A method to improve the efficiency of plant gene editing and its application
By combining FTO protein with the CRISPR-Cas system and expressing it in host cells using different expression cassettes, the problem of low efficiency in targeted region editing in different species of plant gene editing systems has been solved, achieving more efficient gene editing results.
Patent Information
- Application Number
- CN202410047116.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-12
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2044-01-12
AI Technical Summary
Existing plant genome editing systems suffer from low efficiency in precise editing of target regions and difficulty in controlling off-target events across different species, and there is a lack of effective strategies to improve editing efficiency.
The FTO protein, which has RNA demethylation function, is combined with the CRISPR-Cas gene editing system to edit target nucleotides by forming a complex. The FTO protein and Cas nuclease are not fused and are expressed in host cells, including bacterial and plant cells, using different expression cassettes.
It significantly improved the efficiency of plant gene editing, especially in various plants such as soybeans and rice, increasing the efficiency of target editing and reducing off-target events.
Smart Images

Figure CN117844771B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetics and breeding, specifically relating to a method for improving the efficiency of plant gene editing and its application. Background Technology
[0002] Currently, the CRISPR / Cas system has made significant progress in genome editing applications across various species, particularly in plants, where it has been applied for different purposes in various plant species. However, due to the significant differences in structure and expression patterns between animal and plant cells, and even between monocots and dicots, the CRISPR / Cas expression system needs to be optimized for the specific characteristics of different plants to achieve efficient utilization. Optimization of efficient plant genome editing tools mediated by the CRISPR / Cas system mainly focuses on the expression levels and synergy of Cas proteins and sgRNAs, such as codon optimization of Cas proteins or using a more efficient U6 promoter to drive sgRNAs.
[0003] However, even though researchers have optimized CRISPR / Cas nuclease-based editing systems for different species to achieve higher editing efficiency, plant genome editing still faces challenges, primarily in further improving the efficiency of the editing system in precisely editing target regions and controlling off-target events. Currently, there is no strategy that can simultaneously improve editing efficiency across multiple editors in different species; therefore, developing an efficient gene editing-assisted strategy is of great significance for precision breeding.
[0004] FTO is the first identified RNA demethylase, associated with mammalian development and various human diseases, and involved in the regulation of cancer development. Overexpression of FTO in rice and potatoes has shown that FTO-overexpressing lines exhibit greater aboveground and belowground biomass, along with increased stress resistance (YU Q, LIU S, YU L, et al. RNA demethylation increases the yield and biomass of rice and potato plants in field trials[J]. Nat Biotechnol, 2021, 39(12):1581-8). In animal cells, FTO fuses with Cas proteins to perform RNA demethylation at specific genomic locations (e.g., WO2020181180). However, there are no technological implications for using FTO to improve the efficiency of plant gene editing. Summary of the Invention
[0005] To address the aforementioned problems, the present invention aims to disclose a method for improving the efficiency of plant gene editing and its application.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] This invention provides a composition, characterized in that it comprises:
[0008] 1) FTO proteins with RNA demethylation function;
[0009] 2) A CRISPR-Cas gene editing system consisting of a Cas nuclease and a guide RNA, wherein the Cas nuclease and the guide RNA are capable of forming a complex and editing a target nucleotide; wherein the editing is selected from the group consisting of: insertion of at least one polynucleotide, deletion of at least one polynucleotide, molecular alteration of at least one polynucleotide, substitution of at least one polynucleotide, and combinations of at least two of the foregoing.
[0010] Furthermore, the FTO protein in 1) and the Cas nuclease in 2) do not fuse together.
[0011] In some embodiments, the amino acid sequence of the FTO protein described above is shown in SEQ ID NO:1.
[0012] The present invention also provides a carrier system capable of producing the above-described composition, wherein the above-described FTO protein and Cas nuclease are produced by different expression cassettes.
[0013] In some embodiments, the FTO protein is generated by an expression cassette composed of nucleic acid molecules with sequences shown in SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 linked sequentially, or by an expression cassette composed of nucleic acid molecules with sequences shown in SEQ ID NO:5, SEQ ID NO:3, and SEQ ID NO:4 linked sequentially.
[0014] The present invention also provides a host cell, characterized in that the host cell contains the above-described composition or the above-described carrier system.
[0015] In some implementations, the host cell is a bacterial host cell or a non-renewable plant host cell.
[0016] In some implementations, the host cells of the bacteria are Escherichia coli or Agrobacterium cells.
[0017] This invention also provides a method for editing polynucleotides in the genome of target cells, characterized in that the method comprises:
[0018] 1) Provide Cas nuclease to cells;
[0019] 2) Provide the cells with at least one FTO protein capable of RNA demethylation, wherein the FTO protein is not fused to the Cas nuclease described in 1);
[0020] 3) Incubate the target cells to allow the Cas nuclease and guide RNA to form a complex that recognizes the target polynucleotide, binds to the target polynucleotide, and causes the target polynucleotide to make a cut or cleave the target polynucleotide and edit it;
[0021] The editing is selected from the group consisting of: insertion of at least one polynucleotide, deletion of at least one polynucleotide, molecular alteration of at least one polynucleotide, substitution of at least one polynucleotide, and combinations of at least two of the foregoing.
