A picrorhiza small rna, a small rna composition for preventing and / or treating liver cancer, a preparation method and use thereof
By using small RNAs PTH-sRNA-6 and PTH-sRNA-24 extracted from Pien Tze Huang, the expression of target genes in liver cancer was inhibited, which solved the problems of insufficient effectiveness in liver cancer treatment and early diagnosis, and achieved effective prevention and treatment of liver cancer.
Patent Information
- Application Number
- CN202310933805.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-27
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-07-27
AI Technical Summary
Current technologies lack effective early diagnosis methods and treatments, resulting in a high mortality rate for liver cancer patients. Furthermore, surgical treatment and other methods are limited, making it impossible to effectively control the early development and recurrence of liver cancer.
Small RNAs PTH-sRNA-6 and PTH-sRNA-24 were extracted from the traditional Chinese medicine Pien Tze Huang and administered orally to inhibit the expression of related target genes, thereby inhibiting the proliferation of liver cancer cells and promoting apoptosis. The resulting drug composition was used for the prevention and treatment of liver cancer.
Small RNA compositions can effectively inhibit the growth of liver cancer cells, are stably absorbed through the digestive tract, provide good preventive and therapeutic effects, and can be used as a marker for the quality control of Pien Tze Huang to improve therapeutic efficacy.
Smart Images

Figure CN117802096B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a Pianzhiwu small RNA, a small RNA composition, a preparation method and use for preventing and / or treating liver cancer. BACKGROUND
[0002] Liver cancer is one of the most common malignant tumors of the digestive system, and is the fourth largest fatal tumor in the world, which poses a serious threat to human health, especially in East Asia, Africa and Southern Europe. Due to the complex pathogenesis, occult early course, high incidence, poor prognosis, high recurrence and high metastasis after surgery, and especially the lack of effective early diagnosis methods and effective treatment methods, the mortality rate of patients remains high. At present, early surgical resection is the most important and effective treatment for liver cancer, but most patients are already in the middle and advanced stages when they are first diagnosed, which greatly limits surgical treatment, and the recurrence rate after surgery is high. In addition, local ablation, radiotherapy, interventional therapy and liver transplantation, due to the limitations of many contraindications in clinical application, the overall efficacy is still limited.
[0003] Traditional Chinese medicine believes that the pathogenesis of tumors is a dynamic change process of "toxicity, stasis and deficiency", among which toxicity and stasis play a dominant role in the development of the disease and are the key to preventing and treating tumors. Pianzhiwu is a lozenge refined from cow-bezoar, Sanqi, snake gall, musk and other precious Chinese medicines. The patent application with publication number CN104189037A discloses the use of Pianzhiwu in anti-tumor, and points out that Pianzhiwu has certain therapeutic effect on liver cancer. However, the mechanism of Pianzhiwu in exerting efficacy has not been clearly defined.
[0004] Small RNA (sRNA) refers to a class of non-coding RNA molecules with a length of less than 200 nt, including micro RNA (miRNA), small interference RNA (siRNA) and piwi-interacting RNA (piRNA). Small RNA can regulate gene expression at the post-transcriptional level and plays an important role in physiological and pathological processes. Recent studies have found that small RNAs in some traditional Chinese medicines can enter the blood and tissues and organs of the body through the digestive tract and play an important role in disease treatment. For example, MIR2911 in honeysuckle decoction can enter the mouse body through oral administration, and directly act on influenza virus. These findings suggest that small RNAs in traditional Chinese medicines may be a new type of effective ingredient of traditional Chinese medicines that has been overlooked for a long time, which can be absorbed through the digestive tract after oral administration, and reach the target organs to exert therapeutic value. SUMMARY
[0005] The purpose of the present application is to provide a Pianzhiwu small RNA, a small RNA composition, a preparation method and use for preventing and / or treating liver cancer.
[0006] The present application provides a small RNA for preventing and / or treating liver cancer, which is a nucleotide sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0007] The present application also provides use of the aforementioned small RNA in preparation of a medicine for preventing and / or treating liver cancer.
