Specific CD4 T cell epitope peptides screened from the whole proteome of the SARS-CoV-2 S1 protein and their applications

Through the screening of the S1 whole protein group of the novel coronavirus, the specific CD4T cell epitope peptide PAYTNSFTRGVYYPD was identified and provided, which solved the problem of difficulty in screening CD4+ T cell responses in the prior art, achieved a safe and effective CD4T cell immune response, and supported the development of the novel coronavirus vaccine.

CN117843735BActive Publication Date: 2025-06-10THE NAVAL MEDICAL UNIV OF PLA +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311130011.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-04
Publication Date
2025-06-10
Estimated Expiration
2043-09-04

AI Technical Summary

Technical Problem

The prior art is difficult to effectively screen and identify specific CD4 T cell epitope peptides induced by the S1 whole protein of the novel coronavirus, limiting the understanding of CD4+ T cell responses and support for vaccine development.

Method used

Through the S1 whole protein set screen of the novel coronavirus, specific CD4 T cell epitope peptide PAYTNSFTRGVYYPD and its related genes and recombinant vectors were identified and provided for the preparation of antigen presenting cells and induction of specific CD4+ T lymphocytes.

Benefits of technology

It has achieved safe and effective induction of CD4T cell immune responses against the new coronavirus protein, which is of great significance to the development of the new coronavirus vaccine and the treatment of disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117843735B_ABST
    Figure CN117843735B_ABST
Patent Text Reader

Abstract

The present invention discloses specific CD4 T cell epitope peptides screened from the whole proteome of the novel coronavirus S1, and relates to the field of biomedical technologies. The technical key points are as follows: The solution of the present invention provides a novel coronavirus CD4 T cell epitope polypeptide, as well as the roles of the gene encoding the epitope polypeptide, a recombinant protein or complex containing the epitope polypeptide, a sensitized antigen-presenting cell, and specific immune effector cells against the epitope polypeptide in the research and development of novel coronavirus vaccines and disease treatment. The specific CD4 T cell epitope peptides screened from the whole proteome of the novel coronavirus S1 of the present invention can safely and effectively induce CD4 T cell immune responses against the proteins of the novel coronavirus, and are of great significance for the research and development of novel vaccines against the novel coronavirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to specific CD4 T cell epitope peptides screened from the novel coronavirus S1 full protein group and their applications. Background Art

[0002] The novel coronavirus (SARS-CoV-2) epidemic is the most significant public health event of this century, posing a long-term threat to human health and socioeconomic activities. The virus has not completely disappeared; it has coexisted with humans for a long time and continues to mutate, posing a potential threat to human health. Therefore, the research and development of effective vaccines and therapeutic drugs must continue. Specific T cell responses play a vital role in the body's resistance to viral infections. Therefore, studying the T cell immune response induced by viral infection, especially the characteristics of T cell epitopes, is crucial for understanding the immune defense mechanism and is also a prerequisite for the development of vaccines and immunotherapy.

[0003] The basis for T cell recognition and activation is the recognition of viral antigen peptides presented by HLA - T cell epitopes. Therefore, studying the characteristics of viral T cell epitopes is crucial for understanding immune defense mechanisms and is a prerequisite for developing vaccines and immunotherapies. At the same time, due to the high polymorphism of HLA, the identification of SARS-CoV-2 T cell epitopes and their corresponding HLA has the following important significance:

[0004] (1) It can help predict the T cell response induced by natural infection or vaccination with SARS-CoV-2 in a population of a certain ethnicity or geographic region, which is related to the HLA allele composition prevalent in that population;

[0005] (2) It can guide vaccine development and utilize specific dominant epitopes to enhance T cell responses and increase vaccine effectiveness;

[0006] (3) It can also help monitor potential viral mutations to escape T cell responses;

[0007] (4) It can also promote the development of memory T cell-based diagnostics to distinguish between recovered and uninfected individuals.

[0008] The SARS-CoV-2 genome consists of structural and non-structural protein coding regions. The structural protein coding region primarily encodes the Spike protein (S protein), Nucleocapsid protein (N protein), Membrane glycoprotein (M protein), and Envelope protein (E protein). The S protein consists of two subunits, S1 and S2. S1 primarily contains the receptor binding domain (RBD), responsible for recognizing cellular receptors, while S2 contains the essential elements required for membrane fusion. The non-structural protein coding region primarily includes the open reading frame (ORF) 1a and ORF1b genes, encoding 16 non-structural proteins (NSP proteins), namely NSP1 to 16.

