InDel molecular marker for identifying hangnuo yu 21 glutinous corn variety and application thereof
By developing InDel molecular markers and PCR amplification technology, the problem of low accuracy in maize variety identification was solved, enabling rapid and accurate identification of the Hangnuoyu 21 variety, overcoming environmental influences, and improving detection efficiency.
Patent Information
- Application Number
- CN202410127297.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-30
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-01-30
AI Technical Summary
Existing technologies for maize variety identification suffer from low accuracy, are greatly affected by external environmental factors, and are time-consuming and labor-intensive, especially lacking specificity studies for the Hangnuoyu 21 variety.
A set of InDel molecular markers was developed. By designing PCR primer pairs for specific InDel sites, the authenticity of the Hangnuoyu 21 variety was identified using PCR amplification and gel electrophoresis. InDel site detection reagents and primer combinations were provided for detecting the insertion or deletion of InDel sites.
This method enables rapid and accurate identification of the Hangnuoyu 21 variety at the genomic level, avoiding environmental impact, saving manpower and resources, and improving detection efficiency and accuracy.
Smart Images

Figure CN117821656B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of corn variety identification, and particularly relates to an InDel molecular marker for identifying Hangnuo 21 waxy corn variety and application thereof. BACKGROUND
[0002] Corn (Zea mays L.) is an important food crop, which has an important influence on China's food security and economic development. Corn has the functions of regulating the stomach, benefiting the lungs and calming the heart, clearing damp heat, benefiting the liver and gallbladder, and delaying aging, and has a high nutritional value and health care effect.
[0003] Corn germplasm is a material carrier for breeding excellent corn hybrids and developing corn production. In the evolution process of corn over thousands of years, extremely rich genetic germplasm has been formed. Improvement and innovation of corn germplasm has become one of the development directions of world corn breeding. Effective identification of corn varieties has important practical significance for corn variety breeding, testing, quality and market management, and property right protection.
[0004] In the conventional breeding work and traditional agricultural production practice, the main identification method for corn varieties is phenotypic statistical identification, such as plant height, plant shape, ear position, etc. This statistical method has played a huge role in the past work, but there is also a lot of instability. The phenotype of corn is easily affected by external environmental factors such as temperature, moisture, and light, which can cause inaccurate plant phenotypes. At the same time, the phenotype of plants has universality, that is, a characteristic phenotype of one corn variety may be reproduced in another multiple varieties. In order to improve the accuracy of identification, it is necessary to statistically analyze multiple phenotypic results, which consumes a lot of manpower and material resources, and the accuracy is not high enough. At present, the above method has been unable to meet the needs of corn variety identification.
[0005] With the increasing maturity of molecular biology technology, it is of great significance to use molecular biology technology to analyze the genotype of corn germplasm resources from the genome level, develop molecular markers that can be used for specific analysis, improve the utilization efficiency of corn germplasm resources, and explore excellent genes, and promote the application and development of molecular marker-assisted selection breeding technology.
[0006] Insertion / Deletion (InDel) refers to the difference between two parents in the whole genome, that is, a certain number of nucleotides are inserted or deleted in the genome of one parent compared with the other parent. According to the insertion / deletion site in the genome, PCR primers amplifying these insertion / deletion sites, i.e. InDel markers, are designed. InDel markers are widely distributed in the genome with high density, which is suitable for the exploration of whole genome molecular markers. As a high-throughput molecular marker, InDel has the advantages of various genetic markers, such as higher accuracy, stable variation, easy typing, and simple detection.
[0007] Hangnu Yuyu 21 (Zheping Yuyu 2019002) is a waxy corn variety, the variety source is N-21 x TN789, the plant type is semi-compact, the upper leaves are lush, the plant height is 211.0 cm, the ear position height is 84.5 cm, the double ear rate is 0.4%, the empty stalk rate is 0.2%, the lodging rate is 1%, and the folding rate is 0.0%; the ear is larger, conical, and the grain is white. The plant of the variety is moderate, the quality is excellent, the small spot disease is moderately resistant, the large spot disease is resistant and the sheath blight is susceptible, and it is suitable for planting in Zhejiang region.
[0008] At present, the specific research of Hangnu Yuyu 21 variety has not been carried out. Therefore, it is necessary to develop new molecular markers, so as to strengthen the protection of Hangnu Yuyu 21 variety, and at the same time, applied to Hangnu Yuyu 21 seed purity detection to improve the test efficiency. SUMMARY
[0009] The purpose of the present application is to provide a group of InDel molecular markers for identifying Hangnu Yuyu 21 and its application, to lay a technical foundation for simple, rapid, efficient and accurate identification of the authenticity of Hangnu Yuyu 21, and to provide sequence and InDel site information for in-depth research of Hangnu Yuyu 21 based on molecular biology technology.
