto the working electrode loaded with a capture probe, incubating for the first time to allow the capture probe to capture the target miRNA, then dropping a solution of the diazonium ion grafted Ti3C2-Au nanocomposite loaded with a signal probe, incubating for the second time to allow the signal probe to bind to the target miRNA, and then performing an electrochemiluminescence test, and calculating the concentration of the miRNA solution according to the standard curve.

[0046] Preferably, the electrochemiluminescence test type is cyclic voltammetry.

[0047] Preferably, the temperature of the first incubation is 25 - 40 °C and the time is 30 - 90 minutes.

[0048] Preferably, the temperature of the second incubation is 25 - 40 °C, and the time is 30 - 90 minutes.

[0049] Preferably, the concentration of the solution of the diazonium ion grafted Ti3C2 - Au nanocomposite loaded with signal probes is 0.5 - 5 mg / mL;

[0050] Preferably, after each incubation, the surface of the electrode is rinsed with a PBS solution with a pH of 6.7 - 8.0 to remove non - specific connections, and the working electrode is dried by purging with nitrogen after rinsing;

[0051] Preferably, the potential window for the electrochemiluminescence test is 0 V to 0.8 V, the scan rate is 100 mV / s, the PMT excitation voltage is 500 - 800 V, and the test is carried out in a PBS solution with a pH of 6.7 - 8.0 containing 0.02 - 0.1 M hydrogen peroxide.

[0052] Preferably, the standard curve is obtained through the following steps:

[0053] (c) Drop - coat a miRNA solution with a known concentration onto the working electrode loaded with capture probes, and incubate at 25 - 40 °C for 60 - 90 minutes; then incubate with the SP - Au - MXene - luminol nanoprobe solution at 25 - 40 °C for 60 - 90 minutes;

[0054] (d) Perform an electrochemiluminescence test on the sensor obtained in step (c) in a three - electrode system. The sensor is the working electrode, the platinum electrode is the counter electrode, and the Ag / AgCl electrode is the reference electrode. The test type is cyclic voltammetry; change the concentration of the miRNA solution in step (c), and make a standard curve according to the electrochemiluminescence (ECL) intensity at different concentrations.

[0055] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0056] (1) In the present invention, the luminol group is connected to the two - dimensional nanosheet Ti3C2 MXene through a covalent bond, shortening the electron transfer distance between the luminol and the electrode interface, thereby enhancing the ECL signal;

[0057] (2) The large - surface - area MXene in the present invention serves as a carrier to enrich more gold nanoparticles and luminol. Moreover, due to its excellent conductivity and catalytic performance, it can act as an amplifier for the luminol ECL signal;

[0058] (3) The presence of the gold nanoparticles in the present invention provides a bare catalytic surface with high electrocatalytic performance. Through the synergistic catalysis with MXene, the ECL performance of luminol is significantly improved;

[0059] (4) The nanocomposites prepared by the present invention have excellent ECL performance, and the proposed immobilization strategy provides a new perspective for the biolabeling method of luminol and its signal amplification in ECL biosensing;

[0060] (5) The electrochemiluminescence biosensor prepared by the present invention has high sensitivity and high-specificity detection. Brief Description of the Drawings

[0061] Figure 1 It is the preparation and working principle diagram of the electrochemiluminescence biosensor based on the Ti3C2-Au nanocomposite grafted with luminol diazonium ions of the present invention.

[0062] Figure 2 It is the synthesis schematic diagram and high-resolution mass spectrum of luminol diazonium salt in Example 1.

[0063] Figure 3 It is the characterization diagram and fluorescence diagram of the Au-MXene-luminol nanocomposite in Example 1.

[0064] Figure 4 It is the infrared spectrum of the physical mixture of luminol diazonium salt and MXene in Example 1.

[0065] Figure 5 It is the X-ray photoelectron spectroscopy diagrams of MXene nanosheets and Au-MXene-luminol nanocomposites in Example 1.

[0066] Figure 6 It is the electrochemiluminescence curve diagram of the nanocomposite in Example 1.

[0067] Figure 7 It is the electrochemiluminescence curve diagram and standard curve diagram measured by the electrochemiluminescence biosensor based on the Ti3C2-Au nanocomposite grafted with luminol diazonium ions obtained in Example 2 under different concentrations of miRNA-377.