[0009] Recently, researchers analyzed and summarized SARS-CoV-2 T cell epitopes identified in 18 studies (derived from data from 852 recovered COVID-19 patients). These studies used bioinformatically predicted peptide libraries (megapools) or overlapping peptide libraries (most commonly 15 AAs, 5 steps) to stimulate PBMCs in vitro. A total of 711 T cell epitopes and their corresponding HLA genotypes were identified, including 635 CD8+ T cell epitopes and 76 CD4+ T cell epitopes. Of these, 208 epitopes were located in the S protein and 250 in the ORF1 protein. Twenty of these epitope-HLA pairs were identified across studies, suggesting that these may be dominant epitopes. Of these 20 epitopes, six were found in the N protein and ORF1a protein, four in the S protein, three in the ORF3a protein, and one in the M protein.

[0010] Unlike CD8+ T cell epitopes, which cannot accurately predict the binding epitope peptide based on a given HLA genotype, research on CD4+ T cell epitopes currently relies primarily on stimulation with peptide libraries. However, the limited availability of human PBMC samples significantly limits our ability to study CD4+ T cell epitopes.

[0011] Currently, there is little research on the dominant CD4+ T epitopes induced by vaccination and natural infection. Therefore, identifying the potential dominant CD4+ T epitopes in the human population will help to more fully understand the T cell responses in humans after vaccine booster vaccination and natural infection.

[0012] There is currently no report on the identification of specific CD4 T cell epitope peptides based on the screening of the whole protein peptide library of the SARS-CoV-2 S1 protein.

[0013] To this end, the present invention aims to provide specific CD4 T cell epitope peptides screened from the whole protein group of novel coronavirus S1 and their applications to solve the above problems. Summary of the Invention

[0014] The purpose of the present invention is to solve the above problems and provide specific CD4T cell epitope peptides screened from the whole protein group of novel coronavirus S1 and their applications.

[0015] In order to achieve the above object, the technical solution of the present invention is as follows:

[0016] The present invention provides a specific CD4 T cell epitope peptide screened from the whole protein group of the novel coronavirus S1, and the amino acid sequence of the epitope peptide is shown in SEQ ID NO.1.

[0017] SEQ ID NO.1:

[0018] PAYTNSFTRGVYYPD

[0019] The present invention also provides a complex or fusion protein containing the epitope peptide.

[0020] The present invention also provides a gene encoding the epitope peptide, wherein the gene has a nucleotide sequence as shown in SEQ ID NO.2.

[0021] SEQ ID NO.2:

[0022] CCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGAC

[0023] The present invention also provides a recombinant vector containing the above-mentioned gene.

[0024] Furthermore, the recombinant vector is selected from a recombinant adenovirus vector, a recombinant adeno-associated virus vector or a lentivirus vector.

[0025] The present invention also provides an antigen-presenting cell, which is an antigen-presenting cell sensitized with the epitope peptide, the complex or the fusion protein; or an antigen-presenting cell modified with the gene or the recombinant vector.

[0026] Furthermore, the antigen presenting cells are dendritic cells, monocytes, mononuclear macrophages and B cells expressing human HLA-DRB1*09:01:02.

[0027] The present invention also provides a CD4+T lymphocyte that specifically recognizes the epitope peptide. The CD4+T lymphocyte is a CD4+T cell that is cloned and proliferated by repeated stimulation and activation induced by the antigen presenting cells.

[0028] In the scheme of the present invention, it is an HLA-DRB090102-restricted CD4 T cell epitope peptide derived from the new coronavirus. The present invention also provides the use of the above-mentioned specific CD4 T cell epitope peptide in the preparation of a screening and detection reagent for new coronavirus infections.

[0029] The specific CD4 T cell epitope peptide described in the present invention can also provide a detection antigen for evaluating the long-term immune protection of the new coronavirus vaccine.

[0030] The specific CD4 T cell epitope peptide of the present invention can also provide a detection antigen for evaluating the immune response induced by virus variants.

[0031] The specific CD4 T cell epitope peptide described in the present invention can also provide a detection antigen for detecting the specific T cell immune response level of COVID-19 patients.

[0032] The specific CD4 T cell epitope peptide of the present invention can also provide antigens for inducing specific T cells in vitro.

[0033] Based on the above solution of the present invention, the present invention also provides a Tetramer for detecting specific T cells.

