Alfalfa myb transcription factor msmyb306 gene and application thereof

By cloning and regulating the MsMYB306 gene, the growth restriction problem of alfalfa under low temperature stress was solved, and cold resistance was regulated, thereby improving or reducing its adaptability to low temperatures.

CN117701585BActive Publication Date: 2025-12-12NANJING AGRICULTURAL UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311539454.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-18
Publication Date
2025-12-12
Estimated Expiration
2043-11-18

AI Technical Summary

Technical Problem

Alfalfa growth is restricted under low temperature stress, and current technologies lack effective methods to regulate cold-resistant genes, affecting yield and quality.

Method used

The MsMYB306 gene of alfalfa MYB transcription factor was cloned and its expression in plants was regulated by constructing overexpression and interference vectors to improve or reduce cold resistance.

Benefits of technology

Overexpression of MsMYB306 reduces cold resistance, while interference with MsMYB306 improves cold resistance. This significantly affects the response of alfalfa to low temperatures, thus increasing or decreasing its cold resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117701585B_ABST
    Figure CN117701585B_ABST
Patent Text Reader

Abstract

The application discloses an alfalfa MYB transcription factor MsMYB306 gene and application thereof, the nucleotide sequence of the MYB transcription factor MsMYB306 gene is as follows (1) or (2): (1) the nucleotide sequence shown in SEQ ID NO. 1; (2) a nucleotide sequence with more than 90% homology with the nucleotide sequence and equivalent functions of (1). The application provides a method for cultivating cold-resistant plants by using the MsMYB306 gene, the cold resistance of transgenic alfalfa is improved after the gene is interfered with expression in alfalfa; meanwhile, the cold resistance of transgenic alfalfa is reduced after the gene is overexpressed in alfalfa.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering, and particularly relates to a Medicago sativa MYB transcription factor MsMYB306 gene and application thereof. BACKGROUND

[0002] In the process of agricultural production, how to improve yield is particularly important. Abiotic stress seriously affects the yield of agricultural production. Among them, the alfalfa planting area is mainly distributed in the area with high latitude in China, which often encounters low temperature stress, seriously limiting the yield of alfalfa. Therefore, it is necessary to excavate the genes regulating the cold tolerance of Medicago sativa.

[0003] Transcription factor refers to a DNA binding protein capable of specific interaction with cis-acting elements in the promoter region of eukaryotic genes or a related protein capable of interacting with these proteins, that is, a key factor capable of specifically activating or inhibiting transcription. Most plant MYB genes encode R2R3 type MYB proteins. R2R3-MYB transcription factors have an N-terminal DNA binding domain (MYB domain) and an activation or inhibition domain located at the C-terminal. In contrast to the highly conserved MYB domain, other regions of R2R3-MYB proteins are highly variable (Jiang et al., 2004). A large number of studies have shown that R2R3-MYB transcription factors are involved in various processes, including primary and secondary metabolism, plant development, and response to biotic and abiotic stress (Dubos et al., 2010).

[0004] Low temperature stress hinders the growth and development of plants by severely affecting plant metabolism and gene transcription. Cold stress rapidly induces the expression of CBFs genes in plants to activate many downstream COR genes (Liu et al., 2018). MYB transcription factors are considered to play a key role in regulating cold tolerance due to their regulation of CBFs genes. In Arabidopsis, MYB15 is a negative regulator of CBFs genes. myb15 mutant plants exhibit enhanced tolerance to low temperature, while transgenic plants overexpressing MYB15 exhibit a cold-sensitive phenotype. MYB15 inhibits the expression of CBFs genes by directly binding to MYB binding sites in the CBFs promoter (Agarwal et al., 2006). MYB96 is upregulated by low temperature and increases the frost resistance of Arabidopsis by positively regulating CBFs expression (Guo et al., 2013). In rice, OsMYBS3 inhibits the early response of rice to low temperature stress by suppressing the expression of CBFs genes, while on the other hand, OsMYBS3 can activate long-term low temperature signals to regulate the expression of genes encoding trehalose-6-phosphate phosphatase TPPs in the trehalose metabolic pathway to resist long-term low temperature stress (Su et al., 2010). In apple, the interaction of MdMYB2 and MdSIZ1 promoters significantly improves the tolerance of plants to cold stress (Jiang et al., 2022). Transgenic apple calli overexpressing MdMYB4d have reduced conductivity and increased survival rate under freeze stress, positively regulating the cold tolerance of apple calli (Wu et al., 2017). MdMYB23 directly binds to the promoters of MdCBF1 and MdCBF2 and activates their expression to improve cold tolerance (An et al., 2018). MdMYB88 and MdMYB124 bind to the promoters of MdCSP3 (COLD SHOCK DOMAIN PROTEIN 3) and MdCCA1 (CIRCADIAN CLOCK ASSOCIATED 1), respectively, and together activate the expression of MdCBF3, while also promoting anthocyanin accumulation to scavenge ROS accumulation, thereby positively regulating the cold tolerance of apple (Xie et al., 2018). In pepper, CaMYB306 inhibits the transcription of the cold tolerance positive regulator CaCIPK13, which negatively regulates cold tolerance (Ma et al., 2022).However, there are few reports on the function of MYB transcription factors in regulating cold tolerance in alfalfa. The transcription enhancer MtMYB61 and transcription inhibitor MtMYB3 that regulate MtCBF4 were found in Medicago truncatula. MtMYB61 interacts with MtMYB3, which weakens the ability of MtMYB3 to bind to the promoter of MtCBF4, thereby inhibiting the expression of MtCAS15, a target gene downstream of MtCBF4, and negatively regulating the cold tolerance of Medicago truncatula (Zhang et al., 2016). In summary, it is necessary to further study whether members of the R2R3-MYB transcription factor family in Medicago sativa also have the function of regulating cold tolerance.

[0005] Medicago sativa is an important legume forage with high biomass, good nutritional quality, and wide cultivation range. However, low temperature severely limits the growth and development of Medicago sativa and reduces yield and quality. Cloning of cold tolerance regulatory genes from Medicago sativa can provide more excellent target genes for transgenic breeding of Medicago sativa, and is particularly important for cold tolerance molecular breeding of other legume crops. SUMMARY

[0006] To overcome the shortcomings and deficiencies of the prior art, the primary object of the present application is to provide a Medicago sativa MYB transcription factor MsMYB306 gene that interferes with its expression to improve the cold tolerance of plants.

[0007] Another object of the present application is to provide a protein encoded by the Medicago sativa MYB transcription factor MsMYB306 gene described above.

[0008] Still another object of the present application is to provide an application of the Medicago sativa MYB transcription factor MsMYB306 gene described above.

[0009] The objects of the present application are achieved by the following technical solutions:

[0010] In a first aspect, the present application claims a Medicago sativa MYB transcription factor MYB306 gene, the nucleotide sequence of which is as follows (1) or (2):

[0011] (1) the nucleotide sequence as shown in SEQ ID NO. 1;

[0012] (2) a nucleotide sequence having more than 90% homology with the nucleotide sequence described in (1) and having equivalent functions.

