A subspecies of Bifidobacterium animalis YYS-J9 with heavy metal adsorption and short-chain fatty acid production capabilities and its applications
The application of Bifidobacterium animalis subsp. lactis YYS-J9 has solved the problems of heavy metal adsorption, short-chain fatty acid production and Candida albicans inhibition, achieving the effects of heavy metal detoxification, constipation treatment and intestinal health, and enhancing antioxidant capacity.
Patent Information
- Application Number
- CN202311735512.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-15
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2043-12-15
AI Technical Summary
There is a lack of effective methods in the current technology to adsorb heavy metals lead and cadmium, produce short-chain fatty acids, and inhibit Candida albicans. Furthermore, the extraction process of superoxide dismutase (SOD) enzyme is complex and the yield is limited, resulting in poor efficacy in the treatment of heavy metal poisoning and constipation.
A new strain of Bifidobacterium animalis, YYS-J9, is provided. It can produce short-chain fatty acids, adsorb heavy metals lead and cadmium, inhibit Candida albicans, and secrete SOD enzymes. It can be used to prepare fermented foods by fermenting fruits and traditional Chinese medicines.
Bifidobacterium animalis subsp. lactis YYS-J9 can significantly adsorb heavy metals, produce short-chain fatty acids, inhibit Candida albicans, and secrete SOD enzymes. It can be used in products for heavy metal detoxification, constipation treatment, and Candida albicans inhibition to improve intestinal health and antioxidant capacity.
Smart Images

Figure CN117701445B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a subspecies of Bifidobacterium animalis YYS-J9 with heavy metal adsorption and short-chain fatty acid production capabilities, and its applications. Background Technology
[0002] Heavy metals lead and cadmium are unavoidable pollutants in modern agriculture and industry. For example, the use of fertilizers and pesticides, and wastewater from the dyeing and printing industries all contribute to the production of lead and cadmium. Lead is also present in automobile exhaust, discarded batteries, and cosmetics. These heavy metals enter the soil, air, and water, and are absorbed by the human body directly or indirectly through the food chain. Because lead and cadmium are highly accumulative heavy metals, they easily accumulate in large quantities in the body after entering. Lead is mainly stored in the brain, liver, kidneys, and bones, harming organs and the nervous system, affecting intellectual development, and inducing chronic brain damage and anemia. Cadmium mainly accumulates in the kidneys, lungs, bones, and liver. Long-term accumulation can cause poisoning, damage the kidneys, lead to bone diseases, cause bone pain syndrome, and disrupt gastrointestinal function, lowering the zinc-cadmium ratio and leading to increased hypertension. Currently, the main medical treatments for lead and cadmium poisoning are laxatives and induced vomiting. These methods have significant side effects and increase patient suffering. Therefore, it is necessary to find an effective method for daily detoxification.
[0003] Constipation is a common digestive system problem. In my country, the prevalence of chronic constipation in adults ranges from 4.0% to 10.0%, reaching 23.0% in people over 60 years old and 38.0% in those over 80 years old. This has a significant negative impact on patients' quality of life and health. Short-chain fatty acids (SCFAs) are a class of organic acids, including acetic acid, propionic acid, butyric acid, and valeric acid. It has been proven that SCFAs play an important role in regulating intestinal health, energy metabolism, and immune regulation. In regulating the intestines, they mainly work by lowering intestinal pH, inhibiting the growth of harmful bacteria, directly stimulating intestinal wall nerves, promoting intestinal epithelial cell proliferation, and accelerating intestinal peristalsis. This limits the accumulation of putrefactive substances in the intestines, enhances intestinal function, and thus helps prevent and treat constipation. SCFAs mainly originate from the fermentation of intestinal flora and are found in some foods. Supplementing with probiotics that efficiently utilize various carbohydrates and produce high levels of SCFAs is an important measure to increase intestinal SCFA levels.
[0004] Candida albicans is a common type of Candida fungus, also known as white worm. It belongs to the fungal kingdom and is an opportunistic pathogen that can cause acute and chronic infections of the skin, mouth, mucous membranes, and internal organs under specific conditions. Candida albicans can exist on human skin, mucous membranes, the digestive tract, and other organs. When the body's resistance is lowered, Candida albicans will multiply, and when it reaches a certain amount, it will cause illness. This fungal infection can occur in the mouth, esophagus, vagina, etc., causing corresponding diseases. Candida albicans can be transmitted through public baths, bathtubs, towels, swimwear, clothing, medical instruments, and dressings; therefore, prevention and infection control are extremely important.
[0005] Superoxide dismutase (SOD) is an antioxidant metalloenzyme that catalyzes the dismutation of superoxide anion free radicals into oxygen and hydrogen peroxide. It plays a crucial role in maintaining the body's oxidation-antioxidant balance, possessing various effects such as anti-aging, anti-fatigue, anti-inflammation, anti-tumor, anti-radiation, and enhanced liver and kidney function. It also repairs cells and activates other enzymes in the body, making it an internationally recognized "body waste scavenger," often referred to as the "king of anti-aging" and "beauty darling." The extraction process for SOD is exceptionally complex, resulting in extremely limited yields; therefore, the availability of foods containing SOD is particularly important.
