A method for constructing an inducible microglia knockout mouse model and its application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a method for constructing an inducible microglia knockout mouse model and its application. A method for constructing an inducible microglia defect mouse model is disclosed, and a Tmem119-DTR mouse model is constructed based on homologous recombination mediated by the CRISPR / Cas9 system using the screened high-activity gRNA target site; the inventor verifies the tdTomato fluorescence expression of microglia in the model, and the inducible killing of microglia by diphtheria toxin, thereby causing microglia defects. The model can be applied to fields such as microglia function research under specific physiological and pathological conditions.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a construction method and application of an inducible microglia knockout mouse model. Background Art

[0002] Microglia, also known as microglia, are a type of glial cell found in the central nervous system, including the brain, spinal cord, and eyes, accounting for about 10-15% of the total number of brain cells. As special macrophages in the nervous system, microglia perform functions such as phagocytosis and secretion in the brain, and are the most important immune barrier of the central nervous system. Under normal physiological conditions, microglia have a quiescent branching structure. When a neurological disease occurs in the brain or it is damaged, infected, or inflamed, microglia are activated, the cell body increases in size, and the morphology becomes amoebic, performing phagocytic functions. Abnormal proliferation and activation of microglia are closely related to a variety of central nervous system diseases. For example, the pathogenic risk genes of Parkinson's disease, Alzheimer's disease, and autism are all expressed by microglia.

[0003] Specific elimination of target cells in vivo is an important and effective method to study the function and mechanism of the cells. In order to better study the important role of microglia in the central nervous system, researchers have developed a variety of mouse models for studying microglia, including the use of drug intervention to cause microglial cell death / inhibit proliferation, such as colony stimulating factor 1 receptor (CSF1R) inhibitor PLX3397 and ATP competitive CSF1R inhibitor GW2580, which can effectively eliminate activated microglia within a certain window of time after drug intervention; there are also microglia-specific marker fluorescent tracing gene knock-in mouse models, which insert fluorescent reporter genes into microglia-specific marker proteins, such as Iba1, Cx3cr1 and other genes, and track microglia by marking these specific proteins. These methods have greatly increased researchers' understanding of microglia in homeostasis and disease conditions. However, these mouse models have certain limitations. The drug-induced model has a short window period for eliminating microglia, and microglia will re-proliferate after a certain period of time. The fluorescent tracing model can visually track microglia, but cannot analyze the situation when their functions are abnormal. Therefore, there is an urgent need for a specific method for preparing an induced microglia-deficient mouse model, which can cause microglia to be eliminated within a specific time under certain controllable induction conditions, and maintain a normal state in other time periods, so as to achieve specific research on microglia function. Summary of the invention

[0004] Diphtheria toxin (DT) is an exotoxin secreted by Corynebacterium diphtheriae. When it binds to the diphtheria toxin receptor (DTR), it can enter the cytoplasm through endocytosis, inhibit the activity of eukaryotic cell protein synthesis elongation factor 2 (EF-2), block cellular protein synthesis, and induce cell apoptosis. The efficiency of DT-mediated cytotoxicity is very high, and usually a single active DT molecule can kill eukaryotic cells. Mouse cells do not express DTR and are therefore insensitive to the killing effect of DT.

[0005] The inventors used gene editing technology to insert the DTR gene fragment into a specific position of the mouse genome to construct a homologous recombination vector, which was driven by a specific promoter to be specifically expressed on the surface of microglia. DT can then be administered systemically to mice, thereby achieving inducible elimination of specific cell types.

[0006] Transmembrane protein 119 (TMEM119) is a member of the transmembrane protein family and is highly specifically expressed on microglia. Therefore, by inserting DTR into the TMEM119 promoter through gene editing technology, DTR can be driven to be specifically expressed in mouse microglia, and inducible microglia elimination in mice can be achieved by administering diphtheria toxin.