[0068] Figure 8 It is the test diagram for selectivity study in Example 3. Detailed Description of the Embodiments

[0069] In order to make the objectives, technical solutions and advantages of the present invention clearer, the following further details the present invention through specific embodiments.

[0070] It should be noted that the following detailed descriptions are all exemplary and are intended to further illustrate the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0071] Example 1

[0072] Preparation method of a nanocomposite based on Ti3C2-Au nanocomposite grafted with luminol diazonium ions.

[0073] (1) Preparation of MXene: Slowly add 2 g of Ti3AlC2 powder into 40 mL of HCl solution (12 M) containing 2 g of LiF under continuous stirring. Stir at 35 °C for 24 h, centrifuge at 8000 rpm for 5 min, collect the precipitate, and wash it with ultrapure water until the pH of the supernatant is neutral. The obtained precipitate is then ultrasonically cleaned with ultrapure water for 1 hour under argon protection. Finally, centrifuge the mixture at 3500 rpm for 1 h, collect the supernatant and freeze-dry it to obtain MXene for standby.

[0074] (2) Synthesis of luminol diazonium ions: Dissolve luminol (0.89 g, 5 mmol) in 5 mL of 3 M HCl solution. After stirring for 5 min, add sodium nitrite (0.37 g, 5.4 mmol) dissolved in 1 ml of ice water dropwise to the above solution under continuous stirring at 0 - 5 °C. After stirring at 0 - 10 °C for 30 min, add sodium tetrafluoroborate (0.77 g, 7 mmol) to the mixed solution, and stir at 0 - 10 °C for 30 min until precipitation occurs. Filter and collect the precipitate, wash the filtrate with cold water and ether successively, and dry it overnight under vacuum to finally obtain brown luminol diazonium salt, which is stored in the dark at 4 °C.

[0075] Figure 2 In a and b are the synthesis schematic diagram and high-resolution mass spectrum of luminol diazonium salt respectively. The spectral peak of 189.0402 corresponds to the molecular weight of luminol diazonium ions, indicating the successful diazotization of luminol.

[0076] (3) Preparation of MXene-luminol: Disperse 10 mg of MXene and 50 mg of luminol diazonium salt in 10 mL of anhydrous acetonitrile purged with nitrogen. Stir at room temperature for 4 h, centrifuge at 5000 rpm for 3 min, and wash the precipitate with acetonitrile, acetone, and ethanol respectively. The final product is obtained after drying in vacuo and stored in the refrigerator for further use.

[0077] (4) Preparation of Au-MXene-luminol nanocomposite: Disperse 10 mg of the prepared MXene-luminol powder in 10 mL of deionized water, sonicate for 10 min, and dropwise add 400 μL (48.56 mM) of chloroauric acid solution under continuous stirring. Stir the obtained mixed solution at room temperature for 30 minutes to grow gold nanoparticles on the MXene flakes. Subsequently, centrifuge the mixed solution at 5000 rpm for 3 min, wash the collected precipitate thoroughly with ultrapure water, and obtain the Au-MXene-luminol nanocomposite after freeze-drying.

