Application of SlBIW gene in regulating tomato fruit shape

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of SlBIW gene in regulating tomato fruit shape, wherein the CDS sequence of the SlBIW gene is shown as SEQ ID NO. 1, the application is achieved by overexpressing or knocking out the SlBIW gene to affect the tomato fruit shape index, so as to realize the regulation of the tomato fruit shape, and the role of the encoded protein of the SlBIW gene in regulating the tomato fruit shape is also determined. The application also provides an engineering bacterium which can be used for regulating the tomato fruit shape, and a tomato plant with overexpressed or knocked out SlBIW gene is obtained, so that the regulation of the tomato fruit shape is realized.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to application of SlBIW gene in regulating tomato fruit shape. BACKGROUND

[0002] Tomato (Solanum lycopersicum) is a horticultural crop with high economic value and is widely planted worldwide. The fruit shape of tomato is one of its important appearance qualities, and consumers generally prefer flat-round fruits, while the processing industry prefers round or oval fruits due to their ease of large-scale harvesting and transportation. Research on tomato fruit shape and breeding of new varieties with more diverse fruit shapes can better meet market demand.

[0003] Tomato is a model plant for studying the growth and development of fleshy fruits. Through QTL mapping technology, many loci controlling tomato fruit shape have been identified, including SUN, OVATE, LOCULE-NUMBER (LC), and FASCIATED (FAS). IQD family protein SUN can bind calmodulin and further regulate cell division, promoting growth at the proximal and distal ends, resulting in longer fruits (Xiao et al., 2008, 2009; Wu et al., 2011). OVATE, on the other hand, acts as a negative regulator to inhibit fruit elongation. Mutations in OFP family proteins (OVATE Family Protein, OFP) with OVATE domains result in increased longitudinal cell number and decreased lateral cell number, leading to pear-shaped fruits. Further studies have shown that OVATE and OFP20 proteins of the OFP family can interact with TRM5 (TRM Recruiting Motif 5), forming an OFP-TRM protein complex that alters TRM5 cell localization, which may affect cell division and growth during early organ development, thereby regulating tomato fruit shape (Wu et al., 2015; Snoiffer et al., 2020; Zhang et al., 2023). LC and FAS have similar effects on regulating tomato fruit shape. In lc mutants, the promoter of the tomato WUSCHEL (WUS) homolog gene is mutated, preventing the binding of transcriptional repressor to WUS and increasing WUS expression. In fas mutants, the CLAVATA3 (CLV3) homolog gene is mutated, resulting in reduced CLV3 expression. Both mutations disrupt the balance of the WUS-CLV feedback pathway, affecting meristem activity and increasing the number of locules, resulting in larger, flatter fruits (Chu et al., 2019; Munos et al., 2011; Xu et al., 2015).

[0004] In the growth and development of fruits, many plant hormones are also directly or indirectly involved in the regulation of fruit shape. Exogenous application of auxin can significantly increase the expression level of SUN gene, affect the structure of cell microtubule, and make the ovary and fruit more slender. Auxin response factors (ARFs) are a class of transcription factors that can activate or inhibit the expression of auxin response genes. Studies have found that overexpression of SlARF10 can significantly inhibit the lateral growth of fruits, resulting in narrow and long fruit shape (Hendelman et al., 2012); while silencing of SlARF7 gene can accelerate cell expansion, resulting in heart-shaped tomato fruits (De Jone et al., 2011). Recently, the transcription factor SlBZR1.7 in the brassinosteroid (BR) signaling pathway was found to directly bind to the SUN gene promoter to regulate its expression. Overexpression of SlBZR1.7 results in longer fruits and fewer layers of pericarp. Analysis of BZR1 family members found that overexpression of SlBZR1.5 and SlBZR1.6 genes also has similar effects. Knockout of the above three genes results in flat and round fruits, while single mutation of any gene does not significantly change the fruit shape, indicating that BZR1 family genes have functional redundancy in regulating tomato fruit shape (Yu et al., 2022).