[0010] In order to achieve the above purpose, the present application provides the following technical scheme:
[0011] The present application provides the application of InDel site detection reagent in identifying Hangnu Yuyu 21 variety, the reagent is used for detecting at least one InDel site in the following Indel01-Indel37 sites,
[0012] The Indel01 site is located in the deletion of TCTCCACGCAGAGAAGCGCCTACGCCGTCTCAGCGGAGGCATCCA fragment at the position of 74327965 of chromosome 8 in B73-V5 genome;
[0013] The Indel02 site is located in the deletion of TACTAAGTCGATGGAACC fragment at the position of 205618420 of chromosome 5 in B73-V5 genome;
[0014] The Indel03 site is located in the deletion of CATGCGGGCATAGTAAATGTATGAGGAGATCCACCTC fragment at the position of 224380350 of chromosome 5 in B73-V5 genome;
[0015] The Indel04 site is located in the deletion of GCTTGGGTGTCATCATGCGTGAAGCAAA fragment at the position of 21302050 of chromosome 10 in B73-V5 genome.
[0016] The Indel05 site is a deletion of a GAGCAAGAGTTGGGA fragment at position 151363532 on chromosome 7 in the B73-V5 genome;
[0017] The Indel06 site is an insertion of a GCTGCGATGAAACTTTACTT fragment at position 32571190 on chromosome 3 in the B73-V5 genome;
[0018] The Indel07 site is a deletion of a TTGGTGTGCATATGAAGGTCTAGGAGCTCCTTCCTACAATAACAGTATGCTAAGCAGGAA CTGTGCAGCTATCTCAAATGCCAAAAGATTGGCTCGGCAT fragment at position 59957178 on chromosome 2 in the B73-V5 genome;
[0019] The Indel08 site is an insertion of a TTTGCACTCTAACTCTTTCTATAGAAAACA fragment at position 237399322 on chromosome 2 in the B73-V5 genome;
[0020] The Indel09 site is a deletion of an ATAAAGTACCAAAAAGAAAATAATTATTGGAGAGAGTGGGGGTGCAAGCGGTAT fragment at position 9520388 on chromosome 1 in the B73-V5 genome;
[0021] The Indel10 site is a deletion of an AACCACTCTGCAAACAGCCTCGCAGGTCACGGCCAGCAGGGACAGCCGC fragment at position 40513192 on chromosome 1 in the B73-V5 genome;
[0022] The Indel11 site is a deletion of a TAATTAAGGATGACG fragment at position 152997579 on chromosome 9 in the B73-V5 genome;
[0023] The Indel12 site is an insertion of a CCAGCGGCAGCAGCAGCG or CCCAGCAGCAGCAGCAGCG fragment at position 120261605 on chromosome 8 in the B73-V5 genome;
[0024] The Indel13 site is a deletion of an AGCC fragment at position 139994638 on chromosome 3 in the B73-V5 genome;
[0025] The Indel 14 site is a deletion of the TAATTAAGGATGACG fragment at position 152997579 on chromosome 9 in the B73-V5 genome;
[0026] The Indel 15 site is an insertion of the GATAAACAGACCCTTAGTGGTTTTGTTTTCTCAAGCAAAGCTCATTA fragment at position 21540354 on chromosome 1 in the B73-V5 genome;
[0027] The Indel 16 site is a deletion of the GACTACACATAACAAA fragment at position 63055748 on chromosome 10 in the B73-V5 genome;
[0028] The Indel 17 site is a deletion of the CACGGAACACGAATGACCCTGGAGCTTGGTGGCCCTCGTGAGGGTGAACAAAAGCTAA AGGATA fragment at position 307473335 on chromosome 1 in the B73-V5 genome;
[0029] The Indel 18 site is a deletion of the AATTTATAACTCTAGTACTGATGTTCTGCGTTAGATTA fragment at position 182101444 on chromosome 3 in the B73-V5 genome;
[0030] The Indel 19 site is a deletion of the TTTGCTCTTATAAATGATTGCAATTCTTCTCACATCA fragment at position 216292025 on chromosome 3 in the B73-V5 genome;
[0031] The Indel 20 site is a deletion of the TATATATAAACTAGGTCTAAACGGGACTAAAAACCAGGATCAAATGG fragment at position 155788155 on chromosome 6 in the B73-V5 genome;
[0032] The Indel 21 site is a deletion of the TTGCTCACCTGACCTGGTGTT fragment at position 162110398 on chromosome 7 in the B73-V5 genome;
[0033] The Indel 22 site is a deletion of the TAGTGATGATGGTCATTGTATATGTATTTCGTATGG fragment at position 136624473 on chromosome 9 in the B73-V5 genome;
[0034] The Indel23 site is a deletion of the ACCACTGAATAATATGATCCTGGCATTACGTACTTCTG fragment at position 96464136 on chromosome 7 in the B73-V5 genome;
[0035] The Indel24 site is an insertion of the TGATGATAGCAACCTCCGCTGCAATCAGAGAGTAAATCAGTCAGCATTT fragment at position 115594787 on chromosome 9 in the B73-V5 genome;
[0036] The Indel25 site is an insertion of the GACTCTATTCTAGCTCCAGTGTGGA fragment at position 160669715 on chromosome 9 in the B73-V5 genome;
[0037] The Indel26 site is a deletion of the TGTCTCCTTATCTTTCTTGAAAAAACA fragment at position 24353821 on chromosome 5 in the B73-V5 genome;
[0038] The Indel27 site is a deletion of the GTTTTCTTGTGATATTCCGAAAACTAAAACAAGAGCTCTATGAGCACAGGATACGTTCCC fragment at position 9484027 on chromosome 1 in the B73-V5 genome;
[0039] The Indel28 site is an insertion of the AAGGCCGAGGGCGTCCATCACTTTATCTTC fragment at position 178211126 on chromosome 3 in the B73-V5 genome;