[0007] In order to avoid disrupting the expression of endogenous Tmem119 in mice and thus causing microglial functional defects under normal conditions, the inventors designed a Tmem119-DTR mouse model by inserting the 2A-tdTomato-2A-DTR element before the stop codon of the mouse Tmem119 gene. Figure 1 The first aspect of the present invention discloses a method for constructing an inducible microglia knockout mouse model, and the construction method specifically comprises the following steps:

[0008] a. gRNA target site screening: gRNA target sites with low off-target risks were screened, and the sequence information of the gRNA target site is shown in SEQ ID NO: 1; the gRNA target sequence determines the efficiency and potential off-target activity of inducing Cas9 to cut the target gene. Efficient and specific target sequence selection and design are the prerequisites for successfully constructing the Tmem119-DTR mouse model.

[0009] b. Construction of homologous recombination vector: constructing a homologous recombination vector based on the obtained gRNA site and insertion site information;

[0010] Ⅰ. Construction of gene knock-in fragments: 2A peptide, red fluorescent protein, 2A peptide and diphtheria toxin receptor were synthesized by whole gene, and their sequence information was shown in SEQ ID NO:3-6, and they were connected from left to right to construct the gene knock-in fragments;

[0011] II. Construction of recombinant left arm and recombinant right arm: Using the mouse genome as a template, PCR amplification was performed to obtain the sequence of the recombinant left arm as shown in SEQ ID NO: 2, and the sequence of the recombinant right arm as shown in SEQ ID NO: 7;

[0012] III. Construction of Tmem119-DTR homologous recombination vector: Connect the recombinant left arm, gene knock-in fragment and recombinant right arm into the plasmid vector to obtain the Tmem119-DTR homologous recombination vector;

[0013] Vector structure as strategy Figure 2 As shown in A, the structures from left to right are: recombinant left arm, 2A peptide, red fluorescent protein (tdTomato), 2A peptide and diphtheria toxin receptor sequence, and recombinant right arm; the recombinant left arm and the recombinant right arm were obtained by PCR amplification using the mouse genome as a template, and the remaining fragments were obtained by whole gene synthesis.

[0014] c. Construction of Tmem119-DTR knock-in mice:

[0015] The fertilized eggs of mature mice were taken, and the Tmem119-DTR homologous recombination vector, Cas9 mRNA and gRNA were mixed and injected into the fertilized eggs. The injected fertilized eggs were transplanted into the oviducts of recipient mother mice to obtain gene-modified mice F0 generation mice;

[0016] When the F0 generation mice reach adulthood, they are mated with wild-type mice to obtain F1 generation mice. The recombinant left arm and the recombinant right arm in the F0 generation mice and the F1 generation mice are identified by PCR using primer pairs to obtain recombinant positive mice.

[0017] The primer pair includes an identification primer pair for the left arm of the recombination: primer P1, whose sequence is shown in SEQ ID NO:8, and primer P2, whose sequence is shown in SEQ ID NO:9; and an identification primer pair for the right arm of the recombination: primer P3, whose sequence is shown in SEQ ID NO:10, and primer P4, whose sequence is shown in SEQ ID NO:11.

[0018] Primer name Sequence information (5'→3') P1 ACATGCACACCGTCATAGCA(SEQ ID NO:8) P2 CCACGGACCTAGCAACCTTT(SEQ ID NO:9) P3 CACCTGTCCGTCCTTGAACA(SEQ ID NO:10) P4 CTGGGAGTTGAACCCTGTCC(SEQ ID NO:11)

[0019] The second aspect of the present invention discloses the use of the above-mentioned inducible microglia elimination mouse model in evaluating microglia function. That is, the mouse model constructed by the present invention can cause microglia elimination within a specific time under certain controllable induction conditions, and maintain a normal state in other time periods, thereby realizing the specific study of microglia function.