[0005] WD40 proteins are named for the WD-repeat in their structure, which was first found in the beta subunit of G protein (Fong et al., 1986) and is a special motif containing high glycoprotein. In plants, WD40 proteins are involved in many processes, such as secondary metabolism, immune response, abiotic stress response, growth and development, and light signal perception. The WD40 protein LUG can specifically regulate the expression of the flower organ determination gene AGAMOUS (AG). The AG gene in LUG deletion mutants will be expressed in the outer two rounds of flowers, causing sepal transformation into carpels, corolla transformation into stamens, and other abnormal phenomena such as reduced fertility and stigma cracking (Liu et al., 1995; Guan et al., 2018), which further affects fruit quality and yield. WD40 proteins can also form MBW complexes with R2R3-MYB proteins and bHLH proteins, and regulate anthocyanin synthesis in plants (Colanero et al., 2018). Currently, research on the influence of WD40 proteins on reproductive growth in tomato mainly focuses on flower organ development and metabolite synthesis in fruits, and there is no report on how they regulate tomato fruit shape. SUMMARY

[0006] The application aims to provide a technical method for regulating the shape of tomato fruits by changing the function of genes, and provide a reference for enriching the types of tomato fruit shapes.

[0007] In a first aspect, the application provides an application of a SlBIW gene in regulating the shape of tomato fruits, wherein the CDS sequence of the SlBIW gene is shown as SEQ ID NO. 1.

[0008] In a second aspect, the application provides an application of a protein encoded by a SlBIW gene in regulating the shape of tomato fruits, wherein the amino acid sequence of the protein encoded by the SlBIW gene is shown as SEQ ID NO. 2.

[0009] In a third aspect, the application provides an engineered bacterium comprising a vector for editing a SlBIW gene, wherein the CDS sequence of the SlBIW gene is shown as SEQ ID NO. 1, and the editing comprises knock-out and overexpression of the gene.

[0010] In a fourth aspect, the application provides an application of the engineered bacterium in regulating the shape of tomato fruits.

[0011] Further, the engineered bacterium can regulate the fruit shape index of tomatoes.

[0012] Further, the application approaches are one of the following:

[0013] (1) overexpressing the SlBIW gene to reduce the fruit shape index of tomatoes, so as to obtain fruits with a flat round shape;

[0014] (2) knocking out the SlBIW gene to increase the fruit shape index of tomatoes, so as to obtain fruits with an oval shape.

[0015] Further, the method for overexpressing the SlBIW gene is:

[0016] (1) designing a primer sequence using wild-type tomato cDNA as a template, cloning the SlBIW gene, and constructing an overexpression vector of the SlBIW gene;

[0017] (2) transforming the vector into competent cells of Agrobacterium to obtain Agrobacterium overexpressing the SlBIW gene;

[0018] (3) using Agrobacterium containing the SlBIW gene overexpression vector to infect the cotyledon of a common wild-type tomato, and obtaining a seedling by tissue culture, and screening to obtain an overexpression plant of the SlBIW gene.

[0019] Further, the cloned SlBIW gene is connected to a pFGC1008-HA vector to obtain an overexpression vector driven by a strong promoter.

[0020] Further, the common wild type tomato variety is Condine Red.

[0021] Further, the method for knocking out the SlBIW gene is:

[0022] (1) According to the SlBIW genome sequence, a target sequence sgRNA is designed, and a CRISPR / Cas9 vector for tomato SlBIW gene editing is constructed;

[0023] (2) The vector is transferred into an agrobacterium competent cell to obtain an agrobacterium containing the SlBIW gene editing CRISPR / Cas9 vector;

[0024] (3) The cotyledon of the common wild type tomato is infected by the agrobacterium containing the SlBIW gene editing CRISPR / Cas9 vector, and a seedling is reobtained through tissue culture, and a genetically stable homozygous SlBIW gene deletion mutant is screened.

[0025] Further, the target sequence sgRNA includes sgRNA-1, sgRNA-2, sgRNA-3, sgRNA-4, the nucleotide sequence of the sgRNA-1 is shown as SEQ ID NO. 6, the nucleotide sequence of the sgRNA-2 is shown as SEQ ID NO. 7, the nucleotide sequence of the sgRNA-3 is shown as SEQ ID NO. 8, and the nucleotide sequence of the sgRNA-4 is shown as SEQ ID NO. 9.