[0078] Figure 3 It is a characterization diagram of the Au-MXene-luminol nanocomposite. Among them, Figure 3 a in Figure 3 is a transmission electron microscope image, Figure 3 b in Figure 3 is an infrared spectrum, Figure 4 c in Figure 3 is a fluorescence spectrum, Figure 3 and d in Figure 4 is an X-ray diffraction pattern. Figure 3 is the infrared spectrum of the physical mixture of luminol diazonium salt and MXene. In the transmission electron microscope image ( Figure 3 a in Figure 3 ), it can be seen that the surface of the flaky MXene is decorated with gold nanoparticles with an average diameter of 46 nm. Compared with the luminol diazonium salt, in the infrared spectrum of the Au-MXene-luminol nanocomposite ( Figure 3 b in Figure 4 ), the diazonium peak at 2283 cm-1 disappears, and a new Ti-O-C stretching vibration band appears at 1100 cm-1. In contrast, Figure 4 is the infrared spectrum of the physical mixture of luminol diazonium salt and MXene, and it is found that the diazonium peak at 2283 cm-1 is still visible, and the Ti-O-C peak at 1100 cm-1 is not visible. These results indicate that physical mixing does not cause the characteristic peak of the diazonium group at 2283 cm-1 to disappear, and the changes in the FT-IR characteristic peaks of MXene-luminol and Au-MXene-luminol are due to the loss of the diazonium group during the reaction of luminol with MXene, forming a Ti-O-C chemical bond, indicating that luminol has been successfully grafted onto the surface of the MXene nanosheets. In the fluorescence spectrum ( Figure 3 c in Figure 3 ), MXene does not have fluorescence emission under the excitation of 331 nm, while MXene-luminol and Au-MXene-luminol have strong fluorescence emission at 430 nm, with a slight red shift compared with the luminol diazonium salt, indicating that luminol has been successfully grafted onto the surface of MXene, resulting in the fluorescence emission of the nanocomposite. In the X-ray diffraction pattern ( Figure 3 d in Figure 3 ), MXene does not have an XRD peak at 39°, and the (002) peak of Ti3AlC2 at 9.5° shifts to a lower angle, indicating the formation of MXene. After the grafting of luminol, the (002) peak in the XRD spectra of MXene-luminol and Au-MXene-luminol remains unchanged, indicating that the covalent grafting of the diazonium salt does not cause the structural collapse of the layered MXene nanosheets. In addition, five characteristic diffraction peaks at 38°, 44°, 64°, 77° and 82° are observed on Au-MXene-luminol, corresponding to the (111), (200), (220), (311) and (222) crystal planes of the face-centered cubic gold single crystal, indicating the effective growth of AuNPs.

[0079] Figure 5 X-ray photoelectron spectroscopy (XPS) spectra of MXene nanosheets and Au-MXene-luminol nanocomposites Figure 5 In (a) is the full XPS spectrum Figure 5 In (b), Figure 5 In (c), Figure 5 In (d), Figure 5 In (e), Figure 5 In (f) are the high-resolution spectra of C 1s, O 1s, Ti 2p, N 1s, and Au 4f, respectively. Compared with MXene, characteristic peaks of N element and Au element appear in the full spectrum of Au-MXene-luminol, which come from luminol and gold nanoparticles, respectively. Compared with MXene, two new peaks appear in the C 1s spectrum of Au-MXene-luminol at 285.90 and 288.00 eV, which are attributed to the C-N and C=O bonds of luminol. A new peak appears at 533.90 eV in the O1s spectrum of Au-MXene-luminol, which is attributed to the C=O bond of luminol, and the peak intensities of C-Ti-(OH)x and C-Ti-Ox decrease significantly. A new peak appears at 531.43 eV, representing the formation of Ti-O-C, indicating that the reaction process between luminol diazonium salt ions and MXene is the reaction between diazonium salt ions and -OH and =O functional groups of MXene, and after removing the diazonium group, a Ti-O-C covalent bond is formed with MXene.

[0080] (5) Electrochemiluminescence performance of Au-MXene-luminol nanocomposites: Equal volumes of luminol with the same mass concentration, physical mixture of luminol and MXene (MXene+luminol), physical mixture of luminol and MXene-Au (MXene-Au+luminol), MXene-luminol prepared in step (3), and Au-MXene-luminol nanocomposites prepared in step (4) were respectively drop-coated on the electrode. After drying with an infrared lamp, they were placed in 5 mL of PBS (pH 7.4) containing 0.02 M H2O2 for electrochemiluminescence testing. The test type was cyclic voltammetry testing, the potential window was 0 V to 0.8 V, the scan rate was 100 mV / s, and the PMT excitation voltage was 800 V.

[0081] The obtained electrochemiluminescence curve is as shown in Figure 6As shown, compared with luminol, the ECL intensity of the mixture of luminol and MXene increased by 38.6%, which is due to the excellent conductivity and catalytic performance of MXene, accelerating the processes of electron transfer and ring-opening oxidation of luminol; the ECL intensity of the mixture of luminol and MXene-Au was twice that of luminol, which is because the presence of gold nanoparticles provides a bare catalytic surface with high electrocatalytic performance, further enhancing the ECL intensity; the ECL intensity of MXene-luminol was doubled compared with that of luminol. On the one hand, it is because the luminol group is covalently bonded to MXene, shortening the electron transfer distance between luminol and the electrode interface. On the other hand, it benefits from the fact that MXene with a large surface area as a carrier enriches more luminol, thus enhancing the ECL signal; the ECL intensity of Au-MXene-luminol was six times that of luminol, indicating that the synergistic effect of gold nanoparticles and MXene more significantly improved the ECL performance of luminol.