[0040] The Indel29 site is a deletion of the GCAGAGGCCACTGTTCTTAAGGCGTCGCCTATGCGTCCAGGCGGAGGTCCAACT fragment at position 87599950 on chromosome 8 in the B73-V5 genome;
[0041] The Indel30 site is an insertion of the GCTATAGGGTCATTAGACCATGTGAACAATTGTATCTAGGGTTTTA fragment at position 65475938 on chromosome 4 in the B73-V5 genome;
[0042] The Indel31 site is an insertion of a CTGAGGTATGACCAGTAATCTATCCATACTACTATATAATTTACTAGATTA or GACTGAGGTATGACCAGTAATCTATCCATACCACTATATAATTTACTAGATTA fragment at position 205849549 of chromosome 4 in the B73-V5 genome;
[0043] The Indel32 site is an insertion of a TTACAGTATTTGCCAATAATATAAAATTATTAATTATCACC fragment at position 178804799 of chromosome 2 in the B73-V5 genome;
[0044] The Indel33 site is a deletion of an ATTTAATCCCTAAATTACCAAACGGTGAG fragment at position 224929148 of chromosome 5 in the B73-V5 genome;
[0045] The Indel34 site is an insertion of a CATATATATTAGGCTCACCAGTGGAGAAATGGG fragment at position 156447947 of chromosome 6 in the B73-V5 genome;
[0046] The Indel35 site is a deletion of a GTGCGAGCTCTACATGCTGCCTATGCAA fragment at position 165282119 of chromosome 6 in the B73-V5 genome;
[0047] The Indel36 site is a deletion of a TAATATAGTATAAAATCGGATGGCATACCAGGAATTTTTCC fragment at position 29261210 of chromosome 7 in the B73-V5 genome;
[0048] The Indel37 site is an insertion of a GAAATAAGAGGGCACGACGCACGCGC fragment at position 144364593 of chromosome 7 in the B73-V5 genome;
[0049] The B73-V5 genome is Genbank database: GCA_902167145.1.
[0050] The above Indel molecular marker is a co-dominant marker, and the present application uses an InDel site detection reagent to analyze whether the above Indel molecular marker is present in a sample to be identified to identify whether it is the Hangnuo Yu 21 corn variety.
[0051] Further, the InDel site detection reagent comprises a PCR primer pair for amplifying the DNA fragment comprising the InDel site. Specifically, the application comprises: designing a PCR primer pair according to the sequence flanking the InDel site, and then using the primer pair to perform PCR amplification with the genomic DNA of the sample to be identified as a template, such as the amplification product of the sample to be identified comprising two amplification products of different molecular weights (derived from the father and the mother, respectively), and the difference in molecular weight corresponds to the fragment inserted or deleted in the InDel site, then judging that the sample to be identified is the Hangnuoyu 21 variety.
[0052] Further, the DNA fragment comprising the InDel site is a fragment of 100-800 bp selected from the upstream and downstream of the InDel site.
[0053] The application also provides a primer combination for detecting the InDel site, comprising any one or more of primer groups 1-31,
[0054] The primer group 1 comprises: a primer pair as shown in SEQ ID NO. 1-2 for amplifying the Indel01 site; a primer pair as shown in SEQ ID NO. 3-4 for amplifying the Indel02 site;
[0055] The primer group 2 comprises: a primer pair as shown in SEQ ID NO. 5-6 for amplifying the Indel03 site; a primer pair as shown in SEQ ID NO. 7-8 for amplifying the Indel04 site;
[0056] The primer group 3 comprises: a primer pair as shown in SEQ ID NO. 9-10 for amplifying the Indel05 site; a primer pair as shown in SEQ ID NO. 11-12 for amplifying the Indel06 site;
[0057] The primer group 4 comprises: a primer pair as shown in SEQ ID NO. 13-14 for amplifying the Indel07 site; a primer pair as shown in SEQ ID NO. 15-16 for amplifying the Indel08 site;
[0058] The primer group 5 comprises: a primer pair as shown in SEQ ID NO. 17-18 for amplifying the Indel09 site; a primer pair as shown in SEQ ID NO. 19-20 for amplifying the Indel10 site;
[0059] The primer set 6 comprises: a primer pair as shown in SEQ ID NO. 21-22 for amplifying the Indel11 site; a primer pair as shown in SEQ ID NO. 23-24 for amplifying the Indel12 site;
[0060] The primer set 7 comprises: a primer pair as shown in SEQ ID NO. 25-26 for amplifying the Indel13 site;
[0061] The primer set 8 comprises: a primer pair as shown in SEQ ID NO. 27-28 for amplifying the Indel14 site;
[0062] The primer set 9 comprises: a primer pair as shown in SEQ ID NO. 29-30 for amplifying the Indel15 site;
[0063] The primer set 10 comprises: a primer pair as shown in SEQ ID NO. 31-32 for amplifying the Indel16 site;
[0064] The primer set 11 comprises: a primer pair as shown in SEQ ID NO. 33-34 for amplifying the Indel17 site;
[0065] The primer set 12 comprises: a primer pair as shown in SEQ ID NO. 35-36 for amplifying the Indel18 site;