[0008] Further, the medicine is a medicine for inhibiting proliferation of liver cancer cells.
[0009] Preferably, the medicine prepared from the nucleotide sequence as shown in SEQ ID NO. 1 is a medicine for inhibiting expression of CUX1 gene.
[0010] And / or, the medicine prepared from the nucleotide sequence as shown in SEQ ID NO. 2 is a medicine for inhibiting expression of NDRG3, CAT1, SLC7A1 gene.
[0011] The present application also provides a small RNA composition for preventing and / or treating liver cancer, which is composed of the nucleotide sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2.
[0012] Further, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 1 is 60-80%, and the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 2 is 20-40%.
[0013] Further, the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 1 is 76-77%, and the molar percentage of the nucleotide sequence as shown in SEQ ID NO. 2 is 23-24%.
[0014] Further, the molar ratio of the nucleotide sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 is 1:0.3.
[0015] The present application also provides a preparation method of the aforementioned small RNA composition, which comprises the following steps:
[0016] Mixing the nucleotide sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and then the preparation is completed.
[0017] The present application also provides use of the aforementioned small RNA composition in preparation of a medicine for preventing and / or treating liver cancer.
[0018] Further, the medicine is a medicine for inhibiting proliferation of liver cancer cells; and / or, the medicine is a medicine for promoting apoptosis of liver cancer cells.
[0019] Preferably, the drug is a drug that inhibits the expression of NDRG3, CUX1, CAT1, SLC7A1 genes.
[0020] The present application also provides a drug for preventing and / or treating liver cancer, which is a preparation prepared from the aforementioned small RNA or the aforementioned small RNA composition as an active ingredient, plus a pharmaceutically acceptable adjuvant or auxiliary ingredient.
[0021] Compared with the prior art, the present application has the following beneficial effects:
[0022] The present application discovers two small RNAs (PTH-sRNA-6 and PTH-sRNA-24) from traditional Chinese medicine Pianzaihu, which have inhibitory effects on lung cancer target genes and can inhibit the proliferation of liver cancer cells, and can be used for preventing and / or treating liver cancer. Moreover, the composition of the two small RNAs combined can also effectively inhibit the growth of liver cancer cells and has good preventive and / or therapeutic effects on liver cancer. Meanwhile, the two small RNAs of the present application can be effectively absorbed by ingestion and stably exist, and are convenient and effective to use. The two small RNAs of the present application can be used as markers for quality control of Pianzaihu, and Pianzaihu with high content of the two small RNAs has better effects on treating liver cancer. The present application discovers small RNAs in Pianzaihu that are beneficial to treating liver cancer, which has important significance for further research and development and quality control of Pianzaihu.
[0023] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical ideas of the present application.
[0024] The above content of the present application will be further described in detail through the following embodiment. However, this should not be understood as limiting the scope of the above subject matter of the present application to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 Flow chart for high-throughput sequencing of small RNAs.
[0026] Figure 2 Copy number of small RNAs sequenced by Solexa.
[0027] Figure 3 Contents of Pianzaihu small RNAs PTH-sRNA-6 and PTH-sRNA-24 in the serum of mice in each group.
[0028] Figure 4 Contents of Pianzaihu small RNAs PTH-sRNA-6 and PTH-sRNA-24 in the liver of mice in each group.
[0029] Figure 5 The binding ability of PTH-sRNA-6 to the mRNA of CUX1 gene.
[0030] Figure 6 The binding ability of PTH-sRNA-24 to the mRNA of NDRG3 gene.
[0031] Figure 7 The binding ability of PTH-sRNA-24 to the mRNA of CAT1 gene.
[0032] Figure 8 The binding ability of PTH-sRNA-24 to the mRNA of SLC7A1 gene.
[0033] Figure 9 The binding ability of PTH-sRNA-24 to the mRNA of SLC7A1 gene.
[0034] Figure 10 The apoptosis rate of liver cancer cells is detected by flow cytometry.
[0035] Figure 11 The proliferation of liver cancer cells is detected by CCK8.