[0082] Example 2

[0083] Preparation method of an electrochemiluminescence biosensor based on Ti3C2-Au nanocomposite grafted with luminol diazonium ions( Figure 1 ).

[0084] (1) Preparation of Au-MXene-luminol nanocomposite: The same as steps (1)-(4) of Example 1.

[0085] (2) Preparation of SP-Au-MXene-luminol nanoprobe: Add 100 μL of signal probe solution (SP, 1.5 μM, sequence is GATACAAAAGTTGC) to 500 μL of Au-MXene-luminol aqueous solution (1 mg / mL), stir and react at 4 °C for 12 h, centrifuge the dispersion solution at 5000 rpm for 2 min, and then redisperse it into 500 μL of TE buffer to obtain SP-Au-MXene-luminol nanoprobe solution, and store it at 4 °C for later use.

[0086] (3) Modify the working electrode: Mechanically polish the gold electrode with 0.3 μM and 0.05 μM α-Al2O3 slurries Ultrasonically rinse with ethanol and ultrapure water. Then, before any modification, perform electrochemical cleaning on the gold electrode. In 1 M sulfuric acid solution, cycle between -0.1 V and +1.60 V about 10 times, and the scanning rate is 0.05 V·s -1, until the oxidation and reduction peak currents reach a constant value. After drying, 5 μL of CP (1 μM, with the sequence CTTTGTGTGATTAC) solution was drop-coated on the electrode and incubated at 4 °C for 12 h to complete the immobilization of the capture probe (CP). After washing with PBS at pH 7.4 and drying by nitrogen purging, 5 μL (1 mM) of the blocking agent mercaptoethanol solution (MCH) was drop-coated on the CP-modified gold electrode (Au / CP). MCH was retained at 37 °C for 60 minutes to block non-specific binding sites. The modified gold electrode was washed with PBS at pH 7.4 and dried again by nitrogen purging to obtain the working electrode.

[0087] (4) Construction of the electrochemiluminescence miRNA sensor: The working electrode prepared in step (3), the counter electrode platinum electrode, and the reference electrode Ag / AgCl electrode formed a three-electrode system, and the SP-Au-MXene-luminol nanoprobe prepared in step (2) was used in combination to construct the miRNA sensor.

[0088] (5) Making the standard curve: 5 μL of miRNA-377 solutions with different concentrations (50 aM, 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM) were drop-coated on the working electrode and incubated at 37 °C for 60 min. Then, the working electrode (Au / CP / miRNA) capturing miRNA was carefully rinsed with PBS at pH 7.4 and dried by nitrogen purging. Subsequently, 5 μL of the SP-Au-MXene-luminol nanoprobe solution was drop-coated and incubated at 37 °C for 90 min. Finally, the working electrode (Au / CP / miRNA / SP-Au-MXene-luminol) modified with the SP-Au-MXene-luminol nanoprobe was carefully rinsed with PBS at pH 7.4, dried by nitrogen purging, and placed in 5 mL of PBS (pH 7.4) containing 0.02 M H2O2 for electrochemiluminescence testing. The test type was cyclic voltammetry testing, the potential window was 0 V to 0.8 V, the scanning rate was 100 mV / s, and the PMT excitation voltage was 800 V.

[0089] The electrochemiluminescence curve graph and the standard curve graph measured by the electrochemiluminescence biosensor based on the Ti3C2-Au nanocomposite grafted with luminol diazonium ions obtained in this example under different concentrations of miRNA-377 are as Figure 7 shown. In the range of 50 aM to 1 nM, there is a good linear relationship between the ECL intensity and the logarithm lgc of the miRNA-377 concentration miRNA , and the linear regression equation is I(ECL) = 489.70 * lgc miRNA + 2762.07, and the correlation coefficient R 2= 0.999, and the detection limit is 5.64 aM, where I(ECL) is the ECL intensity and c miRNA is the concentration of miRNA-377.

[0090] Example 3

[0091] A preparation method of an electrochemiluminescence biosensor based on Ti3C2-Au nanocomposite grafted with luminol diazonium ions.

