Photoelectrochemical automatic detection device for detecting copper ions based on titanium dioxide doped biomass carbon

By using a TiO2/NSi doped biomass carbon nanocomposite material preparation method and an automatic photoelectrochemical detection device, the problems of expensive and cumbersome traditional copper ion detection have been solved, realizing portable, high-precision rapid detection of copper ions.

CN117761128BActive Publication Date: 2026-01-02JIANGSU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311782348.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-22
Publication Date
2026-01-02
Estimated Expiration
2043-12-22

AI Technical Summary

Technical Problem

Existing methods for detecting copper ions are expensive and cumbersome to operate, making it difficult to achieve sensitive and rapid on-site detection.

Method used

A TiO2/NSi-doped biomass carbon nanocomposite material (TiO2@NSi-C) was prepared and combined with an automatic photoelectrochemical detection device to achieve luminescence focusing, automatic sample replacement, and post-detection cleaning.

Benefits of technology

A portable, high-precision photoelectrochemical detection device is provided, which reduces the complexity of detection, improves detection efficiency and sensitivity, and is suitable for rapid detection of copper ions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117761128B_ABST
    Figure CN117761128B_ABST
Patent Text Reader

Abstract

The application discloses a photoelectrochemical automatic detection device for detecting copper ions based on titanium dioxide doped biomass carbon, relates to the field of photoelectrochemical detection, and uses prepared TiO2@NSi-C nanocomposite material as a detection electrode, and uses the detection in a detection device, and further comprises a shell, a light-emitting and light-collecting device, a base, a sample changing device and the detection device; the base is divided into several areas, the outer side of the base is provided with the shell, the sample changing device is arranged on the inner side of the base, and the light-emitting and light-collecting device and the detection device are arranged on the shell; wherein, the light-emitting and light-collecting device is used for providing required light for the sample changing device to realize electrochemical reaction of a sample; the detection device is used for detecting current change of the sample in the sample changing device; and the sample changing device is used for rotating the sample to a light receiving position. The device can realize automatic light-emitting and light-collecting, automatic sample changing and detection, and cleaning and liquid discharge after detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of photoelectrochemical detection, and particularly relates to a photoelectrochemical automatic detection device for detecting copper ions based on titanium dioxide doped biomass carbon. BACKGROUND

[0002] Copper is an important metal element, but excessive copper ions can cause harm to soil, water sources and human bodies. Traditional copper ion residue detection methods mainly include colorimetry, polarography, AAS method and ICP-AES method. However, due to the limitations of expensive instruments and complicated operation, it is urgent to develop a sensor technology for analysis which is sensitive, rapid, suitable for on-site detection and easy to popularize.

[0003] As a new emerging analysis and detection technology, photoelectrochemical sensing uses light signals as an excitation source and collects electrochemical signals, so that the mode has the advantages of high sensitivity, good stability, rapid analysis speed, simple device and easy miniaturization.

[0004] Semiconductor nanomaterials can greatly increase the surface area of semiconductor materials, produce some new physical properties, and can construct a wide range of heterojunctions, which can play an important role in the field of photoelectrochemical sensing.

[0005] Therefore, developing a portable, high-precision and highly automated photoelectrochemical detection device helps to promote the detection and production of heavy metal ions. Therefore, the application of the photoelectrochemical automatic detection device for detecting copper ions based on titanium dioxide doped biomass carbon is urgent. SUMMARY

[0006] In view of the deficiencies in the prior art, the application provides a preparation method of TiO2 / NSi doped biomass carbon nanocomposite (TiO2@NSi-C), which uses magnolia leaves as raw materials to prepare TiO2@NSi-C, and the TiO2@NSi-C prepared by the method is used for detecting Cu 2+ The use of the detection electrode in the detection device can realize automatic light emission and light collection, automatic sample replacement detection and cleaning and liquid discharge after detection.

[0007] The application achieves the above technical purposes through the following technical means.

[0008] A preparation method of TiO2@NSi-C includes the following steps:

[0009] Step 1, preparing NSi doped biomass carbon

[0010] The washed and dried Magnolia grandiflora leaves and activated carbon are added into a pyrolysis bottle, and are pyrolyzed by microwave in an inert atmosphere. After the reaction is completed, the biomass carbon and activated carbon are separated by sieving. The obtained biomass carbon is crushed in a ball mill to prepare the NSi-doped biomass carbon. The crushed biomass carbon is soaked in a strong acid and stirred, and then filtered and washed. The filter residue is dried in an oven to obtain the NSi-doped biomass carbon, which is denoted as NSi-C;

[0011] Step 2, preparation of TiO2@NSi-C

[0012] The NSi-C obtained in step 1 and titanium sulfate are added into an ethanol solution, mixed and stirred to obtain a solution A. Ammonium trifluoride is titrated into the solution A to obtain a mixed solution B. The mixed solution B is stirred and then transferred into a CEM microwave synthesizer. The microwave power is set, and a constant temperature reaction is performed. After the reaction is completed, the solid is collected by centrifugation and washing. Then, the solid is dispersed in anhydrous ethanol, dried, and then transferred into a tube furnace in a N2 atmosphere for calcination to obtain a TiO2 / NSi-doped biomass carbon composite material, which is denoted as TiO2@NSi-C.

[0013] In the above scheme, in step 1, the inert atmosphere is N2. The microwave pyrolysis reaction conditions are: microwave power 750 W, reaction temperature 550℃, and reaction time 15 min. The ball mill crushing conditions are 600 r / min. The strong acid is a hydrochloric acid solution with a pH value of 1.5 to 2.0. The stirring condition is magnetic stirring for 24 h. The washing needs to meet the condition that the material is neutral after washing. The drying condition is drying at 60℃ for 24 h.