[0020] The third aspect of the present invention discloses the use of the above-mentioned inducible microglia knockout mouse model in screening drugs for preventing and / or treating central nervous system diseases. The inducible microglia knockout mouse model of the present invention can be used in combination with a specific central nervous system disease model to discover the pathological effects of different drugs in the presence or absence of microglia.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] The present invention provides a method for constructing an inducible microglia knockout mouse model and verifies it. The method utilizes the characteristic that the Tmem119 molecule is a mouse microglia-specific marker protein, and constructs a Tmem119-2A-tdTomato-2A-DTR site-specific gene knock-in mouse model by inserting diphtheria toxin receptor (DTR) and red fluorescent protein (tdTomato) into the Tmem119 gene expression frame, which can realize the expression of endogenous Tmem119 gene driving DTR and tdTomato fluorescent protein in mice. Utilizing this model, mouse microglia can be marked by tdTomato fluorescent expression; microglia can be killed by giving mice diphtheria toxin at a specific time point or time period, causing microglia to be knocked out, thereby realizing the role of microglia in specific physiological and pathological processes. The inducible microglia knockout mouse model of the present invention, combined with a disease model of a specific central nervous system, finds the pathological effects of different drugs in the presence or absence of microglia; it has a good prospect for drug screening and research and development. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The following are: the gene structure of mouse Tmem119 and the gene structure of Tmem119 after Tmem119-DTR gene modification.

[0024] Figure 2 Schematic diagram of the strategy for constructing the Tmem119-DTR mouse model and the identification results. Figure 2 A in the middle is a schematic diagram of the construction strategy of Tmem119-DTR mice; P1, P2, P3, and P4 are schematic diagrams of the positions of the primers for recombination PCR identification; Figure 2B and C in the middle are electrophoresis diagrams for homologous recombination identification in F0 generation mice; number 1 is the mouse number; M is a 1kb DNA marker.

[0025] Figure 3 This is the electrophoresis diagram for homologous recombination identification in F1 generation mice; the numbers are the mouse numbers, wt is the wild-type control; M is the 1kb DNA marker.

[0026] Figure 4 To detect the fluorescence expression of tdTomato in microglia of Tmem119-DTR mice; anti-mouseCD11b-APC and anti-mouse CD45-APC-A750 were used to label the microglia in the brains of mice in each group. low CD11b + The proportion of tdTomato-positive cells was analyzed in the cells.

[0027] Figure 5 Detection of the inducible knockout effect of microglia in Tmem119-DTR mice. DETAILED DESCRIPTION

[0028] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0029] Embodiment 1

[0030] Construction of Tmem119-DTR mouse model

[0031] In order to avoid disrupting the expression of endogenous Tmem119 in mice and thus causing microglial functional defects under normal conditions, the inventors designed a Tmem119-DTR mouse model by inserting the 2A-tdTomato-2A-DTR element before the stop codon of the mouse Tmem119 gene. Figure 1 shown.

[0032] 1) gRNA target site screening

[0033] The gRNA target sequence determines the efficiency and potential off-target activity of inducing Cas9 to cut the target gene. Efficient and specific target sequence selection and design are the prerequisites for successfully constructing the Tmem119-DTR mouse model.

[0034] According to the recombination scheme, the potential gRNA sites near the insertion site were analyzed by software, and the sites with low off-target risks were preferentially selected as the gRNA target sites (SEQ ID NO: 1) for subsequent mouse fertilized egg injection experiments.

[0035] 2) Construction of homologous recombination vector

[0036] According to the obtained gRNA site and insertion site information, a homologous recombination vector was constructed. The vector structure is as shown in the strategy Figure 2 As shown in A, the structures from left to right are: recombinant left arm, 2A peptide, red fluorescent protein (tdTomato), 2A peptide and diphtheria toxin receptor sequence, recombinant right arm, and the sequences are SEQ ID NO: 2-7. The recombinant left arm and the recombinant right arm were obtained by PCR amplification using the mouse genome as a template, and the remaining fragments were obtained by whole gene synthesis. During the construction process, the recombinant left arm, the gene knock-in fragment (2A-tdTomato-2A-DTR) and the recombinant right arm were first obtained by PCR, and the three DNA fragments were connected to the PBR322 vector using the In-Fusion method to obtain the final PBR322-Tmem119-DTR recombinant vector. After the vector was verified to be correct by enzyme digestion and sequencing, subsequent mouse preparation was carried out.