[0092] (1) Preparation of Au-MXene-luminol nanocomposite: The same as steps (1)-(4) of Example 1.

[0093] (2) Preparation of SP-Au-MXene-luminol nanoprobe: Add 100 μL of signal probe solution (SP, 1.5 μM, sequence: GATACAAAAGTTGC) to 500 μL of Au-MXene-luminol aqueous solution (1 mg / mL), stir and react at 4 °C for 12 h, centrifuge the dispersion solution at 5000 rpm for 2 min, and then disperse it into 500 μL of TE buffer to obtain SP-Au-MXene-luminol nanoprobe solution, which is stored at 4 °C for later use.

[0094] (3) Modify the working electrode: Mechanically polish the gold electrode with 0.3 μM and 0.05 μM α-Al2O3 slurries and ultrasonically rinse with ethanol and ultrapure water. Then, before any modification, perform electrochemical cleaning on the gold electrode. In 1 M sulfuric acid solution, cycle between -0.1 V and +1.60 V about 10 times, with a scan rate of 0.05 V·s -1 , until the oxidation and reduction peak currents reach a constant value. After drying, drop 5 μL of CP (1 μM, sequence: CTTTGTGTGATTAC) solution on the electrode and incubate at 4 °C for 12 h to complete the immobilization of the capture probe (CP). Wash with PBS with a pH of 7.4, blow dry with nitrogen, and then drop 5 μL (1 mM) of blocking agent mercaptoethanol solution (MCH) on the CP-modified gold electrode (Au / CP). MCH is retained at 37 °C for 60 minutes to block non-specific binding sites. Wash the modified gold electrode with PBS with a pH of 7.4 and blow dry with nitrogen again to obtain the working electrode.

[0095] (4) Construction of the electrochemiluminescence miRNA sensor: The working electrode prepared in step (3), the counter electrode platinum electrode, and the reference electrode Ag / AgCl electrode form a three-electrode system, and the SP-Au-MXene-luminol nanoprobe prepared in step (2) is used in combination to construct the miRNA sensor.

[0096] (5) Selective testing: 5 μL of 100 fM miRNA solutions with different sequences were drop-coated on the working electrode and incubated at 37 °C for 60 min. Among them, the sequence of miRNA-377 is AUCACACAAAGGCAACUUUUGU, the sequence of miRNA (S-RNA) with one base mismatch with the target miRNA-377 is AACACACAAAGGCAACUUUUGU, the sequence of miRNA (T-RNA) with three base mismatches with the target miRNA-377 is AACACACAUAGGCAACUAUUGU, and the sequence of miRNA with completely misaligned bases (N-RNA) with the target miRNA-377 is UUGUACUACACAAAAGUACUG. Then, the working electrode capturing miRNA was carefully rinsed with PBS at pH 7.4, dried by nitrogen purging, and then 5 μL of SP-Au-MXene-luminol nanoprobe solution was drop-coated and incubated at 37 °C for 90 min. Finally, the working electrode modified with SP-Au-MXene-luminol nanoprobe was carefully rinsed with PBS at pH 7.4, dried by nitrogen purging, and placed in 5 mL of PBS (pH 7.4) containing 0.02 M H2O2 for electrochemiluminescence testing. The test type was cyclic voltammetry testing, the potential window was 0 V to 0.8 V, the scan rate was 100 mV / s, and the PMT excitation voltage was 800 V.

[0097] The results of the selective testing in this example are as Figure 8 shown. Only when miRNA-377 is present, the ECL signal is the strongest. The ECL intensity ratios of miRNA-377, S-RNA, T-RNA, and N-RNA are 100:17.36:10.20:6.49, respectively, proving that the miRNA-377 biosensor constructed by the present invention has good specificity and has the value of practical application.

[0098] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention.

Claims

1. A Ti3C2-Au nanocomposite based on diazonium ion grafting, characterized in that, It includes the following components: Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles; the gold nanoparticles are attached to the surface of the Ti3C2 MXene nanosheets, and the luminol diazonium salt ions are covalently connected through Ti-O-C bonds after reacting with the Ti3C2 MXene nanosheets.