[0014] In step 2, the constant temperature reaction conditions are 160℃, the microwave power is 200 W, and the constant temperature reaction time is 1 h. The calcination temperature in the tube furnace is 300℃, and the calcination time is 2 h.

[0015] A detection electrode is prepared from the TiO2@NSi-C prepared by the above preparation method, and the preparation steps are as follows:

[0016] (A1) dispersing the TiO2@NSi-C in deionized water to prepare a suspension;

[0017] (A2) taking 40-60 μL of the suspension in step (A1) to modify an ITO electrode, drying at room temperature to obtain a modified electrode, denoted as TiO2@NSi-C / ITO, and then dropping and coating 10-50 μL of an aptamer solution of Cu 2+ to obtain an aptamer / TiO2@NSi-C / ITO electrode;

[0018] (A3) taking 10-50 μL of Cu 2+The solution is drop-coated on the aptamer / TiO2@NSi-C / ITO electrode to obtain Cu 2+ / aptamer / TiO2@NSi-C / ITO electrode to obtain Cu 2+ The Cu 2+ concentration is detected.

[0019] In the above scheme, in step (A1), the concentration of the suspension TiO2@NSi-C is 5 mg / mL;

[0020] In step (A2), the Cu 2+ The aptamer sequence is: ATC GCG ATA TTT TCT GTA GCG ATT CTTGTT TGA GCGCTC GGT ACG AAC AGA;

[0021] In step (A3), the Cu 2+ The concentration is 1*10 -15 ~2*10 -7 mol / L.

[0022] A photoelectrochemical automatic detection device based on nanomaterials comprises a detection electrode, a shell, a light-emitting condensing device, a base, a sample changing device, and a detection device. The base is divided into several areas, and the outer side of the base is provided with a shell. The sample changing device is arranged on the inner side of the base. The light-emitting condensing device and the detection device are arranged on the shell. The light-emitting condensing device is used to provide the required light for the sample changing device to realize the electrochemical reaction of the sample. The detection device is used to detect the current change of the sample in the sample changing device. The sample changing device is used to rotate the sample to the light receiving position.

[0023] In the above scheme, the sample changing device comprises a reaction bin, a stepping motor, and a connecting shaft B. The output end of the stepping motor is connected with the connecting shaft B. The reaction bin is arranged on the connecting shaft B. A plurality of quartz chambers are arranged on the reaction bin. The quartz chambers are used to place samples.

[0024] In the above scheme, the detection device comprises a connecting shaft A, an extension rod, an extension motor, and a quartz chamber cover. The output end of the extension motor is the extension rod. One end of the connecting shaft A is arranged on the extension rod. The other end of the connecting shaft A is provided with the quartz chamber cover. The quartz chamber cover is below the detection electrode. The quartz chamber cover is matched with the opening on the quartz chamber.

[0025] In the scheme, the detection electrode comprises an Ag / AgCl electrode as a reference electrode, a platinum wire electrode as a counter electrode and an indium tin oxide glass (ITO) modified with TiO2@NSi-C as a working electrode.

[0026] In the scheme, the light emitted by the light-emitting condensing device enters the sample changing device through the light inlet hole a formed on the shell.

[0027] In the scheme, the light-emitting condensing device comprises a light source, a refracting mirror, a concave mirror and a plane mirror; the light emitted by the light source changes the light path through the concave mirror and the refracting mirror, and then enters the light inlet hole a through the plane mirror and the light outlet hole.

[0028] In the scheme, a fan is arranged in the light-emitting condensing device, and the fan is used to cool the light source.

[0029] In the scheme, a water pump and a liquid storage chamber are further included; the water pump pumps out the solution in the liquid storage chamber and then delivers the solution to the quartz chamber in the detection device through a pipeline to realize the cleaning of the quartz chamber.

[0030] In the scheme, a control system is further included, which is arranged in the base, and the control system comprises a PCB board, the PCB board is electrically connected with the stepping motor, the telescopic motor, the light source, the water pump and the screen; the screen is arranged on the shell, and the screen is used to display the processed data.

[0031] Beneficial effects:

[0032] 1. The overall structure of the device shell designed by the present application is compact, small and portable, and is suitable for carrying to the outdoor for detection, compared with the sampling, transportation and detection of the traditional detection, the detection is greatly simplified, and the detection cost is reduced.

[0033] 2. The light-emitting condensing device of the present application uses a plurality of mirrors to complete the aggregation of light and emit to the detection device to provide a stable light source. A fan is arranged in the device, and a ventilation hole is formed on the shell of the device for overall heat dissipation and exhaust.

[0034] 3. The photoelectrochemical detection device based on nanomaterials of the present application uses a composite nanomaterial composed of biomass carbon material made of agricultural waste and metal oxide nanomaterial to detect, and the photocatalytic performance is much higher than that of single nanomaterial, and the biomass carbon material made of agricultural waste also provides good biocompatibility for experimental detection, so that the device will also have good performance in the detection of plant hormones and the like. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 XRD spectrum of TiO2@NSi-C nanocomposite material;

[0036] Figure 2 XPS spectrum of TiO2@NSi-C nanocomposite material;

[0037] Figure 3 The figure is a photocurrent curve of the aptamer / TiO2@NSi-C / ITO electrode in the Cu 2 + / aptamer / TiO2@NSi-C / ITO electrode;

[0038] Figure 4 The figure is a photocurrent curve of the aptamer / TiO2@NSi-C / ITO electrode in the Cu 2+ solution concentration increasing condition;

[0039] Figure 5 The figure is a photoelectrochemical automatic detection device based on nanomaterials according to the present application;

[0040] Figure 6 The figure is a shell related to the present application;

[0041] Figure 7 The figure is a base surface distribution map related to the present application;

[0042] Figure 8 The figure is a base area distribution map related to the present application;

[0043] Figure 9 The figure is a base plan view related to the present application;

[0044] Figure 10 The figure is a base related to the present application;

[0045] Figure 11 The figure is an assembly view of the base related to the present application;

[0046] Figure 12 The figure is a light collecting and emitting device related to the present application;

[0047] Figure 13 The figure is an internal view of the light collecting and emitting device related to the present application;

[0048] Figure 14 The figure is an assembly view of the detection device related to the present application;

[0049] Figure 15 The figure is an assembly view of the sample changing device related to the present application;

[0050] Figure 16 The figure is a working principle diagram of the detection electrode in the present application.