[0066] The primer set 13 comprises: a primer pair as shown in SEQ ID NO. 37-38 for amplifying the Indel19 site;
[0067] The primer set 14 comprises: a primer pair as shown in SEQ ID NO. 39-40 for amplifying the Indel20 site;
[0068] The primer set 15 comprises: a primer pair as shown in SEQ ID NO. 41-42 for amplifying the Indel21 site;
[0069] The primer set 16 comprises: a primer pair as shown in SEQ ID NO. 43-44 for amplifying the Indel22 site;
[0070] The primer set 17 comprises: a primer pair as shown in SEQ ID NO. 45-46 for amplifying the Indel23 site;
[0071] The primer set 18 comprises: a primer pair as shown in SEQ ID NO. 47-48 for amplifying the Indel24 site;
[0072] The primer set 19 comprises: a primer pair as shown in SEQ ID NO. 49-50 for amplifying Indel25 site;
[0073] The primer set 20 comprises: a primer pair as shown in SEQ ID NO. 51-52 for amplifying Indel26 site;
[0074] The primer set 21 comprises: a primer pair as shown in SEQ ID NO. 53-54 for amplifying Indel27 site;
[0075] The primer set 22 comprises: a primer pair as shown in SEQ ID NO. 55-56 for amplifying Indel28 site;
[0076] The primer set 23 comprises: a primer pair as shown in SEQ ID NO. 57-58 for amplifying Indel29 site;
[0077] The primer set 24 comprises: a primer pair as shown in SEQ ID NO. 59-60 for amplifying Indel30 site;
[0078] The primer set 25 comprises: a primer pair as shown in SEQ ID NO. 61-62 for amplifying Indel31 site;
[0079] The primer set 26 comprises: a primer pair as shown in SEQ ID NO. 63-64 for amplifying Indel32 site;
[0080] The primer set 27 comprises: a primer pair as shown in SEQ ID NO. 65-66 for amplifying Indel33 site;
[0081] The primer set 28 comprises: a primer pair as shown in SEQ ID NO. 67-68 for amplifying Indel34 site;
[0082] The primer set 29 comprises: a primer pair as shown in SEQ ID NO. 69-70 for amplifying Indel35 site;
[0083] The primer set 30 comprises: a primer pair as shown in SEQ ID NO. 71-72 for amplifying Indel36 site;
[0084] The primer set 31 comprises: a primer pair as shown in SEQ ID NO. 73-74 for amplifying Indel37 site.
[0085] The application provides application of the primer combination in identifying Hangnu Yuyu 21 varieties.
[0086] The application further provides a method for identifying authenticity of Hangnu Yuyu 21 varieties based on InDel sites, and the method comprises the following steps:
[0087] 1) designing primer pairs according to the flanking sequences of the InDel sites;
[0088] 2) extracting genomic DNA of the corn material to be identified;
[0089] 3) performing PCR amplification reaction on the genomic DNA of the material to be identified according to the primer pairs in step 1) to obtain an amplification product;
[0090] 4) amplification product polymorphism identification: performing gel electrophoresis analysis on the amplification product obtained in step 3) to obtain an InDel site fingerprint of the amplification product, and determining according to the InDel site fingerprint: if the InDel site fingerprint of the amplification product is two amplification products with different molecular weights, and the difference in molecular weight corresponds to the inserted or deleted fragment in the InDel site, then the material to be identified is the Hangnu Yuyu 21 variety.
[0091] Further, in step 3), the reaction system of the PCR amplification is 10 μL, including 5 μL of 2x rapid PCR mixture, 25 ng of DNA template, 0.5 μL of forward primer and reverse primer, and the rest is ddH2O.
[0092] Further, in step 3), the PCR amplification reaction program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, a total of 35 cycles; 72℃ extension for 5 min; 4℃ storage.
[0093] Further, the amplification product is subjected to electrophoresis in a polyacrylamide gel with a mass percentage concentration of 8%.
[0094] Compared with the prior art, the application has the following beneficial effects:
[0095] (1) The InDel molecular marker of the application can be used to identify samples from the genomic level, is not affected by cultivation measures and environmental conditions, overcomes errors caused by field phenotype identification, and has good accuracy, repeatability and stability.
[0096] (2) The present application uses the genomic DNA of the variety to be identified as a template, and through simple PCR amplification technology and polyacrylamide gel electrophoresis, the base level deletion / insertion can be converted into the size difference of the amplified fragments, so as to complete the authenticity identification of the variety. The primer pair combination provided by the present application is a codominant marker, which can distinguish hybrid from parent.