[0037] 3) Construction of Tmem119-DTR knock-in mice: Fertilized eggs of C57BL / 6 mice were taken, and the PBR322-Tmem119-DTR recombinant vector, Cas9 mRNA and gRNA were mixed according to the method in the Mouse Embryo Operation Experiment Manual (Third Edition), and then microinjected into the fertilized eggs. After a short period of incubation, the injected fertilized eggs were transplanted into the oviduct of the recipient mother mouse to obtain gene-modified mice F0 generation mice. After the F0 generation mice were born, their tails were cut and the genome was extracted. The identification primer pairs for the left arm of homologous recombination (primers P1 and P2) and the identification primer pairs for the right arm (primers P3 and P4) were used to identify whether correct homologous recombination occurred. The primer positions are shown in the figure below. Figure 2 As shown in P1-P4 in A, the sequence information is as follows:

[0038] Primer name Sequence information (5'→3') P1 ACATGCACACCGTCATAGCA(SEQ ID NO:8) P2 CCACGGACCTAGCAACCTTT(SEQ ID NO:9) P3 CACCTGTCCGTCCTTGAACA(SEQ ID NO:10) P4 CTGGGAGTTGAACCCTGTCC(SEQ ID NO:11)

[0039] The PCR reaction system of primer pairs P1 / P2 and P3 / P4 is the same, as follows:

[0040] PCR reaction composition Volume (μl) ddH2O 31 PCRBuffer 10 2.5 mM dNTP 4 Primer 1 (20 pmol / μl) 1 Primer 2 (20 pmol / μl) 1 DNA Polymerase 2 Genomic DNA 1 total 50

[0041] The PCR reaction procedures for primer pairs P1 / P2 and P3 / P4 are the same, as follows:

[0042]

[0043] A total of 2 F0 mice were born. The results of homologous recombination identification of the left arm of mice 1-2 were as follows: Figure 2 As shown in B, the F0 generation mice with correct homologous recombination can amplify a 5.6kb band, and the negative mice can amplify a 7.2kb band. The results show that correct homologous recombination occurred in the left arm of mouse No. 1; the results of homologous recombination identification of the right arm of mouse No. 1 are shown in Figure 2 As shown in C, correct recombination of the right arm can be amplified by PCR to produce a 4.4 kb band, and the results show that correct homologous recombination also occurred in the right arm of mouse No. 1.

[0044] When the F0 mice No. 1 were grown up, they were mated with wild-type C57BL / 6 mice to obtain F1 mice. After the F1 mice were born, their tails were cut and the genome was extracted. The same conditions as for the identification of the F0 mice were used to perform PCR identification on the left arm (primers P1 and P2) and the right arm (primers P3 and P4) of homologous recombination to confirm whether the obtained F1 mice were Tmem119-DTR gene knock-in mice with correct homologous recombination. The identification results were as follows: Figure 3 As shown. Figure A shows the results of homologous recombination identification of the left arm of F1 generation 1-10 positive mice; Figure B shows the results of homologous recombination identification of the right arm of F1 generation left arm positive mice. The results show that F1 generation mice No. 1, 3, 5, and 9 are recombinant positive mice obtained through passage.

[0045] Embodiment 2

[0046] Detection of tdTomato fluorescence expression in microglia of Tmem119-DTR gene knock-in mice

[0047] During the construction of Tmem119-DTR mice, DTR and tdTomato were co-expressed in the form of fusion proteins according to the design strategy. Therefore, when mouse microglia express DTR, the expression of tdTomato fluorescence should be detected at the same time. The inventors detected the tdTomato fluorescence expression of microglia in the brain by flow cytometry. The flow cytometry test results are shown in Figure 2. Figure 4 As shown, tdTomato fluorescence can be detected in almost all Tmem119-positive cells in the brain of Tmem119-DTR mice, and the fluorescence ratio is 100%, while tdTomato fluorescence can hardly be detected in microglia in the brain of wild-type C57BL / 6 mice. The above content verifies that tdTomato can be correctly expressed in mouse cells after homologous recombination.