[0051] Reference signs:

[0052] 1 - housing; 3 - base; 4 - PCB board; 5 - sample changing device; 6 - detection device; 7 - liquid storage chamber; 8 - water pump; 101 - screen; 102 - inlet cover; 2 - light focusing device; 103 - water inlet hole; 104 - sample inlet hole; 105 - screen fixing groove; 106 - liquid outlet hole a; 107 - light inlet hole a; 301 - wiring hole a; 302 - PCB fixing groove; 303 - water pump fixing seat; 304 - liquid outlet hole b; 305 - wiring hole b; 306 - motor mounting hole; 307 - light inlet hole b; 308 - reaction chamber fixing chamber; 201 - light outlet hole; 202 - light focusing device housing; 203 - heat dissipation hole; 204 - refracting mirror; 205 - concave mirror; 206 - light source; 207 - fan; 208 - plane mirror; 209 - partition; 601 - connecting shaft A; 602 - telescopic rod; 603 - telescopic motor; 604 - quartz chamber cover; 501 - quartz chamber; 502 - connecting shaft B; 503 - reaction chamber; 504 - stepping motor. DETAILED DESCRIPTION

[0053] Embodiments of the present application are described in detail below with reference to examples illustrated in the accompanying drawings, in which the same or similar components have the same or similar designations throughout the various figures. The embodiments described below are examples intended to explain the present application, and should not be understood as limiting the present application.

[0054] In the description of the present application, it should be understood that the terms "center", "longitudinal", "transverse", "length", "width", "thickness", "upper", "lower", "axial", "radial", "vertical", "horizontal", "inner", "outer", and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, and are only used to facilitate the description of the present application and simplify the description, and do not indicate or imply that the device or element referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as limiting the present application. In addition, the terms "first", "second" are only for descriptive purposes, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Therefore, the features defined as "first", "second" can explicitly or implicitly include one or more of the features. In the description of the present application, the meaning of "a plurality of" is two or more, unless otherwise specifically limited.

[0055] In the present application, unless otherwise explicitly specified and limited, the terms "mounting", "connecting", "connecting", "fixing" and the like should be understood broadly, for example, it can be fixedly connected, or it can be detachably connected, or integrally connected; it can be mechanically connected, or it can be electrically connected; it can be directly connected, or it can be indirectly connected through an intermediate medium, or it can be the communication inside two elements. For those skilled in the art, the specific meaning of the above terms in the present application can be understood according to the specific circumstances.

[0056] Embodiments:

[0057] A preparation method of TiO2@NSi-C, comprising the following steps:

[0058] Step 1, preparation of NSi doped biomass carbon

[0059] Take the washed and dried Magnolia denudata and activated carbon into the pyrolysis bottle, and introduce nitrogen for 15 min. Set the microwave pyrolysis reaction conditions: microwave power 720 W, reaction temperature 550℃, reaction time 15 min. After the reaction is completed, separate the biomass carbon and activated carbon using a sieve. Crush the obtained biomass carbon in a ball mill at a speed of 600 r / min for 30 min. Soak the crushed biomass carbon in hydrochloric acid and magnetically stir for 24 h. Finally, filter it using a Buchner funnel, wash it with ethanol and deionized water three times each until it is neutral, and transfer it to a 60℃ oven for drying for 24 h. The obtained biomass carbon is denoted as NSi-C.

[0060] Step 2, preparation of TiO2@NSi-C

[0061] Step 1, the obtained NSi-C and titanium sulfate are added to an ethanol solution and stirred thoroughly to obtain solution A. Ammonium trifluoride is titrated into solution A to obtain a mixed solution. After the mixed solution is stirred thoroughly, 25 mL is transferred to a CEM microwave synthesizer. The microwave power is set to 200 W, the reaction temperature is set to 160℃, and the reaction time is set to 1 h. After the reaction is completed, the solid is collected by centrifugation and washing. Then, the solid is dispersed in anhydrous ethanol, dried, and then transferred to a tube furnace in a N2 atmosphere and calcined at 300℃ for 2 h. The obtained TiO2 / NSi doped biomass carbon composite material is denoted as TiO2@NSi-C.

[0062] The prepared TiO2@NSi-C is used for detecting Cu in a photoelectrochemical automatic detection device 2+ comprising the following steps:

[0063] (1) TiO2@NSi-C is dispersed in deionized water to prepare a suspension of 5 mg / mL;

[0064] (2) Take 40-60 μL of the suspension described in step (A1) and modify it on the ITO electrode. Dry it at room temperature to obtain the modified electrode, denoted as TiO2@NSi-C / ITO. Then drop-coat 10-50 μL of Cu 2+ aptamer solution (Cu 2+ The aptamer sequence is: ATC GCGATA TTT TCT GTA GCG ATT CTT GTT TGA GCGCTC GGT ACG AAC AGA (this aptamer is a general aptamer and can be purchased directly), resulting in an aptamer / TiO2@NSi-C / ITO electrode;

[0065] (A3) Take 10-50 μL of a concentration of 1*10 -15 ~2*10 -7 Cu mol / L 2+ The solution was drop-coated onto the aptamer / TiO2@NSi-C / ITO electrode to obtain Cu. 2+ / aptamer / TiO2@NSi-C / ITO electrode, with Cu 2+ The aptamer / TiO2@NSi-C / ITO electrode is used as the working electrode, the silver / silver chloride electrode as the reference electrode, and the platinum wire electrode as the counter electrode for Cu detection. 2+ concentration.