[0036] Figure 12 The change of tumor diameter of nude mice. DETAILED DESCRIPTION
[0037] The raw materials and equipment used in the specific embodiments of the present application are known products, which are obtained by purchasing commercially available products.
[0038] The Pianzhihuang used in the present application is provided by Zhangzhou Pianzhihuang Pharmaceutical Co., Ltd.
[0039] The inventors previously extracted total RNA of Pianzhihuang and performed high-throughput sequencing of small RNA. Then, the mice were gavaged with Pianzhihuang, and the RNA of mouse serum was extracted for high-throughput sequencing of small RNA to screen Pianzhihuang-derived small RNA, and small RNAs with copy number greater than 100 were selected. Through research, the present application found two small RNAs related to liver cancer.
[0040] Example 1, verification of two small RNAs in Pianzhihuang
[0041] 1. Extraction of total RNA in Pianzhihuang
[0042] An appropriate amount of Pianzhihuang was ground into 100-mesh powder at room temperature or low temperature, and then the total RNA of the sample was extracted by Trizol reagent. The specific extraction method is as follows:
[0043] 1) Using a low temperature grinder, grind the Piancizeng into powder, take 50mg into a 1.5ml centrifuge tube, add 1ml trizol, vortex, and stand for 10min on ice;
[0044] 2) Add 200ul chloroform, mix well by shaking, and then stand for 5min;
[0045] 3) Centrifuge at 14000g for 20min at 4℃;
[0046] 4) Take the supernatant into a new 1.5ml centrifuge tube, add 1-2 times the volume of isopropanol, mix well, and then stand for 1h or more at-20℃;
[0047] 5) Centrifuge at 14000g for 20min at 4℃;
[0048] 6) Discard the supernatant and leave the precipitate, add 1ml 75% alcohol prepared with DEPC water, and blow;
[0049] 7) Centrifuge at 14000g for 20min at 4℃;
[0050] 8) Discard the supernatant, invert the 1.5ml centrifuge tube to dry the alcohol, about 5-10min;
[0051] 9) Add DEPC water to dissolve, and store at-80℃, to obtain Piancizeng total RNA.
[0052] 2, Detection of the content of the two small RNAs
[0053] After the total RNA of Piancizeng is extracted, it can be detected by high-throughput sequencing technology, reverse transcription PCR (RT-PCR), real-time fluorescent quantitative PCR (qPCR), RNA chip, Northern Blotting, in situ hybridization and other technologies. The specific method of this embodiment is as follows:
[0054] After the total RNA of Piancizeng is extracted, it can be detected by high-throughput sequencing technology, reverse transcription PCR (RT-PCR), real-time fluorescent quantitative PCR (qPCR), RNA chip, Northern Blotting, in situ hybridization and other technologies. The specific method of this embodiment is as follows: Figure 1 Through the conventional small RNA high-throughput sequencing (experimental process as shown in
[0055] Table 1. Name and sequence of small RNA
[0056]
[0057] The copy number of the above two small RNAs is as shown in Figure 2 provided by the sequencing company (Shenzhen Huada Gene Company Limited).Figure 2 As shown in Table 1, the contents of the two PTH-sRNAs in Pianzhihuang are relatively high. The content of PTH-sRNA-6 in Pianzhihuang is 256786 copies, and the content of PTH-sRNA-24 in Pianzhihuang is 77153 copies.
[0058] The beneficial effects of the present application are demonstrated by the following specific test examples.
[0059] Test Example 1, Stability study of Pianzhihuang small RNA entering the body through ingestion
[0060] 1. Experimental method
[0061] The Pianzhihuang small RNA entering the animal body through ingestion and stably existing was detected by RT-qPCR method. Male C57 mice were randomly divided into PBS control group, single-dose Pianzhihuang administration group, and multiple-dose Pianzhihuang administration group. After fasting for 12 h, Pianzhihuang was ground into 100-mesh powder, which was then suspended in PBS to prepare a suspension for gavage administration. The single-dose administration group was administered by gavage only once, and the multiple-dose administration group was administered by gavage once every 3 h, for a total of three times. The gavage dose of Pianzhihuang was 0.1 g / 100 g each time. The PBS control group was administered with the same dose of PBS by gavage. The mouse blood was collected 6 h after the last gavage, and the liver tissue was collected. RNA was extracted from the serum and liver tissue, and the content of Pianzhihuang small RNA (PTH-sRNA-6 and PTH-sRNA-24) was detected by Real-time PCR. The primers for reverse transcription PCR and qPCR detection of Pianzhihuang small RNA are shown in Table 2.