[0034] The present invention also provides an active immunotherapy agent for novel coronavirus infection, which comprises the above-mentioned specific CD4 T cell epitope peptide.

[0035] Compared with the existing technology, this solution has the following beneficial effects:

[0036] The present invention provides specific CD4T cell epitope peptides screened from the whole proteome of the novel coronavirus S1 protein, and provides human HLA allele information that can recognize the epitope peptide, and can be used to prepare Tetramer to verify the epitope and HLA. The specific CD4T cell epitope peptides provided by the present invention can safely and effectively induce CD4T cell immune responses against the novel coronavirus protein, which is of great significance to the research and development of new vaccines for the novel coronavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the peptide library screening strategy in Example 1 of the present invention;

[0038] Figure 2 These are the flow cytometry results of the second (A) and third (B) rounds of screening of sample I-226 in Example 1 of the present invention;

[0039] Figure 3This is the detection of the blocking efficiency of the HLA_DR antibody on the T cell response induced by S6 and S16 single peptides in Example 3 of the present invention (A. The blocking efficiency of the HLA_DR antibody on the CD4+ T cell response induced by S6 single peptide; B. The blocking efficiency of the HLA_DR antibody on the CD4+ T cell response induced by S16 single peptide);

[0040] Figure 4 These are the flow cytometry results of Tetramer detection of I_72 (responders) and I_73 (non-responders) in the examples of the present invention (A: PBMCs were rested for 4 hours after recovery, and Tetramer detection was performed; B: PBMCs were stimulated and expanded with the S1 peptide library for 9 days, and Tetramer detection was performed). DETAILED DESCRIPTION

[0041] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0042] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0043] The solution provided by the embodiments of the present invention is as described in the above invention content, providing specific CD4T cell epitope peptides screened from the whole protein group of the new coronavirus S1, as well as genes encoding the epitope polypeptides, recombinant proteins or complexes containing the epitope polypeptides, sensitized antigen-presenting cells, and specific immune effector cells against the epitope polypeptides in the development of new coronavirus vaccines and disease treatment.

[0044] Example 1: Screening of CD4 T cell dominant epitope peptides targeting S1 protein

[0045] 1.1 Information of S1 protein peptide library

[0046] Peptide library synthesis plan: 15AA, 5 steps. The S1 protein (1-681AA) peptide library contains 135 peptides, S1-S135, and the S2 protein (682-1273AA) peptide library contains 117 peptides, S137-S253. S136 contains both S1 and S2, and its sequence is TQTNSPRRARSVASQ. Table 1 below shows the S1 protein peptide library information.

[0047] Table 1: S1 protein peptide library information

[0048]

[0049] 1.2 Short-term expansion of antigen-specific T cells in vitro

[0050] After cell recovery and counting, 3 x 105 cells were plated per well in a 96-well round-bottom plate. After stimulation with the S1 peptide library for 72 hours, 40 units / ml of IL-2 was added and the medium was replaced halfway. On day 6, significant cell proliferation was observed, and after another half-volume medium replacement, each well was split in half for expansion culture. On day 9, the medium was replaced halfway.

[0051] 1.3 Screening of dominant epitopes

[0052] First round of screening: We divided the S1 peptide library into five subpools: S1-1, S1-2, S1-3, S1-4, and S1-5. PBMCs were collected from recovered individuals one month after infection. After nine days of in vitro expansion with S1, the cells were harvested and counted. 200,000 cells per well were plated in a 96-well round-bottom plate and stimulated with each of the above subpools for 6 hours (after one hour of stimulation, BFA was added to block cytokine transport). IFNγ expression in CD4+ and CD8+ T cells was measured by flow cytometry. An S1 stimulation group and a Dmso group were also set up as positive and negative controls.

[0053] Second round of screening: The above five sub-libraries were divided into six secondary sub-libraries, namely A, B, C, D, E, and F. The sub-libraries selected in the first round of screening were subjected to the second round of testing.

[0054] The third round of screening: samples that responded after the second round of sub-library stimulation were selected, 200,000 cells per well were placed in a 96-well round-bottom plate, and the corresponding single peptide was added. After 6 hours of stimulation, intracellular staining was performed to detect the expression of IFNγ in CD4+ and CD8+ T cells.