[0013] In a second aspect, the present application claims a protein encoded by the Medicago sativa MYB transcription factor MYB306 gene described above, the amino acid sequence of which is as follows (a) or (b):

[0014] (a) the amino acid sequence as shown in SEQ ID NO. 2;

[0015] (b) a sequence having equivalent function to that shown in SEQ ID NO. 2, which is formed by substitution, deletion or addition of one or several amino acids.

[0016] In a third aspect, the present application claims a biological material related to the above-mentioned alfalfa MYB transcription factor MYB306 gene, which is a biological material containing the MYB transcription factor MYB306 gene, or a biological material for silencing, interfering or inhibiting the MYB transcription factor MYB306 gene.

[0017] The biological material containing the MYB transcription factor MYB306 gene is at least one of the following (a) to (g):

[0018] (a) an expression cassette containing the MYB transcription factor MYB306 gene;

[0019] (b) a recombinant vector containing the MYB transcription factor MYB306 gene;

[0020] (c) a recombinant vector containing the expression cassette of (a);

[0021] (d) a recombinant microorganism containing the MYB transcription factor MYB306 gene;

[0022] (e) a recombinant microorganism containing the expression cassette of (a);

[0023] (f) a recombinant microorganism containing the recombinant vector of (b);

[0024] (g) a recombinant microorganism containing the recombinant vector of (c);

[0025] The biological material for silencing, interfering or inhibiting the MYB transcription factor MYB306 gene is at least one of the following (I) to (IV):

[0026] (I) an interference sequence of the MYB transcription factor MYB306 gene;

[0027] (II) a primer set for amplifying the MYB transcription factor MYB306 gene interference sequence of (I);

[0028] (III) an interference vector of the MYB transcription factor MYB306 gene;

[0029] (IV) a recombinant microorganism containing the interference vector of (III).

[0030] Further, the primer set for amplifying the MYB transcription factor MYB306 gene interference sequence (I) comprises an MsMYB306 interference fragment sense chain amplification upstream primer and an MsMYB306 interference fragment antisense chain enzyme digestion site upstream primer;

[0031] MsMYB306 interference fragment sense chain amplification upstream primer Y5288:

[0032] 5'-ACCATGGGGCGCGCCTGGCCAAACAAGCCTTATCTGA-3';

[0033] MsMYB306 interference fragment sense chain amplification downstream primer Y5289:

[0034] 5'-TCATCGATTGGGCGCGCCTGCTTTGTGCTCCTTCACTACA-3';

[0035] MsMYB306 interference fragment antisense chain enzyme digestion site upstream primer Y5290:

[0036] 5'-CTTAATTAACTCTCTAGATGGCCAAACAAGCCTTATCTGA-3';

[0037] MsMYB306 interference fragment antisense chain enzyme digestion site downstream primer Y5291:

[0038] 5'-TTGCAGGTATTTGGATCCTGCTTTGTGCTCCTTCACTACA-3'.

[0039] In a fourth aspect, the present application claims the use of the above-mentioned alfalfa MYB transcription factor MYB306 gene, the above-mentioned protein, or the above-mentioned biological material in (1) or (2) as follows:

[0040] (1) improving plant cold tolerance or cultivating transgenic plants with improved cold tolerance;

[0041] (2) reducing plant cold tolerance or cultivating cold-sensitive transgenic plants.

[0042] Further, the above-mentioned use silences or interferes with the above-mentioned alfalfa MYB transcription factor MYB306 gene in the target plant to improve the cold tolerance of the plant. Alternatively, overexpressing the above-mentioned alfalfa MYB transcription factor MYB306 gene in the target plant reduces the cold tolerance of the plant.

[0043] In a fifth aspect, the present application claims a method for improving cold tolerance of a plant by silencing or interfering with the above-mentioned alfalfa MYB transcription factor MYB306 gene in a target plant to improve the cold tolerance of the plant.

[0044] Further, the above-mentioned method for silencing or interfering with the above-mentioned alfalfa MYB transcription factor MYB306 gene in a target plant is a process of constructing an interference vector of the above-mentioned alfalfa MYB transcription factor MYB306 gene, and transforming the interference vector into a plant by means of Agrobacterium-mediated method to obtain a transgenic plant with improved cold tolerance.

[0045] The plant according to the present application is alfalfa.

[0046] During the research, the technical personnel constructed overexpression vector 35S::MsMYB306 and interference vector MsMYB306-RNAi by using pCAMBIA3301 and pFGC5941 respectively, and screened for grass herbicide phosphinothricin. Mature leaves of 8-12 weeks of cuttings of alfalfa were selected for genetic transformation, and the processes of infection, co-culture, induction of callus, regeneration of callus, and rooting of regenerated seedlings were performed in sequence to obtain transgenic alfalfa.

[0047] The recombinant vector containing the alfalfa MYB transcription factor MsMYB306 gene is a recombinant expression vector, which is obtained by linking the nucleotide sequence of the above-mentioned alfalfa MYB transcription factor MsMYB306 gene with a plant expression vector; and the plant overexpression vector is preferably pCAMBIA3301.

[0048] The interference vector for interfering with the expression of the alfalfa MYB transcription factor MsMYB306 gene is prepared by using a vector, and the vector is preferably pFGC5941.

[0049] The preparation method of the recombinant expression vector containing the alfalfa MYB transcription factor MsMYB306 gene (MsMYB306) comprises the following steps:

[0050] (1) Primer design

[0051] Primer ① is the upstream primer Y4752 for amplifying the MsMYB306 gene fragment:

[0052] 5'-ATGATGGGAAGGCCACCATGTT-3';

[0053] Primer ② is the downstream primer Y4753 for amplifying the MsMYB306 gene fragment:

[0054] 5'-CTAAAAGAAATCTGAAGTAGTT-3';

[0055] Primer 3 is the upstream primer Y4926 for amplifying MsMYB306 to construct overexpression vector:

[0056] 5'-CACGGGGGACTCTTGACCATGGCAATGATGGGAAGGCCACCATGTT-3';

[0057] Primer 4 is the downstream primer Y4927 for amplifying MsMYB306 to construct overexpression vector:

[0058] 5'-CGGGGAAATTCGAGCTGGTCACCCTAAAAGAAATCTGAAGTAGTT-3';

[0059] Primer 5 is the upstream primer Y5288 for amplifying the sense strand of MsMYB306 interference fragment:

[0060] 5'-ACCATGGGGCGCGCCTGGCCAAACAAGCCTTATCTGA-3';

[0061] Primer 6 is the downstream primer Y5289 for amplifying the sense strand of MsMYB306 interference fragment:

[0062] 5'-TCATCGATTGGGCGCGCCTGCTTTGTGCTCCTTCACTACA-3';

[0063] Primer 7 is the upstream primer Y5290 for amplifying the restriction site of the antisense strand of MsMYB306 interference fragment:

[0064] 5'-CTTAATTAACTCTCTAGATGGCCAAACAAGCCTTATCTGA-3';