[0097] (3) The present application can complete the identification of the sample to be tested at the seedling stage, saving a large amount of manpower, material resources, land resources and time; the amount of DNA used for detection is small, and the detection can be completed in a short time, so that the variety authenticity of Hangnuoyu 21 can be quickly and accurately identified, and the present application is suitable for popularization and application. BRIEF DESCRIPTION OF DRAWINGS
[0098] Figure 1 The gel electrophoresis map of the PCR amplification product of the primer group 1-12 of the present application.
[0099] Figure 2 The gel electrophoresis map of the PCR amplification product of the primer group 13-31 of the present application.
[0100] Figure 1 And 2 In the above, the amplification results of the lanes from left to right correspond to Hangnuoyu 21, TN789, N-21, T25xN238, N238, T25, Kocian 4, K17xW25, W25, K17, Zhekenu 2, and Zhekenu 101, respectively. DETAILED DESCRIPTION
[0101] The present application will be further described below in conjunction with specific examples. The following examples are only used to illustrate the present application, and are not used to limit the application scope of the present application. Any modification or replacement of the method, step or condition of the present application without departing from the spirit and essence of the present application shall fall within the scope of the present application.
[0102] The experimental methods not specified in the following examples are usually carried out according to the conventional conditions or according to the conditions recommended by the manufacturers; the materials, reagents and the like used are commercially available reagents and materials, unless otherwise specified, wherein the Hangnuoyu 21, TN789, N-21, T25xN238, N238, T25, Kocian 4, K17xW25, W25, K17, Zhekenu 2, and Zhekenu 101 germplasm are provided by Hangzhou Agricultural Technology Extension Center (Hangzhou Plant Protection and Inspection Center).
[0103] Example 1: Obtaining of InDel molecular marker for identifying Hangnuoyu 21 variety
[0104] 1) Field sampling was conducted on the protected variety Hangnuoyu 21, as well as its parent varieties TN789 and N-21 and nine similar varieties (T25×N238, N238, T25, Ketian 4, K17×W25, W25, K17, Zhekenuo 2, and Zhekenuo 101). 0.1g of leaf tissue samples were placed in 2mL centrifuge tubes and then rapidly frozen in liquid nitrogen. The samples were then stored at -80℃ in an ultra-low temperature freezer.
[0105] 2) Take the above sample out of the ultra-low temperature freezer, add a steel ball with a diameter of 6mm and material of 304, and then place it in a grinding machine and grind it at a frequency of 50Hz for 30s.
[0106] 3) Plant genomic DNA was extracted using the CTAB method. 2 μL of the DNA was taken and its concentration was detected using a UV spectrophotometer. 1 μL of the DNA was taken and its quality was detected using agarose gel electrophoresis.
[0107] 4) Select the DNA samples extracted in step 3) and send them to Beijing Novogene Technology Co., Ltd. for resequencing. The sequencing depth is 30×. Compare with the reference genome B73-V5 (Genbank database: GCA_902167145.1). Compare the InDel markers of the father and mother with those of the other 9 varieties to screen for father-specific markers and mother-specific markers as candidate InDel molecular markers.
[0108] 5) Using the site selected in step 4) as coordinates on the genome, select 800bp upstream and downstream fragments as template regions for primer design, and design InDel molecular marker primers;
[0109] 6) PCR amplification was performed using genomic DNA from Hangnuoyu 21 and its parents as templates, yielding different band patterns. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 35 cycles; 72℃ extension for 5 min; storage at 4℃. The PCR amplification reaction system, per 10 μL volume, included 5 μL of 2×Rapid Taq Master Mix (Vazyme), 0.5 μL of DNA template (50 ng / μL), 0.5 μL each of forward and reverse primers, and the remainder ddH2O. The amplification products were analyzed by 8% polyacrylamide gel electrophoresis. Stable and clear differential bands were amplified between Hangnuoyu 21 and its parents, and the InDel site fingerprint of the Hangnuoyu 21 amplification product contained two amplification products with the same molecular weight as the paternal and maternal materials. The InDel sites and corresponding primers are shown in Table 1.
[0110] Table 1. Different molecular marker positions and corresponding primers
[0111]
[0112]
[0113]
[0114]
[0115] Example 2: Variety identification of Hangnu Yuyue 21
[0116] The genomic DNA of Hangnu Yuyue 21 variety and the control material were extracted by the method of steps 1) to 3) in Example 1, respectively;
[0117] The primer combinations in Table 1 screened in Example 1 were used to perform PCR amplification with the genomic DNA of Hangnu Yuyue 21 variety and 9 control varieties as templates, and the PCR amplification system and reaction process were the same as in Example 1, and the amplification products were analyzed by 8% polyacrylamide gel electrophoresis, and the experimental results are shown in Figure 1 and Figure 2 , and the statistical results are shown in Table 2.