[0066] Figure 1 The XRD diffraction pattern of TiO2@NSi-C prepared in Example 1 is shown. The crystal phases of TiO2@NSi-C were investigated by X-ray diffraction (XRD), which revealed that it is essentially composed of TiO2, SiO2, SiCN, and Si3N4. For TiO2, diffraction peaks were observed at 25.3° (101), 37.1° (103), 37.8° (004), 38.7° (112), 48.1° (200), 54.4° (105), 55.0° (211), 62.8° (204), 68.9° (116), 69.8° (220), and 75.1° (211), corresponding to the characteristic peaks on the TiO2 standard card (JCPDS NO. 21-1272). For SiO2, typical diffraction peaks were observed at 27.3° (011) and 44.0° (200). The diffraction peaks at 36.0°, 41.2°, and 72.4° are correlated with the crystal planes (111), (200), and (311) of β-SiC, respectively (JCPDS NO. 073-1708). The diffraction peaks at 39.1°, 41.2°, 56.6°, 64.6°, 65.9°, and 72.4° match the theoretically predicted β-Si3N4 standard card (JCPDS NO. 82-0702).

[0067] Figure 2is the XPS spectrum of TiO2@NSi-C prepared in Example 1. From the XPS full spectrum, it can be seen that TiO2@NSi-C is composed of Ti, O, C, Si elements. The high-resolution XPS spectrum (Figure B) of Ti 2p depicts the absorption peaks of Ti 2p at 458.6 eV and 464.4 eV, corresponding to Ti 4+ 2p 3 / 2 and Ti 2p 1 / 2 . In Figure C, the Si 2p spectrum can be well fitted to three characteristic peaks at 103.3 eV, 102.3 eV and 101.2 eV, corresponding to Si-O, Si-N and Si-C, respectively. From the N 1 s spectrum (Figure D), it can be observed that there are three peaks at 397.4 eV, 400.1 eV and 402.1 eV, belonging to pyridine nitrogen, graphitic nitrogen and oxidized nitrogen, respectively. In the high-resolution XPS spectrum of Figure E, the three peaks at 284.8 eV, 286.9 eV and 288.7 eV are attributed to C-C / C=C, C-N and C=N-C, respectively. The XPS spectrum of O 1 s (Figure F) is divided into three main characteristic peaks at 529.9 eV, 531.5 eV and 533.2 eV, which are attributed to C=O, Ti-O / Si-O and C-O, respectively.

[0068] Figure 3 is the change of photocurrent signal of TiO2@NSi-C prepared in Example 1 applied in sensor. The TiO2@NSi-C modified electrode (curve a) has a strong photocurrent response due to its high efficient charge separation ability; while the photocurrent of the aptamer / TiO2@NSi-C / ITO modified electrode (curve b) after combining with aptamer is significantly reduced. After dropping Cu 2+ solution on the prepared aptamer / TiO2@NSi-C / ITO electrode (curve c), the photocurrent is enhanced, which is mainly because the aptamer on the electrode can specifically recognize Cu 2 , so that Cu 2 and aptamer combine and then fall off from the surface of the material, thereby recovering the photocurrent of the sensor, so as to realize the construction of a sensor based on the photoelectrochemical signal "on-off-on" detection of Cu 2+ .

[0069] Figure 4 is the change of photocurrent intensity of the aptamer / TiO2@NSi-C / ITO electrode prepared in Example 1 under the condition of increasing concentration of Cu 2+ solution. The concentration of the measured Cu 2+ solution is 0 pM / L, 0.001 pM / L, 0.01 pM / L, 0.1 pM / L, 1 pM / L, 100 pM / L, 500 pM / L, 1000 pM / L, 1*10 4pM / L, 2*10 4 pM / L. As shown in (A), the intensity of photocurrent increases with the increase of Cu 2+ solution concentration, as shown in (B), the standard curve is drawn with the photocurrent intensity and different Cu 2+ solution concentration change value, and the optimal linear range is 1*10 -3 pM / L ~1*10 3 pM / L, the minimum detection limit is: 0.3*10 -4 pM / L, thus the photoelectrochemical aptamer sensor of the application can detect Cu 2+ Sensitivity detection can be carried out.

[0070] A photoelectrochemical automatic detection device for detecting copper ions based on titanium dioxide doped biomass carbon, comprising a shell 1, a light-emitting condensing device 2, a base 3, a sample changing device 5 and a detection device 6; the base 3 is divided into several areas, and the outer side of the base 3 is provided with the shell 1, the sample changing device 5 is arranged on the inner side of the base 3, and the light-emitting condensing device 2 and the detection device 6 are arranged on the shell 1, wherein the light-emitting condensing device 2 is used to provide the required light for the sample changing device 5 to realize the electrochemical reaction of the sample, and the detection device 6 is used to detect the current change of the sample in the sample changing device 5; the sample changing device 5 is used to rotate the sample to the light receiving position.

[0071] The sample changing device 5 comprises a reaction bin 503, a stepping motor 504 and a connecting shaft B 501; the output end of the stepping motor 504 is connected with the connecting shaft B 501, and the reaction bin 503 is arranged on the connecting shaft B 501; a plurality of quartz chambers 502 are formed in the reaction bin 503; and the quartz chambers 502 are used to place samples.