[0065] Primer 8 is the downstream primer Y5291 for amplifying the restriction site of the antisense strand of MsMYB306 interference fragment:

[0066] 5'-TTGCAGGTATTTGGATCCTGCTTTGTGCTCCTTCACTACA-3';

[0067] (2) Obtaining of MsMYB306 gene fragment:

[0068] Using the cDNA of Medicago sativa as template, the full-length fragment of MsMYB306 gene is amplified by using primer 1 and primer 2;

[0069] (3) Construction of recombinant expression vectors pCAMBIA3301-MsMYB306 and pFGC5941-MsMYB306 containing MsMYB306 gene:

[0070] MsMYB306 gene fragment as a template, using primer ③ and primer ④ make MsMYB306 gene fragment introduce NcoI and BstE II two enzyme cutting sites, and connect with plant expression vector pCAMBIA3301, and then construct obtain containing MsMYB306 gene recombination expression vector pCAMBIA3301-MsMYB306;

[0071] MsMYB306 gene fragment as a template, using primer ⑤ and primer ⑥ make MsMYB306 gene interference positive sense fragment introduce containing Asc I enzyme cutting site homologous arm, using primer ⑦ and primer ⑧ make MsMYB306 gene interference antisense fragment introduce containing Xba I and BamH I enzyme cutting site homologous arm, first connect positive sense fragment with plant expression vector pFGC5941, then connect antisense fragment with the vector that has connected positive sense fragment, and then obtain containing MsMYB306 interference fragment recombination expression vector pFGC5941-MsMYB306;

[0072] Containing MsMYB306 gene recombination expression vector pCAMBIA3301-MsMYB306 transgenic plant and pFGC5941-MsMYB306 interference vector transgenic plant are obtained by transforming the above-mentioned recombination expression vector or interference vector into alfalfa leaf tissue, and culturing the transformed plant tissue.

[0073] In the embodiment of the application, the plant is preferably alfalfa.

[0074] The preparation method of the transgenic plant expressing alfalfa MsMYB306 comprises the following steps:

[0075] (1) the recombinant expression vector pCAMBIA3301-MsMYB306 and interference vector pFGC5941-MsMYB306 are introduced into Agrobacterium tumefaciens EHA105 by using the method of electric shock transformation, and the Agrobacterium positive colonies containing the recombinant expression vector pCAMBIA3301-MsMYB306 and the interference vector pFGC5941-MsMYB306 are obtained, respectively;

[0076] (2) the activated Agrobacterium EHA105 containing the recombinant expression vector pCAMBIA3301-MsMYB306 and the interference vector pFGC5941-MsMYB306 is used to dip the leaves of alfalfa, and the transgenic alfalfa is obtained through co-culture and screening of glufosinate ammonium resistance.

[0077] The application clones the cDNA sequence of the MYB transcription factor MsMYB306 from alfalfa, and links the obtained sense fragment and antisense fragment of the MsMYB306 gene with a plant expression vector to construct an overexpression vector and an interference vector, transforms alfalfa leaves with the constructed overexpression vector and interference vector, and then cultivates into transgenic alfalfa.The MsMYB306 gene is down-regulated under the induction of low temperature; the application provides a method for regulating the cold resistance of plants by using the MsMYB306 gene, and the overexpression of the gene in alfalfa reduces the cold resistance of the transgenic alfalfa; meanwhile, the interference of the gene in alfalfa improves the cold resistance of the transgenic alfalfa.

[0078] The application has the following advantages and effects relative to the prior art:

[0079] (1) The application clones the cDNA sequence of MsMYB306 from alfalfa, and the expression of the gene is down-regulated under the induction of low temperature.

[0080] (2) The application links the obtained full-length cDNA of MsMYB306 with a plant overexpression vector to construct an overexpression vector suitable for alfalfa, links the obtained sense fragment and antisense fragment of the MsMYB306 gene with a plant interference vector to construct an interference expression vector suitable for alfalfa, and transforms alfalfa, and the transgenic alfalfa overexpressing MsMYB306 obviously reduces the cold resistance, and the transgenic alfalfa interfering with the expression of MsMYB306 obviously improves the cold resistance.

[0081] (3) The application provides a method for cultivating cold-resistant alfalfa by down-regulating the expression of MsMYB306 by using the RNAi interference technology.

[0082] (4) The application provides a method for cultivating stress-tolerant plants by using the MsMYB306 gene. BRIEF DESCRIPTION OF DRAWINGS

[0083] Figure 1 is an expression frame schematic diagram of the overexpression vector pCAMBIA3301-MsMYB306.

[0084] Figure 2 is an insertion site schematic diagram of the sense fragment and antisense fragment of the interference expression vector pFGC5941-MsMYB306.

[0085] Figure 3 is an agarose gel electrophoresis diagram of PCR amplification of the open reading frame sequence of the MsMYB306 gene;

[0086] wherein M is a standard DNA molecule; lane 1 is the amplification fragment of the MsMYB306 gene.

[0087] Figure 4 is the PCR identification agarose gel electrophoresis diagram of overexpression vector pCAMBIA3301-MsMYB306;

[0088] M is a standard DNA molecule; lanes 1, 2, 3, 4, 5, 6, 7 and 8 are positive recombinants.

[0089] Figure 5 is the PCR amplification agarose gel electrophoresis diagram of MsMYB306 gene RNAi interference fragment;

[0090] M is a standard DNA molecule; lane 1 is the amplification of the sense fragment of MsMYB306 gene, and lane 2 is the amplification of the antisense fragment of MsMYB306 gene.

[0091] Figure 6 is the PCR identification agarose gel electrophoresis diagram of sense fragment and antisense fragment insertion of interference expression vector pFGC5941-MsMYB306;

[0092] M is a standard DNA molecule; lanes 1, 2, 3, 4, 5, 7 and 8 are positive sense fragment recombinants, lanes 9, 10, 11, 12, 13, 14, 15 and 16 are positive antisense fragment recombinants; lane 6 is a negative sense fragment recombinant.

[0093] Figure 7 is the result analysis column chart of MsMYB306 gene expression induced by low temperature 4℃;

[0094] The letters a, b, c and d above the column represent significant differences (P<0.05) between different treatments, that is, the same letter above the data column means no significant difference, and different letters above the data column mean significant difference.

[0095] Figure 8 is the PCR identification agarose gel electrophoresis diagram of transgenic alfalfa introduced with overexpression vector pCAMBIA3301-MsMYB306 and interference expression vector pFGC5941-MsMYB306;

[0096] WT represents wild type; numbers 1-5 represent different overexpression transgenic alfalfa lines, and numbers 6-9 represent different RNAi interference transgenic alfalfa lines.

[0097] Figure 9 is the result analysis chart of real-time quantitative PCR of 5 transgenic alfalfa introduced with overexpression vector pCAMBIA3301-MsMYB306;

[0098] Wherein, WT represents wild type; numbers 1-5 represent different transgenic alfalfa lines; letters a, b, c, d and e above the column represent significant differences (P<0.05) between different materials.