[0118] Table 2. Fingerprint data of 37 InDel primers for corn varieties (0, 1, 2 indicate different alleles)
[0119]
[0120]
[0121] Note: TN789 is the Hangnu Yuyue 21 paternal line; N-21 is the Hangnu Yuyue 21 maternal line. T25, N238, K17, W25, etc. are new corn lines; Kocian 4, Zhekenu 2, Zhekenu 101 are corn popular varieties.
[0122] From the results of Figure 1 , 2 and Table 2, it can be seen that only Hangnu Yuyue 21 has two amplification products in the InDel site fingerprint map, and the molecular weight is the same as that of the paternal and maternal materials, that is, the molecular weight difference of the two amplification products corresponds to the size of the inserted or deleted fragment in the InDel site. Therefore, the InDel 1-37 molecular markers determined by the present application have obvious variety specificity, and can distinguish Hangnu Yuyue 21 from other corn materials.
[0123] In summary, the molecular marker primer set provided by the present application can quickly and accurately identify the Hangnu Yuyue 21 variety, and the operation is simple, and the identification result is not affected by external environmental changes.
Claims
1. The application of the InDel site detection reagent in the identification of Hangnuoyu 21 variety, characterized in that, The reagent is used to detect the following Indel01 to Indel37 sites. The Indel01 site is located at position 74327965 on chromosome 8 in the B73-V5 genome, where the fragment TCTCCCACGCAGAGAAGCGCCTACGCCGTCTCAGCGGAGGCATCCA is deleted. The Indel02 site is located at position 205618420 on chromosome 5 in the B73-V5 genome, where the TACTAAGTCGATGGAACC fragment is deleted. The Indel03 site is located at position 224380350 on chromosome 5 in the B73-V5 genome, where the CAGCGGGCATAGTAAATGTATGAGGAGATCCACCTC fragment is deleted. The Indel04 site is located at position 21302050 on chromosome 10 in the B73-V5 genome, where the fragment GCTTGGGTGTCATCATGCGTGAAGCAAA is deleted. The Indel05 site is located at position 151363532 on chromosome 7 in the B73-V5 genome, where the GAGCAAGAGTTGGGA segment is deleted. The Indel06 site is located at position 32571190 on chromosome 3 in the B73-V5 genome, where the GCTGCGATGAAACTTTACTT fragment is inserted. The Indel07 site is located at position 59957178 on chromosome 2 in the B73-V5 genome, where the TTGGTGTGCATATGAAGGTCTAGGAGCTCCTTCCTACAATAACAGTATGCTAAGCAGGAACTGTGCAGCTATCTCAAATGCCAAAAGATTGGCTCGGCAT fragment is deleted. The Indel08 site is located at position 237399322 on chromosome 2 in the B73-V5 genome, where the TTTGCACTCTAACTCTTTCTATAGAAAACA fragment is inserted. The Indel09 site is located at position 9520388 on chromosome 1 in the B73-V5 genome, where the ATAAAGTACCAAAAAGAAAATAATTATTGGAGAGAGTGGGGGGTGCAAGCGGTAT fragment is deleted. The Indel10 site is located at position 40513192 on chromosome 1 in the B73-V5 genome, where the fragment AACCACTCTGCAAACAGCCTCGCAGGTCACGGCCAGCAGGGACAGCCGC is deleted. The Indel11 site is located at position 152997579 on chromosome 9 in the B73-V5 genome, where the TAATTAAGGATGACG fragment is deleted; The Indel12 site is located at position 120261605 on chromosome 8 in the B73-V5 genome, where the fragment CCAGCGGCAGCAGCAGCG or CCCAGCAGCAGCAGCAGCG is inserted. The Indel13 site is located at position 139994638 on chromosome 3 in the B73-V5 genome, where the AGCC segment is deleted; The Indel14 site is located at position 152997579 on chromosome 9 in the B73-V5 genome, where the TAATTAAGGATGACG fragment is deleted. The Indel15 site is located at position 21540354 on chromosome 1 in the B73-V5 genome, where the GATAAACAGACCCTTAGTGGTTTTGTTTTCTCAAGCAAAGCTCATTA fragment is inserted. The Indel16 site is located at position 63055748 on chromosome 10 in the B73-V5 genome, where the GACTACACATAACAAA fragment is deleted. The Indel17 site is located at position 307473335 on chromosome 1 in the B73-V5 genome, where the CACGGAACACGAATGACCCTGGAGCTTGGTGGCCCTCGTGAGGGTGAACAAAAGCTAAAGGATA fragment is deleted. The Indel18 site is located at position 182101444 on chromosome 3 in the B73-V5 genome, where the AATTTTATAACTCTAGTACTGATGTTCTGCGTTAGATTA