[0072] The detection device 6 comprises a connecting shaft A 601, an extension rod 602, an extension motor 603 and a quartz chamber cover 604; the output end of the extension motor 603 is the extension rod 602, one end of the extension rod 602 is provided with the connecting shaft A 601, the other end of the connecting shaft A 601 is provided with the quartz chamber cover 604, a detection electrode is arranged below the quartz chamber cover 604, and the quartz chamber cover 604 is matched with the opening on the quartz chamber 502.

[0073] The light emitted by the light-emitting condensing device 2 enters the sample changing device 5 through the light inlet hole a107 formed on the shell 1.

[0074] The light-emitting condensing device 2 comprises a light source 206, a refracting mirror 204, a concave mirror 205 and a plane mirror 208; the light emitted by the light source 206 changes the light path through the concave mirror 205 and the refracting mirror 204, and then enters the light inlet hole a107 through the light outlet hole 201 and the plane mirror 208.

[0075] A fan 207 is arranged in the light collecting and emitting device 2, and is used to cool the light source 206.

[0076] The water pump 8 is used to pump the solution in the solution storage chamber 7 to the quartz chamber 502 in the detection device 6, so as to clean the quartz chamber 502.

[0077] The control system is arranged in the base 3, and includes the PCB board 4, which is electrically connected with the stepping motor 504, the telescopic motor 603, the light source 206, the water pump 8 and the screen 101.

[0078] The photoelectrochemical automatic detection device based on nanomaterials includes a shell 1, a base 3, a light collecting and emitting device 2, a detection device 6, a sample changing device 5, a cleaning and liquid discharging system and a control system.

[0079] The base 3 includes wiring holes a301, a PCB fixing groove 302, a water pump fixing seat 303, liquid discharging holes b304, wiring holes b305, a motor mounting hole 306, a reaction bin fixing chamber 308 and light inlet holes b307.

[0080] The shell 1 includes a screen 101, an inlet cover 102, a water inlet hole 103, an inlet hole 104, a screen fixing groove 105, liquid discharging holes a106 and light inlet holes a107.

[0081] The light-gathering and light-emitting device 2 comprises a light outlet hole 201, a light-gathering and light-emitting device shell 202, a heat dissipation hole 203, a refracting mirror 204, a concave mirror 205, a light source 206, a fan 207, a plane mirror 208, and a partition 209. The light-gathering and light-emitting device takes the light-gathering and light-emitting device shell 202 as a support body. The light-gathering and light-emitting device 2 is provided with the light outlet hole 201 on a surface A, and the light outlet hole is positioned concentrically with the light inlet hole a107 on the equipment shell 1. The heat dissipation hole 203 can be opened on any side of the light-gathering and light-emitting device shell 202. The refracting mirror 204 is fixed in a groove inside the light-gathering and light-emitting device shell 202. The concave mirror 205 is fixed in a hole groove 1. The plane mirror 208 is fixed in a hole groove 2. The fan 207 is fixed inside the surface A of the light-gathering and light-emitting device shell 202. The light source 206 is fixed inside the light-gathering and light-emitting device shell 202, and is fixed by using the partition 209.

[0082] The detection device 6 comprises a connecting shaft A601, an extension rod 602, an extension motor 603, and a quartz chamber cover 604. The connecting shaft 601 connects the extension rod 602 and the quartz chamber 604 and is fixed. The extension rod 602 is connected with the extension motor 603 to complete the extension movement, and is connected with the connecting shaft 601 to realize the up and down movement of the quartz chamber cover 604.

[0083] The sample changing device 5 comprises a connecting shaft B501, a quartz chamber 502, a reaction bin 503, and a stepping motor 504. The connecting shaft B501 connects and fixes the quartz chamber 502 and the stepping motor 504, and realizes the rotation of the reaction bin 503 when the stepping motor 504 works step by step. The stepping motor 504 is fixed in the motor mounting hole 306 shown in the surface γ. The reaction bin 503 is fixed in the reaction bin fixing chamber 308 in the region B.

[0084] The cleaning and liquid discharging system comprises a liquid storage chamber 7 and a water pump 8. The liquid storage chamber 7 is fixed in the region C of the base 2. The water pump is fixed in the water pump fixing seat 303 in the region C of the base 2.

[0085] The control system comprises a PCB board 4. The PCB board 4 is fixed in the PCB fixing groove 302 in the region A of the base 2.

[0086] The base 3 is provided with a hole chamber in the area A, area B and area C respectively, the hole chamber in the area A is respectively provided with a wiring hole a301 and a wiring hole b305 for realizing the electrical connection and control of the PCB control board and the water pump 8, the stepping motor 504, the telescopic motor 603 and the light source 206, the area A is further provided with a PCB fixing groove 302 for fixing the PCB 4; the hole chamber in the area B is provided with a light inlet hole b307 with a diameter of 20mm-30mm at the surface α for passing the light emitted by the light gathering and emitting device 2, at the same time, the light inlet hole b307 and the light outlet hole 201 of the light gathering and emitting device 2 are coaxial, and the light is ensured to be irradiated on the material fixed on the electrode when the light is emitted, so as to realize the normal operation of the photoelectrochemical reaction; the hole chamber in the area B is punched through with the motor mounting hole 306 opened at the surface γ of the base 3, the through hole has a diameter of 30mm-50mm, and the through hole is used for connecting the stepping motor 504 and the reaction chamber 503; the area C is provided with a hole chamber for mounting and fixing the liquid storage chamber 7 and the water pump fixing seat 303, wherein the water pump fixing seat 303 is provided with a through hole with a diameter of 28mm-30mm for fixing the water pump 8.