[0099] Figure 10 is a real-time quantitative PCR result analysis diagram of 4 transgenic alfalfa lines introduced with recombinant expression vector MsMYB306-RNAi;

[0100] Wherein, WT represents wild type; numbers 6-9 represent different transgenic alfalfa lines; letters a, b and c above the column represent significant differences (P<0.05) between different materials.

[0101] Figure 11 is a freeze resistance detection result analysis diagram of transgenic alfalfa introduced with recombinant expression vector MsMYB306-RNAi;

[0102] Wherein, (A) is the photo of each line after freeze treatment under non-acclimation and acclimation conditions; (B) is the low temperature semi-lethal temperature of each line under non-acclimation and acclimation conditions; (C) is the survival rate of each line under non-acclimation and acclimation conditions; letters a, b, c, d and e above the column represent significant differences (P<0.05) between different materials. DETAILED DESCRIPTION

[0103] The application will be further described in detail below in combination with examples and drawings, but the embodiments of the application are not limited thereto.

[0104] Medicago sativa L. variety Regen-SY4D (Yu et al., 2022) was provided by the Grassland Biotechnology and Breeding Laboratory of Nanjing Agricultural University.

[0105] Agrobacterium tumefaciens EHA105: purchased from Beijing Tian'en Genesee Technology Co., Ltd.

[0106] pCAMBIA3301 overexpression vector and pFGC5941 RNAi vector: provided by the Grassland Biotechnology and Breeding Laboratory of Nanjing Agricultural University (Yu et al., 2022), both of which are common vectors disclosed in the prior art.

[0107] Escherichia coli DH5α: purchased from Beijing Qianke Biological Technology Co., Ltd. The above biological materials are all conventional biological materials known to those skilled in the art.

[0108] Example 1 Cloning of MsMYB306 gene

[0109] I. Preparation of cDNA template of Medicago sativa

[0110] Medicago sativa was taken from the Baima experimental base of Nanjing Agricultural University, transplanted to mixed culture medium (peat soil: vermiculite: perlite = 2:2:1 (volume ratio)) and cultivated in a culture box at a temperature of 22℃ / 20℃ (day / night), a light cycle of 16h / 8h (light / dark), a humidity of 75%, and a light intensity of 200μmol m -2 s -1 Appropriate amount of compound fertilizer (N:P:K = 15:15:15) solution was regularly applied thereto, and after the material grew uniformly, mature leaves of Medicago sativa were taken for experimental treatment. Plant tissue RNA was extracted by using a Cell / Tissue Total RNA Isolation Kit (Vazyme) kit, and long fragment cDNA was synthesized by using PrimeScript RT reagent Kit (Takara) according to the instructions provided by Takara, for subsequent gene cloning.

[0111] II. Design of primers for amplifying MsMYB306 gene

[0112] According to the cDNA sequence of the MsMYB306 gene of the “Xinjiang Daye” Medicago sativa variety whose genome has been published, primers for amplifying the open reading frame of the Medicago sativa MsMYB306 cDNA were designed (synthesized by Beijing Chengke Biological Technology Co., Ltd.). The upstream primer Y4752 for amplifying MsMYB306 has the sequence of 5’-ATGATGGGAAGGCCACCATGTT-3’; and the downstream primer Y4753 for amplifying MsMYB306 has the sequence of 5’-CTAAAAGAAATCTGAAGTAGTT-3’.

[0113] III. Amplification of MsMYB306 full-length ORF

[0114] PCR amplification was performed by using the template prepared in step I above and the primers designed in step II:

[0115] PCR reaction system (50μL): KOD-FX-DNA polymerase (TOYOBO Company, 1U·μL -1 ) 1μL, 2×buffer 25μL, dNTPs (10mmol·L -1 ) 10μL, upstream primer (10μmol·L -1 ) 1.5μL, downstream primer (10μmol·L -1 ) 1.5μL, reverse transcription first-strand cDNA 1μL, and ddH2O supplemented to 50μL;

[0116] PCR reaction procedure: 94℃ 2 min; 98℃ 10 s, 55℃ 30 s, 68℃ 1 min, 34 cycles; 68℃ 10 min; the amplification product was detected by 1% agarose gel electrophoresis;

[0117] A sequence of about 1000 bp was obtained Figure 3 The obtained PCR product was recovered by DNA gel recovery kit (AXYGEN company).

[0118] Example 2 Construction of overexpression vector pCAMBIA3301-MsMYB306 and interference vector pFGC5941-MsMYB306

[0119] I. Construction of overexpression vector pCAMBIA3301-MsMYB306

[0120] According to the MsMYB306 open reading frame sequence obtained in Example 1, an amplification primer with Nco I and BstE II enzyme cutting sites was designed:

[0121] The amplification upstream primer Y4926 for MsMYB306 to construct overexpression vector was as follows:

[0122] 5'-CACGGGGGACTCTTGACCATGGCAATGATGGGAAGGCCACCATGTT-3';

[0123] The amplification downstream primer Y4927 for MsMYB306 to construct overexpression vector was as follows:

[0124] 5'-CGGGGAAATTCGAGCTGGTCACCCTAAAAGAAATCTGAAGTAGTT-3';

[0125] The MsMYB306 full-length DNA fragment with homologous arms was amplified by PCR, the pCAMBIA3301 expression vector was double digested by restriction endonuclease Nco I (NEB) and BstE II (NEB), respectively, and the gene fragment and the vector fragment were connected in a molar ratio of 1:2. The reaction system was as follows: 5×CE II Buffer 4 μL, Exnase II 2 μL, recovered target fragment 0.06 pmol, supplemented with water to 20 μL, 37℃ connection for 30 min, placed on ice to cool, and the connection product was obtained.

[0126] Heat shock transformation of E. coli with ligation product: The ligation product was added to 100 μL of DH5α competent cells (purchased from Beijing Enzkle Biotech Co., Ltd.) and placed in ice for 5 min; after heat shock at 42°C for 45 s, it was placed in ice for 2 min again; the heat-shocked bacteria were added to 0.5 mL of LB liquid, and cultured at 37°C on a constant-temperature shaker at 200 rpm for 0.5 h. After brief centrifugation, 500 μL of supernatant was removed, and 100 μL of resuspended bacterial liquid was spread on LB solid (containing 50 μg / mL Kana) medium and incubated at 37°C in an incubator overnight;

[0127] Screening, purification and sequencing of recombinant plasmid pCAMBIA3301-MsMYB306: a single colony was picked and subjected to PCR detection using upstream primer Y4926 and downstream primer Y4927; gel electrophoresis showed a single band at about 1000 bp, indicating that the recombinant vector contained the MsMYB306 gene Figure 4 ). The positive single colony was sent to Beijing Enzkle Biotech Co., Ltd. for sequencing, and the results showed that the sequence of the inserted fragment was completely consistent with that of the MsMYB306 coding region, and the enzyme cutting sites at both ends of the inserted fragment were also completely correct, thereby proving that the recombinant expression vector pCAMBIA3301-MsMYB306 was successfully constructed, and the expression frame of the recombinant expression vector is shown in Figure 1 .