[0006] Based on this, the purpose of this invention is to provide a probiotic that can adsorb heavy metals lead and cadmium, produce short-chain fatty acids, inhibit Candida albicans, and secrete SOD enzymes, in order to be applied to the development of products for heavy metal detoxification, relief and treatment of constipation, and inhibition of Candida albicans. Summary of the Invention
[0007] To address the shortcomings of the prior art mentioned in the background section, this invention provides a *Bifidobacterium animalis* subspecies *YYS-J9*, classified as *Bifidobacterium animalis* subspecies *Lactobacillus*, with the Latin scientific name: Bifidobacterium animalis subsp. lactis, It was deposited on August 17, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28185.
[0008] The present invention also provides a composition containing Bifidobacterium animalis subsp. YYS-J9 as described above.
[0009] In one embodiment, the composition includes a microbial preparation or a food product.
[0010] In one embodiment, the number of *Bifidobacterium animalis* subsp. *Lactobacillus* YYS-J9 in the composition is ≥1×10⁻⁶. 6 CFU / mL or ≥1×10 6CFU / g.
[0011] Preferably, in the composition, the number of *Bifidobacterium animalis* subsp. *Lactobacillus* YYS-J9 is ≥1×10⁻⁶. 8 CFU / mL or ≥1×10 8 CFU / g.
[0012] In one embodiment, the composition comprises either uninactivated Bifidobacterium lactis subsp. YYS-J9 or freeze-dried Bifidobacterium lactis subsp. YYS-J9.
[0013] The present invention also provides a fermentation product obtained by fermentation of Bifidobacterium animalis subsp. YYS-J9 as described above.
[0014] The present invention also provides the application of Bifidobacterium lactis subsp. YYS-J9 as described above in the preparation of functional products.
[0015] The present invention also provides the use of Bifidobacterium animalis subsp. lactis YYS-J9 as described above or the composition described above in the preparation of fermented foods.
[0016] In one embodiment, Bifidobacterium animalis subsp. lactis YYS-J9 is used as a probiotic to ferment fruits and traditional Chinese medicines to prepare fermented foods.
[0017] Based on the above, compared with the prior art, the Bifidobacterium lactis subspecies YYS-J9 provided by the present invention has the following beneficial effects:
[0018] The Bifidobacterium animalis subsp. YYS-J9 provided by this invention can produce short-chain fatty acids, especially high levels of short-chain fatty acids produced by utilizing stachyose and galactooligosaccharides. It can adsorb heavy metals Pb and Cd, has a significant antibacterial effect on Candida albicans, has good hydrophobic interaction and biofilm formation ability, and can produce SOD enzyme.
[0019] This bacterium can provide a new source of probiotics for the development of laxative products, heavy metal detoxification products, antibacterial products, and SOD enzyme products, and has important application value.
[0020] Other features and beneficial effects of the invention will be set forth in the following description, and will be apparent in part from the description, or may be learned by practicing the invention. The objects and other beneficial effects of the invention can be realized and obtained by means of the structures particularly pointed out in the description, claims and drawings. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Unless otherwise specified, the positional relationships shown in the drawings in the following description are based on the direction in which the components are drawn in the figure.
[0022] Figure 1 The colony morphology of Bifidobacterium lactis subsp. YYS-J9 provided in this embodiment of the invention;
[0023] Figure 2 Gram staining morphology of Bifidobacterium lactis subspecies YYS-J9 provided in this embodiment of the invention;
[0024] Figure 3 A scanning electron microscope image of Bifidobacterium lactis subsp. YYS-J9 provided in an embodiment of the present invention;
[0025] Figure 4 Agarose gel electrophoresis image of the 16S rDNA target fragment amplified from Bifidobacterium lactis subsp. YYS-J9 provided in this embodiment of the invention;
[0026] Figure 5 This is a phylogenetic tree diagram of the 16S rDNA gene of Bifidobacterium lactis subspecies YYS-J9 provided in an embodiment of the present invention.
[0027] Figure 6 A statistical chart showing the growth status of Bifidobacterium animalis subsp. YYS-J9 using various oligosaccharides, provided in an embodiment of the present invention.
[0028] Figure 7 A statistical chart showing the acetic acid production of Bifidobacterium lactis subspecies YYS-J9 by various sugars, provided in an embodiment of the present invention;
[0029] Figure 8 A statistical chart showing the production of short-chain fatty acids by various sugars using Bifidobacterium lactis subspecies YYS-J9, as provided in an embodiment of the present invention. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. The technical features designed in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0031] In the description of this invention, it should be noted that all terms used in this invention (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and should not be construed as limiting the invention; it should be further understood that the terms used in this invention should be understood to have the same meaning as those in the context of this specification and in the relevant field, and should not be understood in an idealized or overly formal sense, except as expressly defined in this invention.
[0032] This invention relates to Bifidobacterium lactis subsp. YYS-J9 ( Bifidobacterium animalis subsp. lactis It was isolated from naturally fermented yogurt and is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 28185.
[0033] Example 1: Screening and Isolation of Bacteria
[0034] Multiple fresh milk samples were collected, and 200 mL of each sample was placed in sterilized glass fermentation flasks. The samples were then naturally fermented at 37°C for 3 days. Samples that successfully fermented, exhibiting a coagulated consistency and emitting an aromatic fragrance, were then diluted sequentially to a 10⁻⁶ level. -2 10 -3 Take 0.1 mL of the diluted solution and spread it on MRSL medium. Incubate anaerobicly at 37℃ for 48-72 h. Select several single colonies of suspected lactic acid bacteria, purify them 3 times, and test the lead adsorption effect. Select strains with good lead adsorption effect, preserve them and name them YYS-J9.