[0087] The shell 1 is provided with an inlet hole 104 at the top, the inlet hole 104 is a square hole with a side length of 80mm, the hole realizes the function of fixing the quartz chamber 502 to the reaction chamber 503; the equipment shell 1 is provided with an inlet cover 102, which realizes the closed state of the inlet hole 104 and provides a darkroom environment for the photoelectrochemical reaction; the equipment shell 1 is provided with a light inlet hole a107, the diameter of the hole is consistent with the light inlet hole b307 opened at the surface α of the base 3, both are 20mm-30mm, and the two holes satisfy the coaxial positioning; the equipment shell 1 is provided with a water inlet hole 103 at the top, the diameter of the hole is 30-50mm, the water inlet hole 103 is located above the liquid storage chamber 7, which realizes the function of supplementing the cleaning liquid of the liquid storage chamber;

[0088] The spotlight 2, the overall spotlight shell 202 includes the partition 209 which uses black material, and meets the spotlight demand of the device; the light source 206 is fixed in the spotlight 2 through the partition 209, and the partition 209 is 28mm-35mm high; two parallel hole grooves are opened on the top of the spotlight 2, and the hole groove 1 and the hole groove 2 are both in the range of 10mm-15mm; the concave mirror 205 is fixed in the hole groove 1, and the diameter of the concave mirror corresponds to the hole diameter of the hole groove, the curvature radius of the concave mirror 205 is in the range of 20mm-30mm, and meets the formula f=R / 2; the plane mirror 208 is fixed in the hole groove 2, and the diameter of the plane mirror 208 is the same as the diameter of the hole groove; the fan 207 is fixed on the inner side of the face A of the spotlight shell 202, provides cooling wind when the light source 206 works, and is discharged through the cooling hole 203; the light source 206 works and emits light, and under the working of the overall darkroom environment and the refracting mirror 204, the light is primarily spotlighted, and most of the light is shot to the concave mirror 205, the light is spotlighted through the concave mirror 205, then passes through the plane mirror 208, and finally the light is shot out from the light outlet hole 201, so that the spotlighting function is realized;

[0089] The detection device 6, the telescopic rod 602 needs to meet the extension length of 20mm-50mm, and realizes the up-down movement of the quartz chamber cover 604 when the telescopic electrode 603 works while the sample changing device 5 works;

[0090] The stepping motor 504 is connected with the reaction bin 503 and the stepping motor 504 through the connecting shaft B 501, and the stepping motor 504 rotates and drives the reaction bin 503 to rotate; the reaction bin is provided with a plurality of hole chambers, the quartz chamber 502 is installed in the hole chamber, and the plurality of hole chambers of the reaction bin are sequentially rotated while the reaction bin 503 is rotated by the stepping motor 504 each time, so that the next quartz chamber is aligned with the light inlet hole, thereby realizing the automatic sample changing function;

[0091] The cleaning and liquid discharge system uses four pipes and two water pumps 8 to connect the liquid storage chamber 7 and the quartz chamber 502. One end of pipe A is arranged in the liquid storage chamber 7, and the other end is connected with the water pump connection hole A; one end of pipe B is connected with the water pump connection hole B, and the other end is arranged in the quartz chamber 502; one end of pipe C is arranged in the quartz chamber 502, and the other end is connected with the water pump connection hole C; one end of pipe D is connected with the water pump connection hole D, and the other end passes through the liquid discharge hole b 304 and the liquid discharge hole a 106, so that the four pipes realize the flow circulation from the liquid storage chamber 7 to the quartz chamber 502 to the outside, and realize the flow cleaning function;

[0092] The control system uses a PCB board to electrically connect the stepper motor 504, the telescopic motor 603, the light source 206, the water pump 8, and the screen 101. The control system realizes the acquisition, filtering, amplification, and data processing of electrical signals and displays the data on the screen 101. It also realizes the electrical control of the stepper motor 504, the telescopic motor 603, the light source 206, and the water pump 8, so that the whole device can operate normally.

[0093] Combined with appendix Figure 7 , Figure 8 , Figure 9 , Figure 10 , Figure 11 , Figure 12 As shown, wiring hole a in base 3 is located in area A, with a length of 30mm and a width of 15mm; PCB mounting slot 302 is located in area A, with a length of 76mm and a width of 50mm; water pump mounting base 303 is fixed in area C, and has a through hole with a diameter of 28mm and a depth of 37mm; drain hole b304 is opened on surface α of base 3, and this drain hole is concentrically positioned with drain hole a106 opened on equipment housing 1, wherein both drain hole b304 and drain hole a106 have a diameter of 6mm. Through holes; wiring holes b305 are opened on the partition between region A and region C of base 3; motor mounting holes 306 are opened on one side of surface γ of base 3, wherein the motor mounting holes 306 are 80mm long, 46mm wide and 155mm deep; reaction chamber fixing chamber 308 is opened in region B of base 3, wherein the reaction chamber fixing chamber 308 is 78mm in diameter and 45mm deep; light entrance holes b307 are opened on surface α of base, and the light entrance holes are concentrically positioned with the light entrance holes a107 opened on the equipment housing 1, wherein both light entrance holes a107 and light entrance holes b307 are through holes with a diameter of 20mm;