[0062] Table 2. List of primers for reverse transcription PCR and qPCR detection
[0063]
[0064] The sRNA of Pianzhihuang was reverse transcribed using the system shown in Table 3 (10 μl).
[0065] Table 3. sRNA reverse transcription reaction system
[0066]
[0067] After the system was prepared, it was mixed and placed in a PCR instrument for reaction. The reaction program is shown in Table 4.
[0068] Table 4. Reverse transcription program of sRNA
[0069]
[0070] After reverse transcription, qPCR primers were used for quantitative detection. The qPCR system is shown in Table 5, and the reaction program is shown in Table 6.
[0071] Table 5. sRNA fluorescence quantitative PCR reaction system
[0072]
[0073]
[0074] Table 6. Fluorescence quantitative PCR reaction program
[0075]
[0076] 2. Experimental results
[0077] The relative concentration of the two Piancizeng small RNAs in serum and liver tissue is shown in Table 5. Figure 3 and Figure 4 The results show that the two Piancizeng small RNAs can be absorbed through the digestive tract and reach the serum and liver tissue. The experimental results show that the two Piancizeng sRNAs of the present application can enter the animal body through ingestion and stably exist.
[0078] Test Example 2, bioinformatics means analysis of the binding of Piancizeng small RNA and target gene
[0079] 1. Experimental method
[0080] Whether the Piancizeng small RNA can bind to a series of target genes related to liver cancer disease and inhibit the expression of the target gene to play a therapeutic value on liver cancer disease is studied. The RNA hybrid is used to predict the inhibition effect of the two Piancizeng small RNAs on NDRG3, CUX1, CAT1 and SLC7A1 target genes.
[0081] 2. Experimental results
[0082] The results are as follows:
[0083] The binding ability of PTH-sRNA-6 and CUX1 gene mRNA is shown in Table 6. Figure 5 The figure illustrates the binding mode, binding site and binding free energy of PTH-sRNA-6 and CUX1 gene mRNA. Among them, PTH-sRNA-6 has one binding mode with CUX1.
[0084] The binding ability of PTH-sRNA-24 and NDRG3, CAT1 and SLC7A1 gene mRNA is shown in Table 7. Figures 6-8The binding mode, binding site and binding free energy of PTH-sRNA-24 with NDRG3, CAT1 and SLC7A1 gene mRNA are shown. Among them, PTH-sRNA-24 has three binding modes with NDRG3, one binding mode with CAT1 and one binding mode with SLC7A1.
[0085] NDRG3, CUX1, CAT1 and SLC7A1 are all recognized genes that play a role in promoting the occurrence and development of liver cancer disease process. By inhibiting the expression of the four target genes, the proliferation of liver cancer cells can be inhibited, therefore, inhibiting NDRG3, CUX1, CAT1 and SLC7A1 can play a therapeutic role in liver cancer.
[0086] The experimental results show that PTH-sRNA-6 has an inhibitory effect on CUX1 gene, and PTH-sRNA-24 has an inhibitory effect on NDRG3, CAT1 and SLC7A1 genes, indicating that small RNA PTH-sRNA-6 and PTH-sRNA-24 both have an effect of inhibiting the proliferation of liver cancer cells and can be used for preventing and / or treating liver cancer; and the combination of PTH-sRNA-6 and PTH-sRNA-24 can simultaneously inhibit the expression of NDRG3, CUX1, CAT1 and SLC7A1 genes, further playing a role in preventing and / or treating liver cancer.
[0087] Test Example 3, Inhibitory Effect of Pianciao Small RNA on Target Genes
[0088] 1. Experimental method
[0089] PTH-sRNA-6 and PTH-sRNA-24, two kinds of Pianciao small RNA, are obtained from Pianciao using the method described in Example 1, or can be directly synthesized using conventional techniques.