[0035] Example 2: Identification of bacterial strains
[0036] 2.1 Morphological observation of YYS-J9 bacteria
[0037] The colony morphology of YYS-J9 is as follows: Figure 1 As shown, the bacterial cell morphology is as follows Figure 2 and Figure 3As shown. The main morphological characteristics of YYS-J9 are as follows: On MRSL medium, it is milky white, with round, smooth colonies that are convex and opaque in the middle, and the colony edge is intact with a thin layer around it; it is Gram positive, rod-shaped, with some meristematic stages branching out from the middle, and the cell length is 2.5-5μm and the width is 0.6-1.2μm.
[0038] 2.2 Physiological and biochemical analysis of YYS-J9 bacteria
[0039] The biochemical experiments on lactic acid bacteria were conducted according to the standard method of GB4789.35. Specifically, a basal culture medium for lactic acid bacteria was prepared, containing cellobiose, maltose, mannitol, maltose, salicin, sorbitol, sucrose, raffinose, inulin, lactose, and 1% sodium hippurate. Bifidobacterium animalis subsp. lactis YYS-J9 was inoculated at 1%. After the culture was completed, 0.2 mL of ninhydrin solution was slowly added along the wall of the test tube without shaking. The tubes were then incubated in a water bath at 36℃±1℃ for 10 minutes before the results were interpreted. The interpretation results are detailed in Table 1.
[0040] Table 1. Glycohydrates and major biochemical reactions of YYS-J9
[0041]
[0042] Note: "+" indicates a positive test result, and "-" indicates a negative test result.
[0043] Conclusion: According to the results in Table 1, YYS-J9 can utilize maltose, salicin, inulin, sucrose, lactose, and raffinose, but cannot utilize mannitol, sorbitol, cellobiose, and sodium hippurate.
[0044] 2.3 Molecular biological identification of YYS-J9 bacteria
[0045] ① Extraction of YYS-J9 bacterial genomic DNA: Genomic DNA was extracted using a bacterial genomic DNA extraction kit from TIANGEN.
[0046] ② PCR amplification of the 16S rDNA sequence: The primers used to amplify the 16S rDNA gene sequence are:
[0047] F 9-27: 5'-GAGTTT GAT CCT GGC TCA G-3';
[0048] R 1525-1542: 5'–AGA AAG GAG GTG ATC CAG CC-3';
[0049] Specific primers for the Bifidobacterium GroEL gene:
[0050] 308F:5'-TCC GAT TAC GAY CGY GAG AAG CT -3');
[0051] 806R: 5'-CSG CYT CGG TSG TCA GGA ACA G-3'.
[0052] PCR reaction system: 2×Mix 12.5 μL, primers and DNA 1 μL each, ddH2O 9.5 μL.
[0053] PCR amplification program: Pre-denaturation at 93℃ for 4 min. Then denature at 94℃ for 30 s, extend at 55℃ and 72℃ for 90 s, for a total of 30 cycles. Finally, extend at 72℃ for 10 min and store at 4℃.
[0054] ③ PCR product detection and sequencing analysis: 5 μL of PCR product was separated and examined by gel electrophoresis in 1.0% (w / v) agarose gel containing EB. The amplified 16S rDNA target fragment was 1503 bp in length, and the GroEL gene was 461 bp in length (see agarose gel electrophoresis image of the target fragment amplification for details). Figure 4 ).
[0055] ④ Phylogenetic analysis: Blast alignment analysis was performed on each 16S rRNA sequence in NCBI data to obtain the sequence and... Bifidobacterium animalis subsp. lactis The sequence homology of the strains was greater than 99.5%;
[0056] Furthermore, the Bifidobacterium GroEL gene was compared to obtain its correlation with... Bifidobacterium animalis subsp. lactis The homology of the standard bacteria was 99.55%, and... Bifidobacterium animalis subsp. animalis The homology of the standard strain was 95.85%, while the homology with other species was less than 90%. The phylogenetic tree was constructed using the Neighbor-joining method in MEGA 4 using the 16S rRNA gene (results are shown in [link to results]). Figure 5 ), to determine it as Bifidobacterium animalis subsp. lactis .
[0057] The YYS-J9 16S rDNA sequence determination results are as follows:
[0058]
[0059] The YYS-J9 GroEL gene sequence determination results are as follows:
[0060] GGGGGCTAGGCTGACTGGCAGGTGGCGTCGCCGTCATCAAGGTCGGCGCAGCCACCGAGGTCGAGGCCAAGGAGCGCAAGCACCGCATTGAAGATGCCGTGCGCAACGCCAAGGCCGCCATCGAAGAGGGTCTGGTTCCGGGCGGCGGCGTCGCACTGGTGCAGGCTGCCGAAAAGGTTGAGAAGGACTTCAACCTTGAAGGCGACGAGGCCACCGGTGCCGCAATCGTCT TCTCGGGCATCGAGGCTCCGATTAAGCAGATCGCCGAAAATGCAGGTCTCTCTGGCGCCGTGGTGATCGACAAGGTTCGTTCCCTGCCTGAGGGTGAGGGCTTCAATGCGGCAACCGACACCTATGAGGATCTCATGGCCGCCGGTGTGACCGATCCTGTCAAGGTGACTCGTTCTGCTTTGCAGAATGCGGCCTCCATCGCGGGTCTGTTCCTGACCCCCGGAAGCCG.