[0094] Combined with appendix Figure 5 , Figure 6As shown in the figure, the shell 1, wherein the screen 101 is fixed in the screen fixed groove 105; the cover 102 is fixed in the inlet hole 104, wherein the cover 102 is 80mm in length and 78mm in width; the water inlet hole 103 is opened on the top of the equipment shell 1, and the water inlet hole 103 is located above the liquid storage chamber 7, wherein the water inlet hole 103 is a through hole with a diameter of 30mm; the inlet hole 104 is opened on the top of the equipment shell 1, and the inlet hole 104 is concentrically positioned with the reaction bin fixing chamber 308 on the base 3, wherein the inlet hole 104 is 80mm in length and 78mm in width; the liquid outlet hole a 106 is opened on the side of the plane alpha, and the liquid outlet hole is concentrically positioned with the liquid outlet hole b 304 opened on the plane alpha of the base 3, wherein the liquid outlet hole b 304 and the liquid outlet hole a 106 are both through holes with a diameter of 6mm; the light inlet hole a 107 is opened on the side of the plane alpha, and the light inlet hole is concentrically positioned with the light inlet hole b 307 opened on the plane alpha of the base 3, wherein the light inlet hole a 107 and the light inlet hole b 307 are both through holes with a diameter of 20mm;

[0095] Combined with the attached Figure 13 、 Figure 14 As shown in the figure, the light gathering and emitting device takes the light gathering and emitting device shell 202 as the support main body, wherein the light gathering and emitting device shell 202 is 58mm in length, 36mm in width and 100mm in height; the light gathering and emitting device 2 is provided with the light outlet hole 201 on the plane A, and the light outlet hole is concentrically positioned with the light inlet hole a 107 on the equipment shell 1, wherein the light outlet hole 201 and the light inlet hole a 107 are both through holes with a diameter of 20mm; the heat dissipation hole 203 can be opened on any side of the light gathering and emitting device shell 202, and in this example, the heat dissipation hole 203 is located on the left side plane of the light outlet hole 201; the refracting mirror 204 is fixed in the groove inside the light gathering and emitting device shell 202; the concave mirror 205 is fixed in the hole groove 1; the plane mirror 208 is fixed in the hole groove 2; the fan 207 is fixed inside the plane A of the light gathering and emitting device shell 202; the light source 206 is fixed inside the light gathering and emitting device shell 202, and is fixed by the partition plate 209;

[0096] Combined with the attached Figure 15 As shown in the figure, the detection device 6 includes a connecting shaft A 601, a telescopic rod 602, a telescopic motor 603 and a quartz chamber cover 604; the connecting shaft 601 connects the telescopic rod 602 and the quartz chamber cover 604 and is fixed; the telescopic rod 602 is connected with the telescopic motor 603 to complete the telescopic movement, and is connected with the connecting shaft 601 to realize the up and down movement of the quartz chamber cover 604;

[0097] Combined with the attached Figure 16As shown, the sample changing device 5 includes a connecting shaft B501, a quartz chamber 502, a reaction chamber 503, and a stepping motor 504; the connecting shaft B501 connects and fixes the quartz chamber 502 and the stepping motor 504, and realizes the rotation of the reaction chamber 503 when the stepping motor 504 steps; the quartz chamber 502 has a length of 12 mm, a width of 12 mm, and a height of 40 mm; the stepping motor 504 is fixed in the motor mounting hole 306 shown in the plane γ; and the reaction chamber 503 is fixed in the reaction chamber fixing chamber 308 in the region B;

[0098] The cleaning and liquid discharging system includes a liquid storage chamber 7 and a water pump 8; the liquid storage chamber 7 is fixed in the region C of the base 2, and has a length of 80 mm, a width of 40 mm, a height of 95 mm, and a wall thickness of 2 mm; and the water pump is fixed in the water pump fixing seat 303 in the region C of the base 2;

[0099] The control system includes a PCB board 4; the PCB board 4 is fixed in the PCB fixing groove 302 in the region A of the base 2.

[0100] The accompanying drawings are referred to in the description of the application. Figure 16 As shown, the detection electrode is connected below the quartz chamber cover 604, wherein the detection electrode is a three-electrode system composed of a working electrode (TiO2@NSi-C / ITO), a reference electrode (platinum wire electrode), and a counter electrode (silver / silver chloride electrode). The light emitted from the light emitting hole 201 of the light collecting and emitting device 2 irradiates the working electrode, the nano material enters the excited state under light, and the hole-electron pair is separated to generate current. After the detection target is added, the hole-electron pair separation will be inhibited or promoted, thereby affecting the size of the output current. By detecting the current change after the detection target of different concentrations is added, the concentration of the detection target is detected.

[0101] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the description of the present application, the illustrative description of the above terms does not necessarily mean the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0102] Although the embodiments of the present application have been shown and described above, it should be understood that the above embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application without departing from the principles and purposes of the present application.

Claims

1. A method for preparing a TiO2 doped biomass carbon (TiO2@NSi-C) nanocomposite, characterized in that, comprising the following steps: Step 1, preparation of NSi doped biomass carbon Take the washed and dried leaves of Magnolia grandiflora and activated carbon into a pyrolysis bottle, microwave pyrolysis in an inert atmosphere, after the reaction is completed, separate the biomass carbon and activated carbon by sieving, crush the obtained biomass carbon in a ball mill to prepare NSi doped biomass carbon; after the crushed biomass carbon is soaked in strong acid and stirred, filter and wash, dry the filter residue in an oven to obtain NSi doped biomass carbon, denoted as NSi-C; Step 2, preparation of TiO2@NSi-C Take the NSi-C obtained in step 1 and titanium sulfate into an ethanol solution, mix and stir thoroughly to obtain solution A, titrate ammonium trifluoride into solution A to obtain a mixed solution; after the mixed solution is stirred thoroughly, transfer it into a CEM microwave synthesizer, set the microwave power, and carry out constant temperature reaction, after the reaction is completed, collect the solid by centrifugation and washing; then, disperse the solid into anhydrous ethanol, dry, and then transfer the sample into a tube furnace in N2 atmosphere to calcine to obtain TiO2 / NSi doped biomass carbon composite material, denoted as TiO2@NSi-C.