[0128] II. Construction of interference vector pFGC5941-MsMYB306

[0129] According to the MsMYB306 open reading frame sequence obtained in Example 1, a band of about 276 bp was selected, and an amplification primer with an Asc I (NEB) enzyme cutting site was designed to perform PCR amplification to obtain a sense fragment containing a homologous arm Figure 5 ), and the vector pFGC5941 was single-enzyme cut using Asc I (Takara Co., Ltd.). After recovery of the PCR product and the enzyme cutting product, the target fragment and the vector fragment were connected by homologous recombination.

[0130] MsMYB306 interference fragment sense chain amplification upstream primer Y5288:

[0131] 5'-ACCATGGGGCGCGCCTGGCCAAACAAGCCTTATCTGA-3';

[0132] MsMYB306 interference fragment sense chain amplification downstream primer Y5289:

[0133] 5'-TCATCGATTGGGCGCGCCTGCTTTGTGCTCCTTCACTACA-3';

[0134] The recovery method, the homologous recombination method, and the plasmid transformation Escherichia coli method are the same as the above method.

[0135] The colony PCR detection is performed by using the MsMYB306 interference fragment positive strand to amplify the upstream primer Y5288 and the downstream primer Y5289 to obtain a fragment with a correct size, and the band size is about 276 bp ( Figure 6 ). The results show that the recombinant vector contains a 276 bp positive fragment (as shown in SEQ ID NO. 3). Further sequencing of the inserted fragment shows that the sequence of the inserted fragment is completely consistent with the selected positive fragment sequence, and the enzyme cutting sites at both ends of the inserted fragment are also completely correct, thereby proving that the vector plasmid containing the positive strand fragment is successfully constructed.

[0136] According to the connection rules and methods of the interference vector, a double enzyme cutting site with Xba I (NEB) and BamH I (NEB) is further designed for amplification, and the gene fragment of MsMYB306 obtained in Example 1 is used as a template for PCR amplification to obtain an antisense fragment containing a homologous arm. The vector containing the positive fragment obtained in the above step is subjected to double enzyme cutting using Xba I and BamH I, and the PCR product and the enzyme cutting product are recovered and then connected to the target fragment and the vector fragment by using the homologous recombination method.

[0137] The upstream primer Y5290 of the MsMYB306 interference fragment antisense strand enzyme cutting site is as follows:

[0138] 5'-CTTAATTAACTCTCTAGATGGCCAAACAAGCCTTATCTGA-3';

[0139] The downstream primer Y5291 of the MsMYB306 interference fragment antisense strand enzyme cutting site is as follows:

[0140] 5'-TTGCAGGTATTTGGATCCTGCTTTGTGCTCCTTCACTACA-3';

[0141] The recovery method, the homologous recombination method, and the plasmid transformation Escherichia coli method are the same as the above method.

[0142] The colony PCR detection is performed by using the MsMYB306 interference fragment antisense strand to amplify the upstream primer Y5290 and the downstream primer Y5291 to obtain a fragment with a correct size, and the band size is about 276 bp ( Figure 6), the results showed that the recombinant vector contained a 276 bp antisense fragment (as shown in SEQ ID NO. 4). Further sequencing of the insert fragment showed that the sequence of the insert fragment was completely consistent with the selected antisense fragment sequence, and the enzyme cutting site at both ends of the insert fragment was also completely correct, thereby proving that the vector plasmid containing the sense fragment and antisense fragment was successfully constructed. Among them, Figure 2 is the schematic diagram of the insertion site of the sense fragment and the antisense fragment of the recombinant expression vector pFGC5941-MsMYB306.

[0143] Example 3 MsMYB306 is down-regulated under low temperature inhibition

[0144] I. Obtain low temperature treated alfalfa template

[0145] Alfalfa is taken from Nanjing Agricultural University Baima Test Base, transplanted to mixed culture medium (peat soil: vermiculite: perlite = 2:2:1 (volume ratio)) and cultivated in a culture box, temperature 22℃ / 20℃ (day / night), light period 16h / 8h (light / dark), humidity 75%, light intensity 200μmol m -2 s -1 ; Regularly apply an appropriate amount of compound fertilizer (N: P: K = 15: 15: 15) solution to it; After the material grows uniformly, it is used for low temperature 4℃ test treatment, and mature leaves are taken after 0h, 1h, 2h, 6h and 12h of normal temperature and 4℃ treatment respectively, wrapped with tin foil paper and quickly frozen in liquid nitrogen, and then used Plant tissue RNA was extracted by Cell / Tissue Total RNA Isolation Kit (Vazyme) kit, and cDNA was synthesized using HiScript III RT SuperMix for qPCR Kit (Vazyme) with RNA as template for subsequent qRT-PCR experiments.

[0146] II. Design specific detection primers

[0147] According to the cDNA sequence of MsMYB306 gene and the sequence of alfalfa Actin, the detection quantitative primer was designed by online software (https: / / sg.idtdna.com / pages / tools / primerquest?returnurl=%2FPrimerQuest%2F):

[0148] The upstream quantitative primer of MsMYB306 gene Y4928: 5'-GTTCGCAGCTTCCGAATAAAG-3';

[0149] Downstream quantitative primer Y4929 of MsMYB306 gene: 5'-ACCAAGGGTTGTAGGGTTATG-3';

[0150] Upstream quantitative primer Y358 of Actin gene: 5'-CCCACTGGATGTCTGTAGGTT-3';

[0151] Downstream quantitative primer Y359 of Actin gene: 5'-AGAATTAAGTAGCAGCGCAAA-3';

[0152] III. Quantitative PCR detection of expression difference

[0153] The template cDNA prepared in step one was diluted 30 times for the template of quantitative PCR, and the reaction system was 10 μL: 5 μL of 2xChamQ SYBR qPCR Master Mix (Vazyme), 0.2 μL of each of upstream and downstream primers (10 μM), 4 μL of cDNA template, and 0.6 μL of sterile water. The instrument used was Mini Option Real-Time PCR System produced by Bio-Rad Company, and the PCR reaction condition was set as: 95℃ for 30 s; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. Three repeats were set for each sample, and the housekeeping gene Actin was used as the internal reference gene. After the reaction, the melting curve analysis was performed, the PCR amplification efficiency was above 95%, and the relative expression amount of the gene was automatically calculated by Bio-Rad CFX Manager (Version 1.6) software.

[0154] The results of real-time quantitative PCR showed that the expression of MsMYB306 was inhibited and down-regulated at 2h of low temperature treatment, and maintained at a low level until 12h( Figure 7 ) of low temperature treatment.