[0061] Conclusion: Based on morphological observation, lactic acid bacteria biochemical identification, and homology analysis in the DNA phylogenetic tree, YYS-J9 was identified as a subspecies of Bifidobacterium animalis (Lactobacillus lactis). Bifidobacterium animalis subsp. lactis ) bacterial strains.
[0062] The performance characterization of Bifidobacterium lactis subspecies YYS-J9 provided by this invention is as follows:
[0063] Example 3: Analysis of the growth and short-chain fatty acid production of Bifidobacterium animalis subsp. lactis YYS-J9 using oligosaccharides.
[0064] Various oligosaccharide media were prepared by replacing glucose in MRSL medium with an equal amount of oligosaccharides. YYS-J9 yeast culture was inoculated at 1% (v / v) into MRSL media containing each oligosaccharide, and cultured at 37℃ for 48 h. The bacterial OD was then measured. 600 Values and short-chain fatty acids. Results are shown in... Figure 6The results show that strain YYS-J9 can grow in MRSL medium with trehalose, stachyose, inulin, galactooligosaccharides, isomaltooligosaccharides, and fructooligosaccharides replacing glucose, with growth OD values between 1.62 and 1.90, indicating that it can effectively utilize the above polysaccharides as carbon sources for growth.
[0065] Figure 7 The results of acetic acid production analysis showed that YYS-J9 can produce short-chain fatty acids using various oligosaccharides. Among them, the ability to produce acetic acid using trehalose and galactooligosaccharides is higher than that using glucose. The acetic acid production of all samples ranged from 5.94 to 13.84 mmol / L. Figure 8 The results of the detection of propionic acid, isobutyric acid, n-butyric acid, and isovaleric acid showed that the yield of propionic acid ranged from 41.44 to 75.17 μmol / L, the yield of isobutyric acid ranged from 65.24 to 115.25 μmol / L, the yield of n-butyric acid ranged from 16.82 to 88.73 μmol / L, and the yield of isovaleric acid ranged from 26.48 to 49.01 μmol / L. Stachyose and galactooligosaccharides significantly promoted the yield of the above short-chain fatty acids, while trehalose and galactooligosaccharides had a good promoting effect on the yield of butyric acid.
[0066] Example 4: Adsorption effect of Bifidobacterium animalis subsp. lactis YYS-J9 on heavy metals Pb and Cd
[0067] After centrifuging the fermentation broth of *Bifidobacterium animalis* subsp. *lactamase* YYS-J9 for 24-48 hours, collect the bacterial cells, add PBS, and adjust the total particle count of the bacterial suspension to (1.0±0.1)*10⁻⁶ using flow cytometry. 9 CFU / mL, lead acetate was added to an initial concentration of approximately 5 mg / kg, and the mixture was allowed to stand at 37 ℃ for 4 hours for adsorption. A lead acetate PBS solution of the same concentration without bacterial suspension was used as a control. The supernatant was collected by centrifugation and the lead adsorption rate was determined according to the national standard GB 5009.268-2016 "National Food Safety Standard" for the determination of multiple elements in food: Method 1, Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Adsorption rate / % = (lead content) / (lead content / lead content). 对照 - Lead content 处理组 ) / Lead content 对照 *100.
[0068] After centrifuging the fermentation broth of *Bifidobacterium animalis* subsp. *lactamase* YYS-J9 for 24-48 hours, collect the bacterial cells and add PBS to adjust the total particle count of the bacterial suspension to (1.0±0.1)*10⁻⁶ using flow cytometry. 9CFU / mL, add cadmium sulfate to an initial concentration of approximately 10 mg / kg, and allow to stand at 37 ℃ for 4 hours for adsorption. Use PBS of the same concentration but without bacterial suspension as a control. Centrifuge and collect the supernatant. Determine the Cd adsorption rate according to the national standard GB 5009.268-2016 "National Food Safety Standard" for the determination of multiple elements in food: Method 1, Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Adsorption rate / % = (Cd content) / (Cd content / %). 对照 -Cd content 处理组 ) / Cd content 对照 *100.
[0069] Tests and calculations showed that the adsorption rate of YYS-J9 bacterial suspension for lead was 95.46±1.33%, and the adsorption rate for Cd was 84.62±2.14%, indicating that YYS-J9 has excellent adsorption effects on both Cd and lead.
[0070] Example 5: Hydrophobic interaction test of Bifidobacterium animalis subsp. lactis YYS-J9
[0071] Take Bifidobacterium animalis subsp. lactis YYS-J9 that has been fermented for 48 hours, centrifuge to remove the supernatant, wash twice with PBS, and then add PBS to adjust the OD. 600nm The value was 0.40±0.05, indicating that the YYS-J9 bacterial suspension was obtained. The actual OD value was then measured. 600nm The value is calculated as A0. Take 3 mL of YYS-J9 bacterial suspension, add 3 mL of xylene, mix thoroughly for 5 min, let stand for 1 h, take the lower aqueous phase, and measure the OD. 600nm The value is denoted as A. t ,Hydrophobic interaction force of bacteria / % = (A0 - A T The hydrophobic interaction force of YYS-J9 was calculated to be 78.424±3.859%, indicating that YYS-J9 has good hydrophobic interaction force (Table 2).