[0090] The inhibitory effect of Pianciao small RNA on each target gene is proved by luciferase reporter experiment:
[0091] The target genes NDRG3, CUX1, CAT1, and SLC7A1, which bind to the two Pien Tze Huang small RNAs PTH-sRNA-6 and PTH-sRNA-24 (Table 7), were inserted into the pMIR-REPORT Luciferase plasmid to construct luciferase reporter plasmids for each gene. Positive clones were screened and sequenced for verification, and clones were amplified and the plasmids purified. The relevant cells were cultured and inoculated in 24-well plates. After 12-16 hours, the cells were co-transfected with luciferase expression plasmids carrying the predicted target genes and Pien Tze Huang small RNAs (PTH-sRNA-6 and PTH-sRNA-24). After 24 hours, the cells were collected and lysed, and luciferase substrate was added. Luciferase reacted with the substrate to produce luciferin. Luciferase activity was determined by measuring the intensity of the fluorescence. Comparison with the nonsense RNA transfection group determined whether the predicted target could be inhibited by the Pien Tze Huang small RNA. Nonsense small RNA is a meaningless small RNA sequence that does not bind to the target gene.
[0092] Nonsense small RNA sequence: GGCAGCUAACCUAUAUGACAUGC (SEQ ID NO.9)
[0093] Table 7. Sequence fragments of Pien Tze Huang sRNA binding to target genes
[0094]
[0095]
[0096] 2. Experimental results
[0097] The results of luciferase reporter assay showed that ( Figure 9 ), the Pien Tze Huang small RNA of the present invention has an inhibitory effect on the four target genes NDRG3, CUX1, CAT1, and SLC7A1. However, the nonsense small RNA has no inhibitory effect on these four target genes. This indicates that the Pien Tze Huang small RNA composition of the present invention has an inhibitory effect on all liver cancer target genes and can be used for the prevention and / or treatment of liver cancer.
[0098] Experimental Example 4: Cell apoptosis experiment
[0099] 1. Experimental methods
[0100] The two Pien Tze Huang small RNAs, PTH-sRNA-6 and PTH-sRNA-24, were directly synthesized using conventional techniques.
[0101] PTH-sRNA-6 and PTH-sRNA-24 at a molar ratio of 1:0.3, i.e. the molar percentage of PTH-sRNA-6 in the mixed small RNA is 77% and the molar percentage of PTH-sRNA-24 is 23%. Normal cells without transfection of sRNA are used as a control (control); scramble RNA is transfection of nonsense small RNA, and the nucleotide sequence of the nonsense small RNA is shown in SEQ ID NO. 9, which is used as a negative control.
[0102] 2. Experimental results
[0103] The apoptosis experiment results are shown in Table 1. Figure 10 The results show that the apoptosis rate of liver cancer cells is increased after treatment with the Pianzhiyu sRNA composition (PTH sRNA: PTH-sRNA-6 and PTH-sRNA-24) of the present application. This indicates that the Pianzhiyu sRNA composition of the present application can promote the apoptosis of liver cancer cells.
[0104] Test Example 5, Cell proliferation experiment
[0105] 1. Experimental method
[0106] The two Pianzhiyu small RNAs of PTH-sRNA-6 and PTH-sRNA-24 are directly synthesized by using conventional techniques.
[0107] PTH-sRNA-6 and PTH-sRNA-24 at a molar ratio of 1:0.3, i.e. the molar percentage of PTH-sRNA-6 in the mixed small RNA is 77% and the molar percentage of PTH-sRNA-24 is 23%. Normal cells without transfection of sRNA are used as a control (control); scramble RNA is transfection of nonsense small RNA, and the nucleotide sequence of the nonsense small RNA is shown in SEQ ID NO. 9, which is used as a negative control.
[0108] 2. Experimental results
[0109] The results of the cell proliferation experiment are shown in Figure 11 Figure 2, which show that the treatment of the PTH sRNA compositions of the present application (PTH-sRNA-6 and PTH-sRNA-24) can inhibit the proliferation of liver cancer cells. This indicates that the PTH sRNA compositions of the present application have a therapeutic effect on liver cancer.