[0055] like Figure 1 As shown in FIG, it is a peptide library screening strategy, and the results show that more people respond to S6, including: I-46, I-47, I-60, I-145, I-162, I-226, I-181 and I-72. Figure 2 As shown, the screening results of I-226 are displayed.

[0056] Example 2: HLA typing test was performed on the subjects with good response to S6 obtained from the above screening

[0057] The samples with better T cell response were collected and 12*10 6The cells were centrifuged and treated with protease, and DNA was extracted and sent to Novogene for quality control and sequencing. A total of six genes, HLA-A, B, C, DRB1, DQB1, and DPB1, were tested. The results are shown in Table 2: All responders harbored DRB1*09:01:02. The S6 CD4+ T cell epitope has not been reported, but its corresponding DRB1*09:01:02 is most common in the Chinese population, with 15% of Chinese people harboring this type. This suggests that this epitope is a dominant CD4+ T cell epitope in the Chinese population and warrants further validation using tetramers.

[0058] Table 2: Typing results of DRB1, DQB1 and DPB1

[0059]

[0060] Example 3: Using HLA_DR antibody blocking experiment to analyze whether S6 is presented by HLA_DR

[0061] Based on the fact that the people who responded to S6 tested so far all contained the DRB1*09:01:02 allele, we speculate that S6 is mainly presented by it. PBMC samples that responded to S6 and S16 were selected, and after 10 days of stimulation and amplification with the S1 peptide library, they were counted and plated. HLA-DR blocking antibodies were added in advance for 30 minutes, and then S6 or S16 single peptides were added for stimulation for 6 hours, and the proportion of IFNγ+T cells was detected. The results showed that HLA-DR blocking antibodies can effectively block the activation effect of S6, suggesting that the CD4+T cell epitope S6 is mainly presented by HLA-DRB (such as Figure 3 shown).

[0062] Example 4: Analysis of the binding ability of S6-HLA_DRB1*09:01:02

[0063] Bioinformatic prediction of MHC binding capacity is a key component of various epitope identification methods. We used NetMHCIIpan-4.0 (NetMHCIIpan 4.0 - DTU Healthcare Tech - Bioinformatic Services) to analyze the binding capacity of S6 and its corresponding responder HLA genotypes. The results showed that S6 has a certain binding affinity with DRB1*09:01:02 (see Table 3 below).

[0064] Table 3: Binding ability analysis results of S6 and DRB1*09:01

[0065]

[0066] Example 5: DRA1*01:01 / DRB1*09:01PAYTNSFTRGVYYPD Tetramer Detection Results

[0067] Proimmune was commissioned to synthesize PE-coupled MHC Class II Tetramers.

[0068] PBMC samples from recovered patients were first labeled with tetramers and then with anti-human CD3, CD4, and CXCR5 antibodies, and then analyzed by flow cytometry.

[0069] like Figure 4 Figure 2 shows the flow cytometry results of Tetramer detection of I_72 (responder) and I_73 (non-responder). The results showed that compared with I_73 (non-responder), I_72 (responder) significantly contained CD4 T cells that recognized HLA-DRB1*09:01:02 / S6, especially after expansion and culture of the S1 peptide library.

[0070] In summary, S6 is an HLA-DRB1*09:01:02-restricted CD4 T cell dominant epitope of the new coronavirus.

[0071] Through the above embodiments of the present invention, the specific CD4 T cell epitope peptides provided by the present invention can safely and effectively induce CD4 T cell immune responses against the new coronavirus protein, which is of great significance to the research and development of new coronavirus vaccines.

[0072] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the embodiments as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. An HLA-antigen peptide complex formed by the polypeptide of SEQ ID NO:1 and the HLA-DRB1*09:01:02 molecule, namely the HLA-DRB1*09:01:02 / SEQ ID NO:1 complex.

2. An antigen-presenting cell, characterized in that the antigen-presenting cell is: an antigen-presenting cell expressing human HLA-DRB1*09:01:02 sensitized by the polypeptide of SEQ ID NO:1 or the nucleic acid encoding the polypeptide of SEQ ID NO:1 or the recombinant vector expressing the polypeptide of SEQ ID NO:

1.

3. A CD4+ T cell that specifically recognizes the complex according to claim 1, characterized in that: a CD4+ T cell that is cloned and proliferated after being repeatedly stimulated and induced to be activated by the antigen-presenting cell according to claim 2.

Citation Information

Patent Citations

  • Novel coronavirus CD8+ T cell epitope peptide and application thereof

    CN113666989A