[0072] Table 2 YYS-J9 Hydrophobic Interaction Force Test
[0073]
[0074] Example 6: Biofilm Formation Capacity Analysis of Bifidobacterium lactis subspecies YYS-J9
[0075] MRSL medium was prepared by adding various oligosaccharides at a rate of 0.5 g / L. YYS-J9 was inoculated at 2% (v / v) and fermented at 37℃ for 24-48 h. The number of bacterial particles in each fermentation broth was detected by flow cytometry. Medium containing different oligosaccharides was added to adjust the bacterial OD to (1.0±0.1)*10⁻⁶. 8Take 200 μL of the adjusted fermentation dilution (cfu / mL) and place it in a 96-well plate. Incubate at 37°C for 24 h. Discard the culture medium, add 0.2 mL of 1% (v / v) crystal violet and react for 30 min. Rinse with distilled water, then dissolve in 0.2 mL of 95% (v / v) ethanol. Measure the absorbance of the resulting colored solution at 590 nm. Repeat the experiment three times and record the average value as OD. X The value, with uninoculated culture medium as a control, is counted as a replicate as OD. C When OD X OD C A ratio >1 indicates that the bacteria have the ability to form biofilms; the higher the ratio, the stronger the ability. The results are shown in Table 3, which indicates the OD values for each treatment. X :OD C The values were all greater than 2, indicating that YYS-J9 has a good biofilm formation ability. The biofilm formation ability was significantly higher after the addition of inulin and galactose than that after fermentation on MRSL (P<0.05), indicating that inulin and galactose help YYS-J9 to further promote biofilm formation.
[0076] Table 3 YYS-J9 Biofilm Formation Capacity Test
[0077]
[0078] Note: Different letters (ac) in the table indicate significant differences between samples.
[0079] Example 7: Antibacterial activity of Bifidobacterium animalis subsp. lactis YYS-J9 against Candida albicans.
[0080] The fermentation broth of Bifidobacterium animalis subsp. lactis YYS-J9 was used to determine the inhibition diameter against Candida albicans using the Oxford cup method. The result was 15.67±2.80 mm, indicating that YYS-J9 has a good inhibitory effect on this bacterium.
[0081] Example 8: Test of autoagglutination rate (%) and agglutination rate (%) of Bifidobacterium lactis subsp. YYS-J9
[0082] Preparation of strain YYS-J9 and Candida albicans ( Canidia Albicans 45 mL of the FSCC 129002 fermentation broth was centrifuged at 4500 r / min and 4℃ for 10 min to collect the bacterial sludge. The sludge was washed twice with sterile phosphate-buffered saline (PBS) at pH 7.0 (i.e., PBS was added to the colonies, the mixture was shaken to mix thoroughly, and then centrifuged at 4500 r / min and 4℃ for 10 min to collect the bacterial cells). A bacterial suspension with an absorbance of 0.6 ± 0.1 (A0) at 600 nm was then prepared using PBS.
[0083] Self-agglutination rate (%): YYS-J9 bacterial sludge was prepared into a bacterial suspension with an absorbance of 0.6 ± 0.1 (A0) at a wavelength of 600 nm using sterile PBS. The absorbance A was measured after standing for different time periods (2h, 4h, 24h). x ;
[0084] Self-agglomeration rate R / % = (1-A) x / A0)×100;
[0085] Where x represents 2, 4, and 24; A2 represents the absorbance value measured after the mixed suspension of bacteria has stood for 2 hours; A4 represents the absorbance value measured after the mixed suspension of bacteria has stood for 4 hours; A 24 The absorbance value is the value measured after the mixed suspension of bacteria has been allowed to stand for 24 hours. The same applies below.
[0086] Aggregation rate (%): YYS-J9 bacterial suspension and Candida albicans suspension were mixed in a 1:1 ratio, and the absorbance at a wavelength of 600 nm was adjusted to 0.6 ± 0.1 (A0) to obtain a mixed suspension. The absorbance A was measured after standing for different time periods (2h, 4h, 24h). x .
[0087] The results are shown in Table 4 below: It can be seen that the self-agglomeration rates of YYS-J9 at 2, 4 and 24 (h) were 24.47%, 29.61% and 76.57% respectively, indicating good self-agglomeration ability. The self-agglomeration rates with Candida albicans were 38.64%, 64.75% and 75.65% respectively, indicating that it has extremely high copolymerization ability with Candida albicans sugar.
[0088] Table 4. Determination of the autoagglomeration rate and Candida albicans agglomeration rate of YYS-BSM8
[0089]
[0090] Example 9: SOD enzyme production test of Bifidobacterium lactis subsp. YYS-J9
[0091] SOD enzyme detection was performed using a superoxide dismutase (SOD) assay kit (Nanjing Jiancheng). Specifically, the supernatant was obtained by centrifuging the YYS-J9 fermentation broth. The supernatant was then mixed with water at a 2:3 ratio. Following the kit instructions, the reaction system was prepared, thoroughly mixed, and incubated at 37°C for 20 minutes. The OD value was read at 450 nm using a microplate reader. In this study, the amount of enzyme corresponding to a 50% SOD inhibition rate in the reaction system was defined as one unit of SOD activity (U). Wherein:
[0092]
[0093]
[0094] The test results showed that the SOD enzyme activity in the fermentation supernatant of YYS-J9 was 52.77±0.13 U / mL, indicating that YYS-J9 has a good SOD enzyme production capacity.