fragment is deleted. The Indel19 site is located at position 216292025 on chromosome 3 in the B73-V5 genome, where the TTTGCTCTTATAAATGATTGCAATTCTTCTCACATCA fragment is deleted. The Indel20 site is located at position 155788155 on chromosome 6 in the B73-V5 genome, where the fragment TATATTATAAACTAGGTCTAAACGGGACTAAAAACCAGGATCAAATGG is deleted. The Indel21 site is located at position 162110398 on chromosome 7 in the B73-V5 genome, where the TTGCTCACCTGACCTGGTGTT fragment is deleted. The Indel22 site is located at position 136624473 on chromosome 9 in the B73-V5 genome, where the TAGTGATGATGGTCATTGTATATGTATTTCGTATGG fragment is deleted. The Indel23 site is located at position 96464136 on chromosome 7 in the B73-V5 genome, where the fragment ACCACTGAATAATATGATCCTGGCATTACGTACTTCTG is deleted. The Indel24 site is located at position 115594787 on chromosome 9 in the B73-V5 genome, where the fragment TGATGATAGCAACCTCCGCTGCAATCAGAGAGTAAATCAGTCAGCATTT is inserted. The Indel25 site is located at position 160669715 on chromosome 9 in the B73-V5 genome, where the GACTCTATTCTAGCTCCAGTGTGGA fragment is inserted. The Indel26 site is located at position 24353821 on chromosome 5 in the B73-V5 genome, where the TGTCTCCTTATCTTTCTTGAAAAAACA segment is deleted. The Indel27 site is located at position 9484027 on chromosome 1 in the B73-V5 genome, where the fragment GTTTTCTTGTGATATTCCGAAAACTAAAACAAGAGCTCTATGAGCACAGGATACGTTCCC is deleted. The Indel28 site is located at position 178211126 on chromosome 3 in the B73-V5 genome, where the AAGGCCGAGGGCGTCCATCACTTTATCTTC fragment is inserted. The Indel29 site is located at position 87599950 on chromosome 8 in the B73-V5 genome, where the GCAGAGGCCACTGTTCTTAAGGCGTCGCCTATGCGTCCAGGCGGAGGTCCAACT segment is deleted. The Indel30 site is located at position 65475938 on chromosome 4 in the B73-V5 genome, where the GCTATAGGGTCATTAGACCATGTGAACAATTGTATCTAGGGTTTTA fragment is inserted. The Indel31 site is located at position 205849549 on chromosome 4 in the B73-V5 genome, where the CTGAGGTATGACCAGTAATCTATCCATACTACTATATAATTTACTAGATTA or GACTGAGGTATGACCAGTAATCTATCCATACCACTATATAATTTACTAGATTA fragments are inserted. The Indel32 site is located at position 178804799 on chromosome 2 in the B73-V5 genome, where the TTACAGTATTGCCAATAATATAAAATTATTAATTATCACC fragment is inserted. The Indel33 site is located at position 224929148 on chromosome 5 in the B73-V5 genome, where the ATTTAATCCCTAAATTACCAAACGGTGAG fragment is deleted. The Indel34 site is located at position 156447947 on chromosome 6 in the B73-V5 genome, where the CATAATATTAGGCTCACCAGTGGAGAAATGGG fragment is inserted. The Indel35 site is located at position 165282119 on chromosome 6 in the B73-V5 genome, where the GTGCGAGCTCTACATGCTGCCTATGCAA fragment is deleted. The Indel36 site is located at position 29261210 on chromosome 7 in the B73-V5 genome, where the TAATATAGTATAAAATCGGATGGCATACCAGGAATTTTTCC fragment is deleted. The Indel37 site is located at position 144364593 on chromosome 7 in the B73-V5 genome, where the GAAATAAGAGGGCACGACGCACGCGC fragment is inserted. The B73-V5 genome is from the Genbank database: GCA_902167145.
1.
2. The application as described in claim 1, characterized in that, The InDel site detection reagent includes a pair of PCR primers for amplifying DNA fragments containing the InDel site; The application includes: designing PCR primer pairs based on the flanking sequences of the InDel site, and then using the genomic DNA of the sample to be identified as a template to perform PCR amplification using the primer pairs. If the amplification products of the sample to be identified contain two amplification products with different molecular weights, and the difference in their molecular weights corresponds to the inserted or deleted fragments in the InDel site, then the sample to be identified is determined to be the Hangnuoyu 21 variety.
3. The application as described in claim 2, characterized in that, The DNA fragment containing the InDel site is a fragment of 100-800 bp upstream and downstream of the InDel site, using the InDel site as the coordinate.