[0110] Test Example 6: In vivo verification of the inhibition of liver cancer cell proliferation by PTH sRNA
[0111] 1. Experimental method
[0112] The PTH sRNA was transfected into liver cancer cells (the molar ratio of PTH-sRNA-6 and PTH-sRNA-24 was 1:0.3, i.e. the molar percentage of PTH-sRNA-6 in the mixed small RNA was 77% and the molar percentage of PTH-sRNA-24 was 23%), and then the transfected cells were injected subcutaneously into nude mice at a dose of 1 x 10^ 6 The liver cancer cells not transfected with PTH sRNA were injected subcutaneously into nude mice as a control (control). Scramble RNA, which is a nonsense small RNA having the nucleotide sequence shown in SEQ ID NO. 9, was used as a negative control.
[0113] 2. Experimental results
[0114] The results of the change in the tumor diameter of the nude mice are shown in Figure 12 Figure 3, which show that the proliferation rate of the cells treated with the PTH sRNA compositions (PTH-sRNA-6 and PTH-sRNA-24) was slower than that of the liver cancer cells not treated (control). This indicates that the PTH sRNA compositions discovered in the present application can effectively inhibit the growth of liver cancer tumors.
[0115] In conclusion, the present application discovers two small RNAs (PTH-sRNA-6 and PTH-sRNA-24) from traditional Chinese medicine Pianzaihu, the two small RNAs have inhibitory effect on lung cancer target genes, and have inhibitory effect on liver cancer cell proliferation, and can be used for preventing and / or treating liver cancer. Moreover, the composition of the two small RNAs in combination can effectively inhibit the growth of liver cancer cells, and has good preventive and / or therapeutic effect on liver cancer. Meanwhile, the two small RNAs of the present application can be effectively absorbed by ingestion and stably exist, and are convenient and effective to use. The two small RNAs of the present application can be used as markers for quality control of Pianzaihu, and the Pianzaihu with high content of the two small RNAs has better effect on treating liver cancer. The present application discovers small RNAs in Pianzaihu that are beneficial to treating liver cancer, which has important significance for further research and development and quality control of Pianzaihu.
Claims
1. A small RNA composition for treating liver cancer, characterized by: The small RNA composition is composed of two small RNA components with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.
2.
2. The small RNA composition according to claim 1, characterized in that: The molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.1 is 60-80%, and the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO.2 is 20-40%.
3. The small RNA composition according to claim 2, characterized in that: The molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO. 1 is 76-77%, and the molar percentage of the small RNA represented by the nucleotide sequence of SEQ ID NO. 2 is 23-24%.
4. The small RNA composition according to any one of claims 1 to 3, characterized in that: The molar ratio of the two small RNAs with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is 1:0.
3.
5. The method for preparing the small RNA composition according to any one of claims 1 to 4, characterized in that: The steps include: The two small RNAs with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2 are mixed to obtain the product.
6. Use of the small RNA composition according to any one of claims 1 to 4 in the preparation of a medicament for treating liver cancer.
7. The use according to claim 6, characterized in that: The drug is a drug that inhibits the proliferation of liver cancer cells and / or promotes the apoptosis of liver cancer cells.
8. The use according to claim 7, characterized in that: The drug is a drug that inhibits the expression of NDRG3, CUX1, CAT1 and SLC7A1 genes.
9. A drug for treating liver cancer, characterized in that: The drug is a preparation prepared by using the small RNA composition according to any one of claims 1 to 4 as an active ingredient and adding pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Pientzhuang and application of Pientzhuang preparation in preparation of tumor metastasis resisting medicine
CN104189037A
Oligomeric nucleic acid siRNA and application thereof in preparation of medicine for preventing and treating liver cancer
CN116286828A
Pharmaceutical composition for cancer prevention and treatment, containing NDRG3 expression or activity inhibitor as active ingredient, or NDRG3 protein-specific antibody and use thereof
US20170306047A1