[0095] Example 10: Survival analysis of Bifidobacterium lactis subsp. YYS-J9 in a simulated artificial gastric juice environment.
[0096] (1) The survival rate test process is as follows: YYS-J9 bacteria fermented for 24 hours were collected by centrifugation at 12000 r / min for 5 min, and the same volume of 0.85% (w / v) physiological saline was added and mixed to prepare a bacterial suspension for later use; artificial gastric fluid (125 mM NaCl, 7 mM KCl, 45 mM NaHCO3 and 3 g / L pepsin) was prepared and the pH value was adjusted to 2.0, 2.5 and 3.0, and filtered through a 0.22 μM microporous membrane for later use; 1 mL of bacterial suspension was added to 9 mL of artificial gastric fluid at different pH values and placed in a constant temperature culture at 37℃. 0.9 mL of untreated bacterial suspension (0 h) and samples treated for x (1, 2, 3 and 5) h were taken each time and 0.1 mL was added. PI was stained at 37℃ for 10 min, and 0.1 ml was taken into 0.9 mL of ultrapure water. The total bacterial count P1 / % and the number of dead bacteria P2 / % were detected by flow cytometry. The survival rate / % at different time points was calculated based on this. The survival rate of the untreated bacteria was used as a 100% control. The gastrointestinal tolerance of each treatment was calculated.
[0097] The formula for calculating bacterial survival rate at different treatment times is as follows:
[0098] Survival rate / % = [(P1) 处理组 - P2 处理组 ) / P1 处理组 ] / [ (P1 对照 - P2 对照 ) / P1 对照 ];
[0099] Among them, P1 处理组 The total number of bacterial particles in the treatment group, P2 处理组 This refers to the number of dead bacterial particles in the treatment group, P1 对照 This refers to the total number of bacterial particles in the control group, P2. 对照 This refers to the number of dead bacterial particles in the control group.
[0100] (2) The survival rate of bacteria YYS-J9 in different gastric fluid environments is shown in Table 5 below. According to the data, the following can be seen:
[0101] When YYS-J9 bacteria were treated in a simulated gastric juice environment with a pH of 2.0 for 1-5 hours, the survival rate was 83.67-92.86%; when treated in a simulated gastric juice environment with a pH of 2.5 for 1-5 hours, the survival rate was 85.32-95.81%; and when treated in a simulated gastric juice environment with a pH of 3.0 for 1-5 hours, the survival rate was 86.23-95.27%. This indicates that YYS-J9 has good tolerance to simulated gastric juice environments with pH as low as 2 (survival rate greater than 80%), which provides it with good tolerance to cross the gastric juice environment and reach the intestine.
[0102] Table 5 Survival rate of YYS-J9 in simulated gastric fluid environment / %
[0103]
[0104] Example 11: Survival analysis of Bifidobacterium animalis subsp. Lactobacillus YYS-J9 in a simulated artificial pancreatic juice environment.
[0105] (1) Take the fermentation broth of YYS-J9 bacteria that has been fermented for 24 h, centrifuge at 12000 r / min for 5 min to collect the bacterial cells, add the same volume of 0.85% (w / v) physiological saline and mix well to prepare a bacterial suspension for later use; prepare protein pancreatic juice [0.1% (w / v) pancreatic juice, 0.15% (w / v) bovine bile], adjust the pH value to 7.5 and 8.0 respectively, filter through a 0.22 μM microporous membrane for later use, take 1 mL of bacterial suspension in 9 mL of protein pancreatic juice with different pH values, and incubate at 37℃. Take samples after 3 h and 6 h of treatment, take 0.9 mL each time, add 0.1 mL of PI dilution, stain at 37℃ for 10 min, and detect the total bacterial count P1 / % and mortality rate P2 / % by flow cytometry, and calculate the survival rate / % at different time periods. The survival number of untreated bacterial suspension is used as 100% control to calculate the bacterial survival rate.
[0106] The formula for calculating bacterial survival rate is:
[0107] Survival rate / % = [(P1) 处理组 - P2 处理组 ) / P1 处理组 ] / [ (P1 对照 - P2 对照 ) / P1 对照 ].
[0108] Among them, P1 处理组 This refers to the total number of bacterial particles in the treatment group, P2 处理组 This refers to the number of dead bacterial particles in the treatment group, P1 对照 This refers to the total number of bacterial particles in the control group, P2. 对照This refers to the number of dead bacterial particles in the control group.
[0109] (2) The bacterial survival rate of strain YYS-J9 is shown in Table 6. According to the data, the following can be seen:
[0110] When treated in pancreatic juice at pH 7.5 for 3 h and 6 h, the survival rate of strain YYS-J9 was 86.02% and 81.05%, respectively, and the survival rate in pancreatic juice at pH 8.0 was 81.30% and 75.46%, respectively, indicating that it has good pancreatic juice tolerance.