4. A primer combination for detecting the InDel site of claim 1, characterized in that, Including primer sets 1-31, The primer set 1 includes: primer pairs as shown in SEQ ID NO. 1~2 for amplifying the Indel01 site; and primer pairs as shown in SEQ ID NO. 3~4 for amplifying the Indel02 site; The primer set 2 includes: primer pairs as shown in SEQ ID NO. 5-6 for amplifying the Indel03 site; and primer pairs as shown in SEQ ID NO. 7-8 for amplifying the Indel04 site; The primer set 3 includes: primer pairs as shown in SEQ ID NO. 9~10 for amplifying the Indel05 site; and primer pairs as shown in SEQ ID NO. 11~12 for amplifying the Indel06 site; The primer set 4 includes: primer pairs as shown in SEQ ID NO. 13-14 for amplifying the Indel07 site; and primer pairs as shown in SEQ ID NO. 15-16 for amplifying the Indel08 site; The primer set 5 includes: primer pairs as shown in SEQ ID NO. 17-18 for amplifying the Indel09 site; and primer pairs as shown in SEQ ID NO. 19-20 for amplifying the Indel10 site; The primer set 6 includes: primer pairs as shown in SEQ ID NO. 21~22 for amplifying the Indel11 site; and primer pairs as shown in SEQ ID NO. 23~24 for amplifying the Indel12 site; The primer set 7 includes primer pairs as shown in SEQ ID NO. 25~26 for amplifying the Indel13 site; The primer set 8 includes primer pairs as shown in SEQ ID NO. 27~28 for amplifying the Indel14 site; The primer set 9 includes primer pairs as shown in SEQ ID NO. 29~30 for amplifying the Indel15 site; The primer set 10 includes primer pairs as shown in SEQ ID NO. 31-32 for amplifying the Indel16 site; The primer set 11 includes primer pairs as shown in SEQ ID NO. 33-34 for amplifying the Indel17 site; The primer set 12 includes primer pairs as shown in SEQ ID NO. 35-36 for amplifying the Indel18 site; The primer set 13 includes primer pairs as shown in SEQ ID NO. 37-38 for amplifying the Indel19 site; The primer set 14 includes primer pairs as shown in SEQ ID NO. 39~40 for amplifying the Indel20 site; The primer set 15 includes primer pairs as shown in SEQ ID NO. 41~42 for amplifying the Indel21 site; The primer set 16 includes primer pairs as shown in SEQ ID NO. 43-44 for amplifying the Indel22 site; The primer set 17 includes primer pairs as shown in SEQ ID NO. 45-46 for amplifying the Indel23 site; The primer set 18 includes primer pairs as shown in SEQ ID NO. 47-48 for amplifying the Indel24 site; The primer set 19 includes primer pairs as shown in SEQ ID NO. 49~50 for amplifying the Indel25 site; The primer set 20 includes primer pairs as shown in SEQ ID NO. 51-52 for amplifying the Indel26 site; The primer set 21 includes primer pairs as shown in SEQ ID NO. 53-54 for amplifying the Indel27 site; The primer set 22 includes primer pairs as shown in SEQ ID NO. 55~56 for amplifying the Indel28 site; The primer set 23 includes primer pairs as shown in SEQ ID NO. 57-58 for amplifying the Indel29 site; The primer set 24 includes primer pairs as shown in SEQ ID NO. 59~60 for amplifying the Indel30 site; The primer set 25 includes primer pairs as shown in SEQ ID NO. 61~62 for amplifying the Indel31 site; The primer set 26 includes primer pairs as shown in SEQ ID NO. 63-64 for amplifying the Indel32 site; The primer set 27 includes primer pairs as shown in SEQ ID NO. 65-66 for amplifying the Indel33 site; The primer set 28 includes primer pairs as shown in SEQ ID NO. 67-68 for amplifying the Indel34 site; The primer set 29 includes primer pairs as shown in SEQ ID NO. 69~70 for amplifying the Indel35 site; The primer set 30 includes primer pairs as shown in SEQ ID NO. 71~72 for amplifying the Indel36 site; The primer set 31 includes primer pairs as shown in SEQ ID NO. 73~74 for amplifying the Indel37 site.
5. The application of the primer combination as described in claim 4 in the identification of Hangnuoyu 21 variety.
6. A method for identifying the Hangnuoyu 21 variety, characterized in that, Includes the following steps: 1) Design primer sets 1 to 31 as described in claim 4 for the flanking sequences of Indel 01 to Indel 37 as described in claim 1; 2) Extract genomic DNA from the maize material to be identified; 3) Perform PCR amplification reaction on the genomic DNA of the material to be identified using primer sets 1-31 described in step 1) to obtain amplification products; 4) Identification of polymorphism of amplified products: The amplified products obtained in step 3) are analyzed by gel electrophoresis to obtain the InDel site fingerprint of the amplified products. The InDel site fingerprint is used to determine: if the InDel site fingerprint of the amplified products contains two amplified products with different molecular weights, and the difference in molecular weight corresponds to the inserted or deleted fragment in the InDel site, then the material to be identified is Hangnuoyu 21 variety.
7. The method for identifying the Hangnuoyu 21 variety according to claim 6, characterized in that, In step 3), the PCR amplification reaction system, in 10 μL, includes 5 µL of 2× rapid PCR mixture, 25 ng of DNA template, 0.5 μL each of forward and reverse primers, and the remainder is ddH2O.
8. The method for identifying the Hangnuoyu 21 variety according to claim 6, characterized in that, In step 3), the PCR amplification reaction program is as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 55 °C annealing for 15 s, 72 °C extension for 15 s, for a total of 35 cycles; 72 °C extension for 5 min; storage at 4 °C.
9. The method for identifying the Hangnuoyu 21 variety according to claim 6, characterized in that, The amplified products were electrophoresed in a polyacrylamide gel with a mass percentage concentration of 8%.
Citation Information
Patent Citations
SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof
CN105483281A
SNP molecular markers for identifying Huyunuo 3 waxy corn and application thereof
CN109652582A