[0048] Embodiment 3

[0049] Detection of microglial cell defect effects induced by DT in Tmem119-DTR gene knock-in mice

[0050] In order to verify whether microglia expressing DTR can be eliminated by diphtheria toxin, the inventors administered diphtheria toxin to wild-type mice and Tmem119-DTR mice every other day by intraperitoneal injection on days 0 and 2 of the experiment, respectively, at a dose of 0.015 mg / kg. At the same time as diphtheria toxin was administered, the content of microglia in the brain was detected on day 3 of the experiment. The relevant results are shown in Table 1. Figure 5 The results of flow cytometry showed that after two doses of DT, the proportion of Tmem119-DTR mice brain Tmem119 positive cells dropped to 21%, and tdTomato fluorescence could be detected in almost all of these cells, with a fluorescence ratio of 97.6%.

[0051] From the results, it can be seen that the homologous expression vector constructed by the present invention can knock the Tmem119-DTR gene into the microglia of mice and express it correctly, so that diphtheria toxin can induce killing of microglia and cause microglia defects.

[0052] In summary, the Tmem119-DTR mouse model was constructed based on homologous recombination mediated by the CRISPR / Cas9 system using the screened highly active gRNA target sites; the tdTomato fluorescence expression of microglia in this model, and the inducible killing of microglia by diphtheria toxin and the resulting microglial defects were verified. This model can be applied to the study of microglial function under specific physiological and pathological conditions.

[0053] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for constructing an inducible microglia knockout mouse model, characterized in that: The construction method specifically comprises the following steps: a. gRNA target site screening: Screening for a gRNA target site with low off-target risk, wherein the sequence information of the gRNA target site is shown in SEQ ID NO: 1; b. Construction of homologous recombination vector: constructing a homologous recombination vector based on the obtained gRNA site and insertion site information; Ⅰ. Construction of gene knock-in fragments: 2A peptide, red fluorescent protein, 2A peptide and diphtheria toxin receptor were synthesized by whole gene, and their sequence information was shown in SEQ ID NO:3-6, and they were connected from left to right to construct the gene knock-in fragments; II. Construction of recombinant left arm and recombinant right arm: Using the mouse genome as a template, PCR amplification was performed to obtain the sequence of the recombinant left arm as shown in SEQ ID NO: 2, and the sequence of the recombinant right arm as shown in SEQ ID NO: 7; III. Construction of Tmem119-DTR homologous recombination vector: Connect the recombinant left arm, gene knock-in fragment and recombinant right arm into the plasmid vector to obtain the Tmem119-DTR homologous recombination vector; c. Construction of Tmem119-DTR knock-in mice: The fertilized eggs of mature mice were taken, and the Tmem119-DTR homologous recombination vector, Cas9 mRNA and gRNA were mixed and injected into the fertilized eggs. The injected fertilized eggs were transplanted into the oviducts of recipient mother mice to obtain gene-modified mice F0 generation mice; When the F0 generation mice reach adulthood, they are mated with wild-type mice to obtain F1 generation mice. The recombinant left arm and the recombinant right arm in the F0 generation mice and the F1 generation mice are identified by PCR using primer pairs to obtain recombinant positive mice.

2. The method for constructing an inducible microglia-eliminated mouse model according to claim 1, characterized in that: The primer pair includes an identification primer pair for the left arm of recombination: primer P1, whose sequence is shown in SEQ ID NO: 8, and primer P2, whose sequence is shown in SEQ ID NO: 9; and an identification primer pair for the right arm of recombination: primer P3, whose sequence is shown in SEQ ID NO: 10, and primer P4, whose sequence is shown in SEQ ID NO:

11.

3. Use of the inducible microglia-eliminating mouse model prepared by the construction method according to any one of claims 1 to 2 in evaluating microglia function.

4. Use of the inducible microglia knockout mouse model prepared by the construction method according to any one of claims 1 to 2 in screening drugs for preventing and / or treating central nervous system diseases.

Images