[0111] Table 6 Survival rate of YYS-J9 in artificial simulated pancreatic juice environment / %
[0112]
[0113] This invention also provides the following application examples of Bifidobacterium lactis subspecies YYS-J9:
[0114] Example 12: Preparation of probiotic agent from Bifidobacterium animalis subsp. lactis YYS-J9
[0115] Bifidobacterium animalis subsp. lactis YYS-J9 was inoculated into a culture medium, such as MRS medium, and cultured at 0-38℃ for more than 15 hours. The bacterial cells were collected by centrifugation and resuspended in, for example, physiological saline or PBS buffer to prepare a liquid bacterial preparation containing Bifidobacterium animalis subsp. lactis YYS-J9.
[0116] Optionally, the bacterial cells of Bifidobacterium animalis subsp. lactis YYS-J9 are resuspended in a cell protectant and a carrier, and then freeze-dried to obtain a solid bacterial powder preparation containing Bifidobacterium animalis subsp. lactis YYS-J9.
[0117] Optionally, Bifidobacterium animalis subsp. lactis YYS-J9 can be used as a raw material component in products that adsorb heavy metals lead and cadmium, produce short-chain fatty acids, inhibit Candida albicans, and produce SOD enzymes. Bifidobacterium animalis subsp. lactis YYS-J9 can exist in the products in the form of liquid or solid preparations.
[0118] Example 13: Preparation of fermented food from Bifidobacterium animalis subsp. lactis YYS-J9
[0119] To prepare a fermentation broth of Bifidobacterium animalis subsp. lactis YYS-J9, various fruits, Chinese herbal medicines, grains, and various sugars are used as auxiliary materials. Bifidobacterium animalis subsp. lactis YYS-J9 is inoculated and fermented for a certain period of time under certain temperature conditions (30-38℃) to prepare a fermented product. The fermented product is either inactivated or not inactivated. After dilution of the original liquid or in different proportions, common beverage auxiliary materials are added to prepare a fermented food.
[0120] Based on the results of the above embodiments, the Bifidobacterium lactis subspecies YYS-J9 provided by the present invention has the following properties and effects:
[0121] YYS-J9 can utilize oligosaccharides such as trehalose, stachyose, inulin, galactooligosaccharides, isomaltooligosaccharides, and fructooligosaccharides as carbon sources for growth and reproduction. YYS-J9 can produce acetic acid, propionic acid, isobutyric acid, n-butyric acid, and isovaleric acid using various sugars. Stachyose and galactooligosaccharides can promote the production of short-chain fatty acids by YYS-J9, while trehalose and galactooligosaccharides have a significant promoting effect on butyric acid production. It can adsorb heavy metal lead, with an adsorption rate of up to 95.46%. It can adsorb heavy metal cadmium, with an adsorption rate of up to 84.62%. It has good hydrophobic properties, with a hydrophobicity of 78.424%. It has good biofilm formation ability; the addition of galactooligosaccharides and inulin can further promote biofilm formation, with a biofilm ratio of 3.211 compared to the control. It has significant antibacterial effects against Candida albicans. It exhibits good self-agglutination and other agglutination rates, with a 24-hour self-agglutination rate reaching 76.57% and an agglutination rate with *Candida albicans* reaching 75.65%. It can produce SOD enzyme with an activity of 52.77 U / mL. It can survive for 1-5 hours in gastric juice environments at pH 2.0, 2.5, and 3.0, with a survival rate of 83.67-95.81%. After treatment in pancreatic juice environment at pH 7.5 for 3 and 6 hours, the survival rates are 86.02% and 81.05%, respectively; and after treatment in pancreatic juice environment at pH 8.0 for 3 and 6 hours, the survival rates are 81.3% and 75.46%, respectively. Bacterium YYS-J9 is isolated from common foods, has high safety, and can be used as a heavy metal detoxification product, an intestinal regulator and laxative, and an antifungal product. In summary, compared with existing technologies, the *Bifidobacterium animalis* subsp. *lactamase* YYS-J9 provided by this invention has the following beneficial effects:
[0122] The *Bifidobacterium lactis* subspecies YYS-J9 can provide a new probiotic source for the development of functional products such as heavy metal detoxification products, laxative or intestinal conditioning products, fungal inhibitors, and SOD products, and has significant application value. This bacterium provides a new probiotic source for the development of functional products, for example:
[0123] (1) Bifidobacterium animalis subsp. lactis YYS-J9 can be used as a raw material component of the composition to prepare a composition with the above-mentioned functions; wherein, the composition includes, but is not limited to, microbial preparations, food, etc.
[0124] The bacterial strain exists in the composition in one or more forms, including but not limited to, non-inactivated Bifidobacterium animalis subsp. lactis YYS-J9, inactivated Bifidobacterium animalis subsp. lactis YYS-J9, metabolites of Bifidobacterium animalis subsp. lactis YYS-J9, and freeze-dried Bifidobacterium animalis subsp. lactis YYS-J9.
[0125] Preferably, in the composition, the number of *Bifidobacterium animalis* subsp. *Lactobacillus* YYS-J9 is ≥1×10⁻⁶. 6 CFU / mL or ≥1×10 6 CFU / g.
[0126] More preferably, the number of *Bifidobacterium animalis* subsp. *Lactobacillus* YYS-J9 is ≥1×10⁻⁶. 8 CFU / mL or ≥1×10 8 CFU / g.