[0026] Further, the common wild type tomato variety is Condine Red.

[0027] Compared with the prior art, the present application has the following beneficial effects:

[0028] (1) The present application discloses the function of SlBIW gene and its encoded protein in regulating the fruit shape of tomato, which provides a reference for the cultivation of new varieties.

[0029] (2) The present application constructs transgenic tomato plants with overexpression and gene knockout of SlBIW gene, and realizes the regulation of tomato fruit shape. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 The western blot detection result of the SlBIW gene overexpression plant is shown in the figure. Among them, WT is the common wild type tomato variety Condine Red, OE-SlBIW is the SlBIW gene overexpression plant, the RuBisCO content is used to indicate the determination of the loading amount, and anti-HA indicates that the OE-SlBIW plant contains HA-tagged overexpression BIW protein.

[0031] Figure 2 Gene editing sites and amino acid changes of homozygous mutant plants of SlBIW gene knockout. Among them, WT is the ordinary wild type tomato variety Condine Red, biw is the SlBIW gene knockout mutant.

[0032] Figure 3 It is a SlBIW gene expression pattern diagram. Among them, L is a leaf, R is a root, S is a stem, F is a flower, MG is a fruit green ripening period, BK is a fruit breaking color period, B+1 / +3 / +5 / +7 are the 1st / 3rd / 5th / 7th day after breaking color, and ACTIN is selected as the internal reference gene.

[0033] Figure 4 Tomato fruit phenotype (A), fruit shape index (B) and fruit shoulder angle (C), wherein WT is wild type tomato, biw is SlBIW deletion mutant tomato, and OE-SlBIW is SlBIW gene overexpression tomato. The experiment adopts a completely randomized design, sets three replicates, and the data is analyzed by SAS software (ANOVA), and the significant difference is indicated by different number of asterisks (*, P<0.05; ***, P<0.005). DETAILED DESCRIPTION

[0034] In order to make the person skilled in the art better understand the scheme of the present application, the technical scheme of the present application will be described clearly and completely in combination with specific examples. It should be pointed out that the following detailed description is exemplary and only a part of the embodiments of the present application, but not all the embodiments.

[0035] Based on the examples in the present application, all other examples obtained by the person skilled in the art without making creative efforts shall belong to the scope of protection of the present application.

[0036] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as generally understood by the person skilled in the art to which the present application belongs. The experimental materials used in the embodiments of the present application are all conventional experimental materials in the art, and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out according to the conventional experimental methods or according to the operation instructions recommended by the supplier.

[0037] The CDS sequence of SlBIW gene in the present application is shown as SEQ ID NO. 1, the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2, and the genomic sequence of SlBIW gene is shown as SEQ ID NO. 3.

[0038] SEQ ID NO. 1:

[0039]

[0040] SEQ ID NO. 2:

[0041] MDKKKVVAPLVCHGHSRPVVDLSYSPITPDGFFLISASKDSTPMLRNGETGDWIGTFEGHKGAVWSCCLDKHALRAASASADFSAKLWDALTGDVLHSFDHKHIVRACAFSEDTNLLLTGGFEKILRIFDLNRPDAPPREIDSSPGSVRTVAWLHSDQTILSSSGDAGGLRLWDVRTGKVVQILETKFPVTSAEVSQDGRYITTADGSSVKFWDANHFGLVKSHELPCKVESASLEPKFGNRFIAGGEDMWVHVFDFHTGEEIGCNKGHHGPVHCLRFSPGGESYASGSEDGTIRIWQLGPLGQIEDNSTANGSTTANANDGMGEVTQKIDELAVSETKKKEETQVDGVEQKVVDA*.

[0042] SEQ ID NO. 3:

[0043]

[0044] Obtaining and identification of SlBIW gene overexpression plant

[0045] 1. Construction of SlBIW gene overexpression vector and obtaining of Agrobacterium containing gene editing vector

[0046] The full-length CDS sequence of SlBIW gene (as shown in SEQ ID NO. 1) was obtained by searching the SGN website (http: / / solgenomics.net), and AscI and KpnI were selected as the enzyme cutting sites. Specific homologous recombination primers HA-BIW-F (nucleotide sequence as shown in SEQ ID NO. 4) and HA-BIW-R (nucleotide sequence as shown in SEQ ID NO. 5) were designed by using CE design, and wild type tomato cDNA was used as a template for PCR amplification.