[0022] In some implementations, the cells described above are plant cells.
[0023] In some implementation schemes, the aforementioned cells are rice, soybeans, wheat, barley, millet, sunflower, peanuts, oats, radishes, mung beans, carrots, broad beans, sweet potatoes, potatoes, turnips, beets, cabbage, mustard greens, kale, melons, tomatoes, eggplants, green beans, cowpeas, edamame, leeks, peas, scallions, cauliflower, kale, onions, leeks, spinach, celery, chili peppers, garland chrysanthemum, daylilies, cotton, lentils, rapeseed, sesame, amaranth, lettuce, cucumbers, zucchini, pumpkins, mung beans, bitter melons, corn, sorghum, millet, buckwheat, loofah, cucumbers, watermelons, alfalfa, pasture grass, turfgrass, tea, cassava, grapes, strawberries, winter melons, tobacco, beets, or sugarcane.
[0024] The present invention also provides the application of the above-described composition, or the above-described vector system, or the above-described host cell, or the above-described method in plant gene editing.
[0025] The beneficial effects of this invention are as follows: By optimizing the vector element, this invention successfully improves the efficiency of plant gene editing by using FTO protein. Attached Figure Description
[0026] Figure 1 Schematic diagram of vectors with different hFTO expression structures.
[0027] Figure 2 Comparison of editing efficiency in soybean hairy root system. The horizontal axis represents different target points.
[0028] Figure 3 The effect of hFTO on editing efficiency during stable conversion of soybean. Each line represents a test target point.
[0029] Figure 4 hFTO can promote the effective editing of ineffective targets.
[0030] Figure 5 A schematic diagram of the structure of the MAD7 gene editing vector expressing hFTO.
[0031] Figure 6 Expression of hFTO can improve the efficiency of MAD7 nuclease-mediated gene editing. The horizontal axis represents different target sites.
[0032] Figure 7 A schematic diagram of the guided editing carrier structure for expressing hFTO.
[0033] Figure 8 A schematic diagram of sequence changes during target gene editing in rice. Light-colored text indicates PAM, and arrows point to the edited sites.
[0034] Figure 9 hFTO can improve the efficiency of rice gene editing. The horizontal axis represents the editing of different target sites by enpPE2 and enpPE2-hFTO.
[0035] Figure 10 m of poly(A) RNA 6 A-level analysis.
[0036] Figure 11 TUNLE experiments were conducted on shoot tips and root tips to analyze their chromatin openness levels.
[0037] Figure 12 Cas9 and sgRNA expression levels analysis.
[0038] Figure 13 Analysis of H3K27me3 levels in the Cas9 expression frame of the genome. Detailed Implementation
[0039] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.
[0040] In this application, the words “comprising,” “including,” or variations thereof should be understood to include other elements, numbers, or steps in addition to those described.
[0041] Unless otherwise specified, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino-to-carboxyl orientation. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms “encoding” or “encoded” when used in the context of a particular nucleic acid mean that the nucleic acid contains the essential information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of the specific protein. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue,” “amino acid residue,” or “amino acid” are used interchangeably herein to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids and, unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.
[0042] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Sequence identity verification includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe may be a genomic DNA fragment, cDNA fragment, RNA fragment, or other oligonucleotide, and may be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on sequences from the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the terms "stringent conditions" or "stringent hybridization conditions" refer to conditions under which the probe will hybridize with its target sequence to a detectable extent (e.g., at least 2, 5, or 10 times the background) relative to hybridization with other sequences.Harsh conditions are sequence-dependent and vary across different environments. By controlling hybridization harshness and / or washing conditions, target sequences 100% complementary to the probe can be identified (homologous probe method). Alternatively, harsh conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, probe lengths are less than about 1000 or 500 nucleotides. Typically, harsh conditions are those where the salt concentration is less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 M to 1.0 M Na ion concentration (or other salts), and the temperature conditions are: at least about 30 °C for short probes (e.g., 10 to 50 nucleotides) and at least about 60 °C for long probes (e.g., greater than 50 nucleotides). Harsh conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low-threshold conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1M NaCl, and 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1× to 2× SSC (20× SSC = 3.0M NaCl / 0.3M trisodium citrate). Exemplary medium-threshold conditions include hybridization at 37°C using 40% to 45% formamide, 1.0M NaCl, and 1% SDS, followed by washing at 55°C to 60°C in 0.5× to 1× SSC. Exemplary high-threshold conditions include hybridization at 37°C using 50% formamide, 1M NaCl, and 1% SDS, followed by a final wash at 60°C to 65°C in 0.1× SSC for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Hybridization duration is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity typically depends on post-hybridization washing, with key factors being the ionic strength and temperature of the final washing solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated by the formula from Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5℃ + 16.6 (logM) + 0.41 (%GC) - 0.61 (%formamide) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "formamide%" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature at which 50% of the complementary target sequence hybridizes with a perfectly matched probe (at a given ionic strength and pH). Washing is typically performed at least until equilibration is reached and a low hybridization background level is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mispairing should lower Tm by approximately 1°C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize with the desired sequence of homology. For example, if a sequence with ≥90% homology is required, Tm can be lowered by 10°C.Typically, the stringency conditions are selected to be approximately 5°C lower than the Tm of the specific sequence and its complementary sequence at the defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the Tm.