[0155] Example 4. Generation and molecular detection of transgenic alfalfa

[0156] I. Generation of transgenic alfalfa

[0157] 1. Introduction of recombinant expression vector MsMYB306-RNAi into Agrobacterium tumefaciens EHA105

[0158] Preparation of EHA105 competent cells Lin et al. (Lin JJ. Electrotransformation of Agrobacterium. Methods Mol Biol. 1995, 47: 171-8.) with modification: pick single colony and inoculate in 5 mL YEP (containing 75 mg / L rifampicin or other antibiotics) liquid medium, 28°C, 200 rpm, shake culture overnight. Transfer 1:100 of the bacterial solution into 200 mL YEP (containing 75 mg / L rifampicin or other antibiotics) culture medium, 28°C, 200 rpm, shake culture until OD = 0.4 (about 4-5 h). Transfer into 250 mL sterile centrifuge bottle, 4°C, 4000 rpm, centrifuge for 10 min, discard the supernatant. Resuspend with 150 mL pre-cooled ultrapure water, 4°C, 4000 rpm, centrifuge for 10 min, discard the supernatant. Repeat steps 4 and 5 for 2-3 times (the volume of ultrapure water can be reduced gradually), finally resuspend with 2 mL ice-bath 10% (v / v) glycerol. Aliquot 100 μL per tube in 1.5 mL sterile EP tube (pre-cooled in -80°C freezer), store at -80°C. Thaw the competent cells on ice, pre-cool the 0.2 cm inner diameter electroporation cup on ice, in a clean bench, add 1.5 μL pCAMBIA3301-MsMYB306 or pFGC5941-MsMYB306 plasmid (20 ng / μL) to 100 μL thawed competent cells, mix gently, ice-bath for 1 min, then transfer into the electroporation cup, place between the electrodes of the electroporator (MicroPulser, Bio-RAD), select program Agr, and perform electroporation. After electroporation, quickly pour 1 mL YEP liquid medium into the electroporation cup in a clean bench, then transfer into a shaker tube, 28°C, gentle shake culture for 2 h; take 0.3 mL bacterial solution, spread on YEP plate (containing 35 mg / L rifampicin and 50 mg / L kanamycin), 28°C, inverted culture for 48 h;

[0159] 2. Identification of Agrobacterium positive colonies containing recombinant expression vector pCAMBIA3301-MsMYB306 or pFGC5941-MsMYB306

[0160] Pick PCR-positive colonies and add them to 3 mL of YEP liquid medium (containing 35 mg / L rifampicin and 50 mg / L kanamycin), and incubate at 28°C with shaking for 40 h. Perform PCR detection on 1 μL of the bacterial culture. The PCR primers for the recombinant expression vector pCAMBIA3301-MsMYB306 are: upstream primer Y4926 and downstream primer Y4927; the PCR primers for pFGC5941-MsMYB306 are: upstream primer Y5288 and downstream primer Y5289. PCR reaction system (10 μL): 5 μL of 2×Taq Plus Master Mix II (Vazyme), upstream primer (10 μmol·L⁻¹). -1 1 μL of downstream primer (10 μmol·L⁻¹) -1 1 μL of Agrobacterium tumefaciens solution, 1 μL of bacterial culture, and ddH2O to a final volume of 10 μL; PCR reaction program: 95℃ for 3 min; 95℃ for 15 s, 60℃ for 20 s, 72℃ for 20 s, 34 cycles; 72℃ for 10 min; the amplified products were detected by agarose gel electrophoresis at a mass fraction of 1% (m / v, g / 100 ml); the positive clones were confirmed to contain the plant expression vector pCAMBIA3301-MsMYB306 or pFGC5941-MsMYB306; 0.8 mL of Agrobacterium tumefaciens solution was taken, 0.2 mL of 80% (v / v) glycerol was added, mixed well, and stored at -80℃ for later use.

[0161] 3. Obtaining transgenic alfalfa plants

[0162] (1) Preparation of reagents and culture medium

[0163] ① 2,4-D stock solution (0.5 mg / mL), 6-BA stock solution (1 mg / L), 100 mM AS, termethin antibiotic stock solution (200 mg / mL), cephalosporin antibiotic stock solution (200 mg / mL), Basta stock solution (10 mg / mL);

[0164] ②KT stock solution (1mg / L): Weigh 100mg KT powder, dissolve it in 2mL of 95% ethanol, then dilute to 100mL with distilled water and store at 4℃;

[0165] ③100mM AS: Weigh 0.1962g of AS powder and dissolve it in 10mL of DMSO. Sterilize by filtration through a 0.22μm organic filter membrane and store in aliquots at -20℃.

[0166] ④ Termetine antibiotic stock solution (200mg / mL): Weigh 20g of termetine powder and dissolve it in 80mL of distilled water. Finally, make up to 100mL, filter and sterilize using a 0.22μm aqueous filter membrane, and store in aliquots at -20℃.

[0167] (5) Cephalosporin stock solution (200 mg / mL): 20 g of Cephalosporin powder was dissolved in 80 mL of distilled water, and finally diluted to 100 mL. The solution was sterilized by 0.22 μm water filter membrane and stored at -20 °C after aliquot;

[0168] (6) Basta stock solution: 200 g / L of Basta liquid was diluted to a storage solution with a concentration of 10 mg / mL. The solution was sterilized by 0.22 μm water filter membrane and stored at -20 °C after aliquot;

[0169] (7) SM4 callus maintenance medium (pH 5.8, with antibiotics and screening agents, Basta: 2 mg / L, Phosphinothricin: 200 mg / L, Cephalosporin: 200 mg / L)

[0170]

[0171] (8) MSBK medium (pH 5.85, with antibiotics and screening agents, Basta: 1 mg / L, Phosphinothricin: 200 mg / L, Cephalosporin: 200 mg / L)

[0172]

[0173] (9) MSS medium (pH 5.8, with antibiotics and screening agents, Basta: 1 mg / L, Phosphinothricin: 200 mg / L, Cephalosporin: 200 mg / L)

[0174]

[0175] (2) Agrobacterium-mediated infection of alfalfa leaves and identification of positive plants

[0176] ① 2 days before infection, single colonies of Agrobacterium transformed with the gene of interest were selected and cultured in YEP liquid medium containing kanamycin (50 mg / L) and rifampicin (35 mg / L) overnight. Positive clones were identified.

[0177] ② Things needed 1 day before infection (one transformation): forceps, knife, empty dishes, YEP 200 mL, SM4 + AS solid medium 200 mL, SM4 liquid medium 300 mL, sterilized distilled water 200 mL, sodium hypochlorite disinfectant 100 mL, filter paper, 2 empty 250 mL bottles, 2 wide-mouth bottles, 1 50 mL sharp-bottomed centrifuge tube. And inoculate the bacteria into YEP containing the same antibiotics at a ratio of 1:500;

[0178] ③The day of transformation, cut the leaves of 4-6 weeks old Medicago sativa Regen-SY4D with sterilized scissors, wash the surface with tap water, sterilize the surface with 6.25% NaClO for 40 min, wash with sterilized distilled water for 4-5 times to remove the NaClO, cut the petiole and leaf margin, and make some wounds on the leaves for transformation;

[0179] ④Keep the target bacteria liquid at 28°C with shaking to maintain OD 600 at 0.6-0.8, centrifuge at 22°C, 3000 rpm for 13 min, suspend the precipitate with 100 mL SM4 (containing 100 μM acetosyringone) to make the infection liquid;