[0047] The overexpression vector pFGC1008-HA was cut by restriction enzymes AscI and KpnI. The PCR product and the cut vector were purified and ligated by homologous recombination enzyme at 37°C for 30 min.

[0048] Subsequently, the ligation product was transformed into tran5α E. coli by heat shock at 42°C for 90s, and single colonies were picked for electrophoresis verification and sequencing verification. The sequencing sequence is shown in SEQ ID NO. 4 and SEQ ID NO. 5. The successfully constructed SlBIW overexpression vector was transformed into Agrobacterium GV3101 by 2.5Kv electroporation.

[0049] 2. Obtaining of SlBIW gene overexpression plant

[0050] After the wild type tomato Condine Red (CR) seeds were sterilized and sown in the medium, they were cultured in the dark until the seeds germinated, and then transferred to light for one week. After the cotyledon emerged, the cotyledon was cut and placed in KC medium for 24h recovery in the dark.

[0051] The constructed Agrobacterium was inoculated in 25mL liquid medium, and cultured until OD 600 = 0.8-1.0, then centrifuged at 4°C, 4000rpm for 5min, the supernatant was discarded, and MS0.2 infection liquid was added for resuspension.

[0052] The cotyledon on the KC medium was placed in the resuspended Agrobacterium, and infected for 2min. After the remaining bacterial liquid on the surface of the cotyledon explant was absorbed, it was placed on the care medium for a total of 24h culture, then transferred to 2Z medium for dedifferentiation, and induction of callus production. After 2-3 weeks, it was transferred to 0.2Z medium for induction of germination, and until small seedlings emerged, it was transferred to R medium for induction of rooting.

[0053] 3. Verification of SlBIW gene overexpression plant

[0054] Take 0.05 g of plant material in a 2 mL centrifuge tube, freeze in liquid nitrogen and grind into powder, add 0.2 mL of 2x loading buffer [250 mM Tris-HCl, pH 6.8, 10% (w / v) SDS, 0.5% (w / v) bromophenol blue, 50% (v / v) glycerol, 10 mM DTT], vortex well, denature at 95°C for 10 min. Use SDS-PAGE to separate proteins, use Anti-HA antibody to detect SlBIW overexpression protein by western blot, and the positive plants have obvious bands at 45 kDa. The results are shown in Figure 2, and the OE-SlBIW plants have overexpression BIW protein carrying HA tag. Figure 1

[0055] SEQ ID NO. 4:

[0056] TTACAATTACCATGGGGCGCGCCATGGATAAGAAGAAAGTTGTGGCA.

[0057] SEQ ID NO. 5:

[0058] AACATCGTATGGGTAGGTACCGGCATCAACTACCTTCTGCTCC.

[0059] Example 2. Obtaining and identifying SlBIW gene deletion mutant

[0060] 1. Construction of SlBIW gene CRISPR / Cas9 gene editing vector and transformation of Agrobacterium

[0061] The genomic sequence of tomato SlBIW gene is found on the SGN website https: / / solgenomics.net / and is shown as SEQ ID NO. 3, which is input into http: / / crispr.hzau.edu.cn / CRISPR2 / , 2 target points are selected, and target sequences are designed as primer sequences according to the rules, and the sequences are shown as SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, and SEQ ID NO. 9.

[0062] pHEE401 is cleaved by Bas I restriction endonuclease. The PCR product and the cleaved vector are purified, and NEB Golden Gate Assembly Mix is used to connect the fragments. The subsequent transformation process is the same as described in Example 1.

[0063] 2. Obtaining of SlBIW gene deletion mutant ​

[0064] The tissue culture process was the same as described in Example 1.