2. The Ti3C2-Au nanocomposite based on diazonium ion grafting according to claim 1, wherein The mass molar ratio of the Ti3C2 MXene nanosheets, luminol diazonium salt ions, and gold nanoparticles is 5 - 20 mg: 0.05 - 0.5 mmol: 0.01 - 0.1 mmol.

3. The preparation method of the Ti3C2-Au nanocomposite based on diazonium ion grafting according to claim 1 or 2, characterized in that, It includes the following steps: (1) Disperse the Ti3C2 MXene nanosheets and luminol diazonium salt ions in anhydrous acetonitrile, stir, centrifuge, and wash to obtain MXene-luminol powder. (2) Disperse the MXene-luminol powder obtained in step (1) in deionized water, ultrasonically treat it, then dropwise add HAuCl4 solution, stir, centrifuge, and wash, and freeze-dry to obtain the Ti3C2-Au nanocomposite based on diazonium ion grafting.

4. The preparation method according to claim 3, wherein The preparation method of the Ti3C2 MXene nanosheets includes the following steps: Disperse lithium fluoride in hydrochloric acid solution and stir; then add Ti3AlC2 powder and stir for etching; after centrifuging and washing until the pH is neutral, ultrasonically treat it in water under a protective atmosphere, centrifuge, and take the supernatant for freeze-drying to obtain Ti3C2 MXene nanosheets.

5. The preparation method according to claim 3, characterized in that, The preparation method of the luminol diazonium salt ions includes the following steps: (a) Dissolve luminol in hydrochloric acid solution, and dropwise add sodium nitrite solution to the above solution under continuous stirring, and stir for reaction. (b) Add sodium tetrafluoroborate to the solution obtained in step (a), stir for reaction, filter to collect the precipitate, and vacuum-dry to obtain luminol diazonium salt ions.

6. An electrochemiluminescent biosensor, characterized in that, It includes a working electrode loaded with a capture probe and the Ti3C2-Au nanocomposite based on diazonium ion grafting as described in claim 1 or 2 loaded with a signal probe.

7. The electrochemiluminescent biosensor according to claim 6, wherein The working electrode loaded with the capture probe is a gold electrode directly loaded with the capture probe, or the capture probe is loaded on the working electrode through Ti3C2-Au. The capture probe is a DNA capture probe modified with a thiol group at the end; the sequence of the DNA capture probe modified with a thiol group at the end is 5’-CTTTGTGTGATTAC(SH)-3’. The signal probe is a DNA signal probe modified with a thiol group at the end; the sequence of the DNA signal probe modified with a thiol group at the end is 5’-(SH)GATACAAAAGTTGC-3’. The biosensor electrode also includes a counter electrode and a reference electrode; the counter electrode is a platinum electrode, and the reference electrode is an Ag / AgCl electrode.

8. The electrochemiluminescent biosensor according to claim 7, wherein The preparation method of the gold electrode of the direct load capture probe comprises the following steps: polishing the gold electrode with α-Al2O3 slurry, performing electrochemical activation in a sulfuric acid solution, after the gold electrode is dried, dropping the capture probe solution on the surface of the gold electrode, and incubating, rinsing and drying the electrode, and then incubating with a blocking agent mercaptoethanol solution, and obtaining the gold electrode of the direct load capture probe after rinsing and drying.

9. The electrochemiluminescent biosensor according to claim 6, characterized in that, The preparation method of the diazonium ion grafted Ti3C2-Au nanocomposite loaded with signal probes comprises the following steps: dispersing the diazonium ion grafted Ti3C2-Au nanocomposite in deionized water, adding the signal probe solution, stirring, centrifuging and collecting the precipitate to obtain the diazonium ion grafted Ti3C2-Au nanocomposite loaded with signal probes.

10. Use of the electrochemiluminescent biosensor according to any one of claims 6 to 9 in the electrochemiluminescent detection of miRNA, characterized in that, Comprising the following steps: Dropping miRNA solution onto the working electrode loaded with capture probes, incubating to enable the capture probes to capture target miRNA, then dropping the solution of the diazonium ion grafted Ti3C2-Au nanocomposite loaded with signal probes, incubating to enable the signal probes to bind to the target miRNA, then performing electrochemiluminescence test, and calculating the concentration of the miRNA solution according to the standard curve; the electrochemiluminescence test type is cyclic voltammetry.

Images