[0180] ⑤Put the cut leaves into the infection liquid, mix well, and then perform ultrasonic wave at 40 Hz for 3-5 min (the water temperature should be lower than 20°C), and then vacuumize at -0.1 pka (>0.09 pka) for 10 min; keep at 28°C, 80 rpm for 1.5 h in the dark;

[0181] ⑥Take out the cut leaves, remove the Agrobacterium on the surface of the cut leaves on a sterilized filter paper as much as possible, and then transfer to SM4 solid medium containing 100 μM acetosyringone, with the leaf surface facing up, and keep in the dark for 2 days;

[0182] ⑦Transfer the co-cultured cut leaves to SM4 solid medium containing 20 mg / L Basta, 200 mg / L timentin and 200 mg / L cefotaxime (with the leaf surface facing up), and keep in the light for 5-6 weeks, and replace the medium every 2 weeks;

[0183] ⑧When the callus matures, transfer to MSBK medium containing 20 mg / L Basta halved, and keep in the dark, and replace the medium every 3 weeks until the pre-embryos are formed; about 20-30 days, the pre-embryos develop into real embryos;

[0184] ⑨After 2-3 weeks, the embryos start to develop into small plants and grow out; transfer the small plants to MSS medium, and transfer to a tissue culture tube when the plants grow out;

[0185] ⑩Transfer the robust plants to a greenhouse, define the plants grown from the same callus as the same transformation event, and give different Line numbers, culture, extract DNA, and use the Bar gene primers on the vector to identify the transgene, and then use for subsequent analysis of stress resistance functions.

[0186] PCR detection of the second transgenic Medicago sativa

[0187] 1. Method for extracting total DNA of Medicago sativa

[0188] 2xCTAB extraction solution was preheated in 65℃ water bath. A certain amount of leaf sample was put into a 2mL centrifuge tube with a steel ball, and then was frozen in liquid nitrogen and ground into powder with a grinder (40Hz, 1min). 500μL preheated extraction solution was added into the centrifuge tube, and then was incubated in 65℃ water bath for 30min, during which the tube was inverted every 10min. An equal volume (500μL) of chloroform / isoamyl alcohol (24:1, V / V) was added, and then the tube was shaken vigorously and incubated at 4℃ for 10min at 12000rpm. 350μL supernatant was transferred into a new 1.5mL centrifuge tube, and then an equal volume of isopropanol was added, and the tube was inverted to mix the solution, and then was incubated at -20℃ for more than 30min. The tube was centrifuged at 4℃ for 10min at 12000rpm, and then a white precipitate (DNA) was formed at the bottom of the tube. The supernatant was discarded, and then 1mL of 75% ethanol was added into the tube, and the tube was inverted several times, and then was incubated at 4℃ for 10min at 12000rpm. The supernatant was discarded, and then the liquid in the tube was dried, and then 50μL of 65℃ preheated sterile water was added to dissolve the DNA.

[0189] 2.PCR detection of transgenic alfalfa

[0190] Since the vectors pCAMBIA3301 and pFGC5941 which infected the plants also contained the Bar resistance gene in their left and right border regions, primers Y953 (5'-ATGAGCCCAGAACGACGC-3') and Y954 (5'-TCAAATCTCGGTGACGGG-3') which could specifically recognize the gene were used to detect whether the target gene was successfully transferred into the plant genome; the DNA obtained in the above step was used as a template for PCR amplification, and wild-type alfalfa was used as a negative control. The reaction system (10μL) was as follows: 5μL of 2xTaq Plus Master Mix II (Vazyme), 1μL of upstream primer Y953 (10μmol·L -1 ), 1μL of downstream primer Y954 (10μmol·L -1 ), 1μL of bacterial solution, and ddH2O was added to 10μL.

[0191] The PCR reaction program was as follows: 95℃ for 3min; 95℃ for 15s, 55℃ for 30s, 72℃ for 20s, 34 cycles; 72℃ for 10min; the amplification product was detected by 1% agarose gel electrophoresis Figure 8

[0192] The expression level of MsMYB306 gene in the overexpression and RNAi interference lines was detected by real-time quantitative PCR, and the results showed that the mRNA level of MsMYB306 gene in the overexpression transgenic alfalfa was significantly improved compared with wild-type alfalfa Figure 9 ​), while the mRNA level of MsMYB306 gene in RNAi transgenic alfalfa was significantly decreased Figure 10

[0193] Example 5. Identification of the frost resistance of transgenic alfalfa

[0194] I. Determination of the low temperature semi-lethal temperature

[0195] The leaves of alfalfa were taken, the excess petioles were removed, the leaf surface was washed clean with deionized water, and the water on the leaf surface was absorbed with filter paper. Each three single leaves were placed in a pre-cooled glass test tube, and a small piece of ice was carefully added, and three replicates were set for each sample. The test tubes were placed in a low temperature freezing circulator, starting from 0°C (cold acclimation -2°C), then treated at a rate of 2°C / h, 1 h at each temperature, 5 temperatures for each treatment, and the test tubes at each temperature point were taken out every 2°C and placed in 4°C overnight for thawing. 5 mL of deionized water was added to each test tube, and the conductivity of the water was recorded as C0. The test tubes were placed in a horizontal shaker at room temperature until the electrolytes were impermeable, and the conductivity C1 was measured. The test tubes were treated in a boiling water bath for 40 min to release all the electrolytes in the leaves, cooled to room temperature and the conductivity C2 was measured. The semi-lethal temperature was calculated according to the formula in previous studies (Yu et al., 2022).

[0196] II. Determination of the survival rate of alfalfa after freeze treatment

[0197] The main operation of the freeze injury treatment experiment of alfalfa was based on the method of previous studies (Yu et al., 2022) and was modified in combination with the growth status of plant materials. Alfalfa paper strips with at least 2 nodes were inserted into square plastic pots with a side length of 9 cm containing mixed nutrient soil (peat soil: vermiculite: perlite = 3:1:1 (v / v)), grown in a long day light (light 16 h, dark 8 h) incubator at 24°C for 40-50 d, and placed in a low temperature light incubator at -5°C for 6 h, then transferred to 4°C for thawing treatment, and grown in a long day light incubator at 22°C, the survival rate was counted after two weeks. The alfalfa that needed to be cold acclimated was moved to a long day light incubator at 4°C for cold acclimation for one week when it was grown for 40-50 d, then placed in a low temperature light incubator at -7°C for 6 h, and the subsequent operation was the same as that of non-cold acclimated material. Survival rate formula: survival rate = number of surviving plants / total number of plants * 100%.

[0198] The results are as follows Figure 11 ​As shown in A-C, the low temperature semi-lethal temperature of the transgenic alfalfa overexpressing MsMYB306 was significantly higher than that of the wild type, and the survival rate was significantly lower than that of the wild type, while the low temperature semi-lethal temperature of the RNAi transgenic alfalfa was significantly lower than that of the wild type, and the survival rate was significantly higher than that of the wild type. This shows that the frost resistance of the transgenic alfalfa interfering MsMYB306 expression is significantly higher than that of the wild type, and the frost resistance of the transgenic alfalfa overexpressing MsMYB306 is significantly lower than that of the wild type.