[0065] 3. Verification of SlBIW gene deletion mutant

[0066] A small amount of leaf of T0 generation plant was taken to extract genomic DNA, which was used as a template for PCR and sequence alignment. The plants with mutations at the target site were self-crossed to obtain T0 generation seeds. After sowing the T0 generation seeds, T1 generation plants were obtained, and the same method was used for verification. Homozygous lines were screened for phenotype observation and data measurement. The primer sequence for verification is shown in SEQ ID NO. 10 and SEQ ID NO. 11. The results are shown in Figure 2 The biw had a deletion of 5 bases at the gene editing target site, resulting in premature termination of translation.

[0067] SEQ ID NO. 6:

[0068] CTGGTCTCTATTGAACAAAGCACCAGTGGTCTAGTG.

[0069] SEQ ID NO. 7:

[0070] CTGGTCTCTATGGCAAACAAGCGGTGCCATGCACCAGCCGGGAA.

[0071] SEQ ID NO. 8:

[0072] GCTGGTCTCTCCATGTTTTAGAGCTAGAAATAGCAAGTTA.

[0073] SEQ ID NO. 9:

[0074] GCTGGTCTCTAAACTCAGGAGTGATTGGACTGTATGCACCAGCCGGGAATCG.

[0075] SEQ ID NO. 10;

[0076] TGTTGAATCGAGATGAAT.

[0077] SEQ ID NO. 11:

[0078] TCAAACAAAGTGCAACAG.

[0079] Example 3 SlBIW gene expression pattern analysis

[0080] 1. Plant RNA extraction: Liquid nitrogen was used to grind the tomato tissue samples, and the plant total RNA extraction kit (RNA preppure Plant Kit, Tiangen) was used to extract the RNA according to the instructions.

[0081] 2. cDNA synthesis: The concentration of the extracted RNA was determined using a Nano Drop 2000 spectrophotometer, and then the synthesis of cDNA was performed using a reverse transcription kit (HiScript IIQ RT SuperMix for qPCR, Vazyme).

[0082] 3. Gene expression detection: Real-time fluorescent quantitative PCR (qRT-PCR) was used, and the SYBR (ChamQUniversal SYBR qPCR Master Mix, Vazyme) mixed reaction system was used. The specific method is described in the instructions, and the detection instrument is a Light Cycler 480II real-time PCR instrument (Roche, CH). Actin was selected as the internal reference gene, and the relative expression amount was analyzed by the 2-△△Ct method, as described in (Livak et al., 2001). The gene and Actin primer sequences are shown in SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, and SEQ ID NO. 15. The results are shown in Figure 3 SlBIW gene was expressed in the roots, stems, leaves, flowers, and fruits of tomato.

[0083] SEQ ID NO. 12:

[0084] CTGTTTGCGGTTCTCTCCTG.

[0085] SEQ ID NO. 13:

[0086] TTGGGTCACCTCACCCATAC.

[0087] SEQ ID NO. 14:

[0088] CTGTTTGCGGTTCTCTCCTG.

[0089] SEQ ID NO. 15:

[0090] TTGGGTCACCTCACCCATAC.

[0091] Example 4: Tomato fruit shape observation of SlBIW gene overexpression plants and deletion mutants

[0092] Seeds of wild-type tomato (WT), the SlBIW gene deletion mutant biw, and the SlBIW gene overexpression plant OE-SlBIW were disinfected with potassium permanganate and then immersed in Erlenmeyer flasks filled with water. Germination was carried out at 28℃ and 200 rpm for 2 days. When the radicle of the seed showed signs of sprouting (0.5–1 cm), the seeds were sown into 72-cell trays (peat moss:vermiculite ratio 3:1) and placed in a light source with an intensity of 200 μmol / m². -2 s -1 The plants are cultivated in a plant factory with a photoperiod of 12h / 12h, a day / night temperature of 25℃ / 20℃, and a relative humidity of 70%–80%, and watered with Hoagland nutrient solution 2–3 times a week. When the seedlings have grown to 3 leaves and 1 bud, the plants are transferred to nutrient pots and placed in the plant factory for continued cultivation until fruiting.

[0093] After the fruit enters the late stage of color breaking, the fruit is longitudinally cut and photographed for record-keeping. The result is as follows: Figure 4 As shown in A, compared with the wild type, OE-SlBIW has a more oblate fruit shape and a smaller fruit shape index; the biw phenotype is the opposite, with a more elliptical fruit shape and a larger fruit shape index.