[0127] (2) Various plants (such as fruits, Chinese herbal medicines, grains, etc.) can be used as raw materials, combined with various ingredients, and inoculated with Bifidobacterium animalis subsp. YYS-J9 for fermentation treatment to prepare fermented products. These fermented products can be used to prepare products with hangover relief, antioxidant or weight loss functions.
[0128] The fermentation raw materials can be various conventionally used plant fermentation raw materials, and the auxiliary materials can also be existing conventional auxiliary materials, including but not limited to the above-mentioned options. The fermented product is, but not limited to, used for the preparation of fermented foods.
[0129] In summary, based on its characteristics, *Bifidobacterium animalis* subsp. *Lactobacillus* YYS-J9 and / or its ferments can be used in functional products that include at least one of the following functions:
[0130] (1) Produces short-chain fatty acids;
[0131] (2) It can be grown using a variety of oligosaccharides on its own;
[0132] (3) Adsorption of heavy metals Pb and Cd;
[0133] (4) It has a significant antibacterial effect against Candida albicans;
[0134] (5) Good hydrophobic properties;
[0135] (6) Good biofilm formation ability;
[0136] (7) Produces SOD enzyme;
[0137] (8) Good tolerance to the gastrointestinal environment.
[0138] Among them, products with the above functions (1)-(8) include, but are not limited to, heavy metal detoxification products, intestinal function regulation products, antibacterial products, and may also be products with other directional effects based on the functions (1)-(6).
[0139] It should be noted that:
[0140] (1) Definition:
[0141] The term "food" as used herein is used in a broad sense, encompassing human food and drink. In some embodiments, the food product is suitable for and designed for human consumption. This application can be used to prepare solid dosage forms such as powders and tablets, as well as to disperse in liquids to prepare liquid dosage forms and other dosage forms suitable for oral administration to humans, including but not limited to powders.
[0142] The composition includes, but is not limited to, microbial preparations and food products. The composition containing Bifidobacterium animalis subsp. lactis YYS-J9 can be used in other forms of products.
[0143] The presence of Bifidobacterium animalis subsp. lactis YYS-J9 in the composition includes, but is not limited to, non-inactivated bacteria, inactivated bacteria, metabolites, freeze-dried strains, etc. It is anticipated that Bifidobacterium animalis subsp. lactis YYS-J9 may also exist in the composition in other forms.
[0144] (2) The relevant prior art means or prior art terms involved in this application:
[0145] "OD" is an abbreviation for optical density, also known as absorbance. The energy difference before and after light passes through an analyte is the energy absorbed by the analyte. At a specific wavelength, there is a quantitative relationship between the concentration of the same analyte and the absorbed energy, which can be used to determine the concentration of the analyte. x "OD" is the optical density value measured when the wavelength is set to X nm. It is a standard indicator for tracking the density of microorganisms in liquid cultures and is usually used to indicate the density of bacterial cells. The method for measuring the "OD" value is existing technology, and its principle and method will not be described here.
[0146] The determination of total bacterial count P1 and dead bacterial count P2 using flow cytometry is an existing technology, and its principles and methods will not be elaborated here.
[0147] The method of using an alcohol meter to test the alcohol content and temperature of the distillate, and then calculating the actual alcohol content of each treatment using an alcohol meter temperature-concentration conversion table, is an existing technology, and its principle and method will not be elaborated here.
[0148] The biochemical experiments of lactic acid bacteria were conducted according to the standard method of GB4789.35. This is the existing technology, and its principle and method will not be described here.
[0149] (3) The formulations of the culture media used in the examples are as follows:
[0150] MRSL medium (g / L): casein peptone 10, beef extract 10, yeast extract 5, glucose 5, L-cysteine 0.5, sodium acetate 5, K2HPO4 2, diammonium citrate 2, MgSO4·7H2O 0.2, MnSO4·H2O 0.05, Tween 80 1; pH 6.2. For solid medium, add 2% agar and sterilize at 121℃ for 15 min.
[0151] Unless otherwise specified, the experimental procedures involved in the embodiments of the present invention are conventional experimental procedures in the art, and the reagents or instruments involved can be obtained from legitimate channels.
[0152] Furthermore, those skilled in the art should understand that although many problems exist in the prior art, each embodiment or technical solution of the present invention can be improved in only one or a few aspects, without necessarily solving all the technical problems listed in the prior art or the background art simultaneously. Those skilled in the art should understand that any content not mentioned in a claim should not be construed as a limitation on that claim.
[0153] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A subspecies of Bifidobacterium animalis with heavy metal adsorption and short-chain fatty acid production capabilities (Bifidobacterium lactis) Bifidobacterium animalis subsp. lactis YYS-J9, characterized in that: Its accession number is CGMCCNo.28185.
2. A composition, characterized in that: It contains Bifidobacterium animalis subsp. YYS-J9 as described in claim 1.
3. The composition according to claim 2, characterized in that: The composition includes microbial preparations or food.
4. The composition according to claim 2, characterized in that: The composition contains either uninactivated Bifidobacterium lactis subsp. YYS-J9 or freeze-dried Bifidobacterium lactis subsp. YYS-J9.
5. The use of Bifidobacterium animalis subsp. lactis YYS-J9 as described in claim 1 or the composition as described in any one of claims 2-4 in the preparation of fermented foods.