[0199] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application shall be equivalent replacement modes, and shall be included in the protection scope of the present application.

[0200] SEQUENCE LISTING

[0201] SEQ ID NO. 1

[0202] Medicago sativa L.

[0203] Nucleotide sequence of the MYB transcription factor MsMYB306 of Medicago sativa L.

[0204]

[0205] SEQ ID NO. 2

[0206] Medicago sativa L.

[0207] MYB transcription factor MsMYB306 of Medicago sativa L.

[0208]

[0209]

[0210] SEQ ID NO. 3

[0211] Medicago sativa L.

[0212] MYB transcription factor MsMYB306 of Medicago sativa L.

[0213] SEQ ID NO. 4

[0214] Medicago sativa L.

[0215] Anti-sense fragment of alfalfa MYB transcription factor MsMYB306 for RNAi vector construction

[0216] SEQ ID NO. 5 (upstream primer Y4752 for amplifying MsMYB306 gene fragment):

[0217] 5'- ATGATGGGAAGGCCACCATGTT -3';

[0218] SEQ ID NO. 6 (downstream primer Y4753 for amplifying MsMYB306 gene fragment):

[0219] 5'- CTAAAAGAAATCTGAAGTAGTT -3';

[0220] SEQ ID NO. 7 (upstream primer Y4926 for amplifying MsMYB306 to construct overexpression vector):

[0221] 5'- CACGGGGGACTCTTGACCATGGCAATGATGGGAAGGCCACCATGTT -3';

[0222] SEQ ID NO. 8 (downstream primer Y4927 for amplifying MsMYB306 to construct overexpression vector):

[0223] 5'- CGGGGAAATTCGAGCTGGTCACCCTAAAAGAAATCTGAAGTAGTT -3';

[0224] SEQ ID NO. 9 (upstream primer Y5288 for amplifying MsMYB306 interference fragment positive strand):

[0225] 5'- ACCATGGGGCGCGCCTGGCCAAACAAGCCTTATCTGA -3';

[0226] SEQ ID NO. 10 (downstream primer Y5289 for amplifying MsMYB306 interference fragment positive strand): 5'- TCATCGATTGGGCGCGCCTGCTTTGTGCTCCTTCACTACA -3';

[0227] SEQ ID NO. 11 (upstream primer Y5290 for MsMYB306 interference fragment negative strand enzyme cutting site): 5'- CTTAATTAACTCTCTAGATGGCCAAACAAGCCTTATCTGA -3';

[0228] SEQ ID NO. 12 (downstream primer of MsMYB306 interference fragment antisense strand enzyme digestion site Y5291): 5'-TTGCAGGTATTTGGATCCTGCTTTGTGCTCCTTCACTACA-3';

[0229] SEQ ID NO. 13 (upstream quantitative primer of MsMYB306 gene Y4928):

[0230] 5'-GTTCGCAGCTTCCGAATAAAG-3';

[0231] SEQ ID NO. 14 (downstream quantitative primer of MsMYB306 gene Y4929):

[0232] 5'-ACCAAGGGTTGTAGGGTTATG-3';

[0233] SEQ ID NO. 15 (upstream quantitative primer of Actin gene Y358):

[0234] 5'-CCCACTGGATGTCTGTAGGTT-3';

[0235] SEQ ID NO. 16 (downstream quantitative primer of Actin gene Y359):

[0236] 5'-AGAATTAAGTAGCAGCGCAAA-3';

[0237] SEQ ID NO. 17 (Y953):

[0238] 5'-ATGAGCCCAGAACGACGC-3';

[0239] SEQ ID NO. 18 (Y954):

[0240] 5'-TCAAATCTCGGTGACGGG-3'.

Claims

1. The use of silencing or interfering with the nucleotide sequence of the alfalfa MYB transcription factor MYB306 gene as shown in SEQ ID NO.1, or reducing the activity or content of the protein encoded by the alfalfa MYB transcription factor MYB306 gene, in improving the cold resistance of alfalfa or in breeding transgenic alfalfa with improved cold resistance.

2. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the alfalfa MYB transcription factor MYB306 gene is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, Silencing or interfering with the MYB306 gene, a MYB transcription factor in alfalfa, in target alfalfa plants improves the cold resistance of alfalfa.

4. The application of biological materials used to silence, interfere with, or inhibit the MYB transcription factor MYB306 gene with a nucleotide sequence as shown in SEQ ID NO.1 in improving the cold resistance of alfalfa or in breeding transgenic alfalfa with improved cold resistance, characterized in that, The biomaterial is at least one of the following (I) to (IV): (I) The interference sequence of the MYB transcription factor MYB306 gene; (II) Primer set used to amplify the interference sequence of the MYB transcription factor MYB306 gene described in (I); (III) The interference vector of the MYB transcription factor MYB306 gene; (IV) Recombinant microorganisms containing the interfering vectors described in (III).

5. The application according to claim 4, characterized in that, The primer set used to amplify the interference sequence of the MYB transcription factor MYB306 gene (I) includes MsMYB306 Interferometric fragment positive chain amplification upstream and downstream primers and MsMYB306 Upstream and downstream primers for the antisense strand restriction enzyme site of the interference fragment; MsMYB306 Interferometric fragment positive strand amplification upstream primer Y5288: 5'- ACCATGGGGCGCGCCTGGCCAAACAAGCCTTATCTGA-3'; MsMYB306 Interferometric fragment positive strand amplification downstream primer Y5289: 5'-TCATCGATTGGGCGCGCCTGCTTTTGTGCTCCTTCACTACA-3'; MsMYB306 upstream primer Y5290 for the antisense strand restriction enzyme site of the interference fragment: 5'-CTTAATTAACTCTCTAGATGGCCAAACAAGCCTTATCTGA-3'; MsMYB306 The downstream primer Y5291 for the antisense strand restriction enzyme site of the interference fragment: 5'-TTGCAGGTATTTGGATCCTGCTTTGTGCTCCTTCACTACA-3'.

6. The application according to claim 4, characterized in that, Silencing or interfering with the MYB transcription factor MYB306 gene in target alfalfa plants improves the cold resistance of alfalfa.

7. A method for improving the cold resistance of alfalfa, characterized in that, Silencing or interfering with the nucleotide sequence of the alfalfa MYB transcription factor MYB306 gene, as shown in SEQ ID NO.1, in target alfalfa plants enhances the cold resistance of alfalfa.

8. The method according to claim 7, characterized in that, The process of silencing or interfering with the alfalfa MYB transcription factor MYB306 gene in the target alfalfa is as follows: constructing the alfalfa MYB transcription factor... MYB306 The gene interference vector was transferred into the target alfalfa plant using Agrobacterium-mediated transformation to obtain transgenic alfalfa plants with improved cold resistance.

Citation Information

Patent Citations

  • Spatially modified gene expression in plants

    CN103403016A

  • Spatially Modified Gene Expression In Plants

    CN107674882A