2. The production method according to claim 1, characterized by, In step 1, the inert atmosphere is N2; the microwave pyrolysis reaction conditions are: microwave power 750 W, reaction temperature 550℃, reaction time 15 min; the ball mill crushing conditions are 600 r / min; the strong acid is a hydrochloric acid solution with pH value of 1.5 to 2.0; The stirring condition is magnetic stirring for 24 h; the washing needs to meet the condition that the material is neutral after washing; the drying condition is drying at 60℃ for 24 h; In step 2, the constant temperature reaction condition is 160℃, the microwave power is 200 W, and the constant temperature reaction time is 1 h; the calcination temperature in the tube furnace is 300℃, and the calcination time is 2 h.

3. A detection electrode, characterized by The TiO2@NSi-C nanocomposite material is prepared by the preparation method of any one of claims 1-2, and the preparation steps are as follows: (A1) dispersing TiO2@NSi-C in deionized water to prepare a suspension; (A2) Take 40-60 μL of the suspension in step (A1) to modify on the ITO electrode, dry at room temperature to obtain a modified electrode, recorded as TiO2@NSi-C / ITO, then drop 10-50 μL of the aptamer solution of Cu 2+ to obtain an aptamer / TiO2@NSi-C / ITO electrode.

4. The detection electrode according to claim 3, characterized in that Take 10~50 μL of different concentrations of Cu 2+ solution was dropped on the aptamer / TiO2@NSi-C / ITO electrode to obtain Cu 2+ / aptamer / TiO2@NSi-C / ITO electrode, and the Cu 2+ / aptamer / TiO2@NSi-C / ITO electrode as the working electrode, a silver / silver chloride electrode as the reference electrode, and a platinum wire electrode as the counter electrode, and the Cu 2+ .

5. The detection electrode according to claim 4, characterized in that The Cu 2+ concentration of 1*10 -15 ~2*10 -7 mol / L.

6. The detection electrode according to claim 3, wherein In step (A1), the concentration of the suspension TiO2@NSi-C is 5 mg / mL; In step (A2), the Cu 2+ The aptamer sequence is: ATCGCGATATTTCCTGTAGCGATCCTTGTTTGAGCGCTCGGTACGAACAGA.

7. A nano-material based photoelectrochemical automatic detection device, characterized in that, The detection electrode in claim 3 further comprises a shell (1), a light-emitting and light-collecting device (2), a base (3), a sample changing device (5) and a detection device (6); the base (3) is divided into several areas, and the outer side of the base (3) is provided with the shell (1), the sample changing device (5) is arranged on the inner side of the base (3), and the light-emitting and light-collecting device (2) and the detection device (6) are arranged on the shell (1), wherein the light-emitting and light-collecting device (2) is used to provide the sample changing device (5) with required light to realize the electrochemical reaction of the sample, and the detection device (6) is used to detect the current change of the sample in the sample changing device (5); the sample changing device (5) is used to rotate the sample to a light receiving position; the detection device (6) comprises a connecting shaft A (601), an extension rod (602), an extension motor (603) and a quartz chamber cover (604); the output end of the extension motor (603) is the extension rod (602), one end of the extension rod (602) is provided with the connecting shaft A (601); the other end of the connecting shaft A (601) is provided with the quartz chamber cover (604), and a detection electrode is arranged below the quartz chamber cover (604); and the quartz chamber cover (604) is matched with an opening on a quartz chamber (502). 8.The nano-material based photoelectrochemical automatic detection device according to claim 7, wherein, The sample changing device (5) comprises a reaction bin (503), a stepping motor (504) and a connecting shaft B (501); the output end of the stepping motor (504) is connected with the connecting shaft B (501), and the connecting shaft B (501) is provided with the reaction bin (503); a plurality of quartz chambers (502) are formed in the reaction bin (503); and the quartz chambers (502) are used to place samples.

9. The nano-material-based photoelectrochemical automatic detection device according to claim 7, wherein the detection electrode comprises an Ag / AgCl electrode as a reference electrode, a platinum wire electrode as a counter electrode and an indium tin oxide glass (ITO) modified with titanium dioxide doped biomass carbon (TiO2@NSi-C) as a working electrode. 10.The nano-material based photoelectrochemical automatic detection device according to claim 7, wherein, The light emitted by the light-emitting and light-collecting device (2) enters the sample changing device (5) through an entrance hole a (107) formed in the shell (1).

11. The nano-material based photoelectrochemical automatic detection device according to claim 7, wherein, The light-emitting and light-collecting device (2) comprises a light source (206), a refracting mirror (204), a concave mirror (205) and a plane mirror (208); the light emitted by the light source (206) changes the light path through the concave mirror (205) and the refracting mirror (204), and then enters the entrance hole a (107) through the plane mirror (208) and an exit hole (201); and a fan (207) is arranged in the light-emitting and light-collecting device (2), and the fan (207) is used to cool the light source (206).

12. The nano-material based photoelectrochemical automatic detection device according to claim 7, wherein, It also includes a water pump (8) and a liquid storage chamber (7); the water pump (8) pumps out the solution in the liquid storage chamber (7) and then delivers it to the quartz chamber (502) in the detection device (6) to clean the quartz chamber (502); it also includes a control system, which is arranged in the base (3), the control system includes a PCB board (4), the PCB board (4) is electrically connected with the stepping motor (504), the telescopic motor (603), the light source (206), the water pump (8) and the screen (101); the screen (101) is arranged on the shell (1), and the screen (101) is used to display the processed data.