[0094] Image-J was used to analyze the images, measuring the fruit shoulder angle and the fruit's horizontal and vertical lengths to calculate the fruit shape index. For example... Figure 4 As shown in Figure B, the average included angle of the biw type is 77.52°, and the included angle of the OE-SlBIW type is 47.80°. Statistical results show that both are significantly different from the wild type. Figure 4 As shown in C, the fruit shape index of biw was 0.87, WT was 0.78, and OE-SlBIW was 0.59. Both OE-SlBIW and biw showed significant differences from the wild type.

[0095] Based on the above embodiments, it can be seen that the present invention has discovered a new gene SlBIW that can effectively regulate the shape of tomato fruit. Knocking out SlBIW results in a more oval tomato fruit shape, while overexpressing SlBIW produces the opposite phenotype with a flatter fruit shape.

Claims

1. SlBIW The application of genes in regulating tomato fruit shape is characterized by: The SlBIW The CDS sequence of the gene is shown in SEQ ID NO.1; The application can be carried out in one of the following ways: (1) Through overexpression SlBIW Genes can be used to reduce the tomato fruit shape index, resulting in flattened, round fruits. (2) By knocking out SlBIW Genes can be used to increase the tomato fruit shape index, resulting in oval-shaped fruits.

2. As described in claim 1 SlBIW The application of gene-encoded proteins in regulating tomato fruit shape, characterized by: The SlBIW The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.2; The application can be carried out in one of the following ways: (1) Through overexpression SlBIW Genes can be used to reduce the tomato fruit shape index, resulting in flattened, round fruits. (2) By knocking out SlBIW Genes can be used to increase the tomato fruit shape index, resulting in oval-shaped fruits.

3. The application of an engineered bacterium in regulating the shape of tomato fruits, characterized in that: The engineered bacteria contain editing... SlBIW The vector of the gene, the SlBIW The CDS sequence of the gene is shown in SEQ ID NO.1; The application can be carried out in one of the following ways: (1) Through overexpression SlBIW Genes can be used to reduce the tomato fruit shape index, resulting in flattened, round fruits. (2) By knocking out SlBIW Genes can be used to increase the tomato fruit shape index, resulting in oval-shaped fruits.

4. The application according to claim 3, characterized in that: The engineered bacteria can regulate the tomato fruit shape index.

5. The application according to claim 3, characterized in that: The overexpression SlBIW The genetic approach is as follows: (1) Primer sequences were designed using wild-type tomato cDNA as a template, and a primer system was constructed. SlBIW Gene overexpression vectors; (2) The vector was transferred into Agrobacterium competent cells to obtain overexpression. SlBIW Agrobacterium gene; (3) Utilizing SlBIW Agrobacterium, using a gene overexpression vector, infected the cotyledons of Condine Red, a common wild-type tomato. Seedlings were then regenerated through tissue culture and selected. SlBIW Plants that overexpress the gene.

6. The application according to claim 3, characterized in that: The knockout SlBIW The genetic approach is as follows: (1) According to SlBIW Genome sequence, design of target sequence sgRNA, construction of tomato SlBIW Gene-editing CRISPR / Cas9 vectors; (2) The vector was transferred into Agrobacterium competent cells to obtain cells containing... SlBIW Agrobacterium for gene editing CRISPR / Cas9 vectors; (3) Utilizing SlBIW Agrobacterium, using a gene-editing CRISPR / Cas9 vector, infected the cotyledons of CondineRed, a common wild-type tomato. Seedlings were then regenerated through tissue culture, and genetically stable homozygous individuals were selected. SlBIW Gene deletion mutant.

7. The method according to claim 6, characterized in that: The target sequence sgRNA includes sgRNA-1, sgRNA-2, sgRNA-3, and sgRNA-4. The nucleotide sequence of sgRNA-1 is shown in SEQ ID NO.6, the nucleotide sequence of sgRNA-2 is shown in SEQ ID NO.7, the nucleotide sequence of sgRNA-3 is shown in SEQ ID NO.8, and the nucleotide sequence of sgRNA-4 is shown in SEQ ID NO.9.

Images