[0043] Unless otherwise specified, all figures representing amounts of components, reaction conditions, etc., used in this specification and claims should be understood to be modified by the term "about" in all cases. As used herein, the term "about," when referring to a measurable value such as mass, weight, time, volume, concentration, or percentage, means to cover variations of ±20% from a specified amount in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, because such variations are suitable for performing the disclosed methods and / or using the disclosed compositions, nucleic acids, peptides, etc. Therefore, unless indicated to the contrary, the numerical parameters listed in this specification and appended claims are approximate values that may vary depending on the desired characteristics sought to be obtained from the subject matter disclosed in this application.
[0044] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.
[0045] Example
[0046] Example 1: Optimizing hFTO expression can improve the efficiency of CRISPR-Cas9-mediated gene editing in plants.
[0047] The inventors selected human hFTO (amino acid sequence as shown in SEQ ID NO.1), and obtained a suitable nucleotide sequence for plant expression through codon optimization (as shown in SEQ ID NO.3). They then screened and tested the effects of various hFTO expression elements on improving plant gene editing efficiency. The specific technical solutions include: 1) using the conventional soybean gene editing vector pGES401; 2) fusing the hFTO protein to the N-terminus of the Cas9 protein in pGES401 to construct the test vector pGES402; 3) constructing hFTO into a separate expression cassette, using the soybean endogenous promoter pM8L and HSP terminator to drive hFTO expression, and constructing the test vector pGES501; 4) replacing the pM8L promoter in pGES501 with the more commonly used and more powerful 35S promoter to construct the test vector pGES502. (The structures of the above test vectors are shown in [link to relevant documentation]). Figure 1 The editing efficiency of these four vectors was determined using a soybean hairy root system, and the results are as follows: Figure 2 As shown. A total of 11 gene targets were selected (see...). Figure 2 (The horizontal axis is labeled) The test was conducted, and among all the test vectors, pGES501 had the highest editing efficiency, with an average editing efficiency of 53.27%, while the average editing efficiency of the control vector pGES401 was 42.72%. The above results indicate that different hFTO expression elements have different effects on the gene editing efficiency of plants. Among them, the structure of expressing hFTO alone using the soybean endogenous strong promoter pM8L is the optimal structure. Therefore, the pGES501 vector screened by optimizing the hFTO expression structure can significantly improve the gene editing efficiency of soybean in the soybean hairy root system.
[0048] Example 2: Overexpression of hFTO in soybean stable transformation system significantly improves editing efficiency
[0049] Further testing of the technical efficacy of the pGES501 vector expressing hFTO on CRISPR-Cas9 editing efficiency was conducted using a stable soybean transformation system. The inventors designed 57 sgRNAs that can target 77 different genomic sites for testing. The 57 sgRNAs were mixed in groups of 1–4, resulting in 24 mixed sgRNA groups. Twenty-four vectors carrying different sgRNAs were constructed using pGES401 and pGES501 vectors, respectively, for stable soybean transformation. After soybean transformation, 844 T0 generation positive lines carrying pGES401 and 789 T0 generation positive lines carrying pGES501 were obtained. Genotyping of the 77 target sites in these lines was analyzed, and the gene editing efficiency of each target site was statistically analyzed. The results are as follows: Figure 3 and Figure 4As shown, the average editing efficiency of pGES501 at 77 target sites (53.56%) was significantly higher than that of pGES401-mediated gene editing (35.54%). Furthermore, at target sites 7, 11, and 19 (target site 7: CAAACACCTTTTGTCAATGGAGG, target site 11: ATCTTCTGAAGCCGGGGCTGAGG, and target site 19: CCGGCCGCCGTGGAAGGAGGCGG), effective editing could not be achieved using the pGES401 vector, while effective editing could be achieved using the pGES501 vector at all three target sites, with editing efficiencies ranging from 9.09% to 22.86%.
[0050] The results above demonstrate that the hFTO expression cassette can significantly improve the editing efficiency of the CRISPR-Cas9 system in stable soybean transformation and can edit sites that cannot be edited by conventional gene editing systems.
[0051] Example 3: hFTO can improve the gene editing efficiency of MAD7 nuclease in soybeans.
[0052] Besides Cas9, other nucleases can be used for gene editing. In this example, another representative nuclease, MAD7, was selected to test the effect of hFTO. MAD7 is a type VA nuclease (LIN Q, ZHU Z, LIU G, et al. Genome editing in plants with MAD7 nuclease[J]. J Genet Genomics, 2021, 48(6):444-51). The editing efficiency of conventional MAD7-based editing systems in soybeans is very low and cannot meet the requirements for commercial use. The inventors constructed the MAD7-based editing vector pGES-MAD7 and simultaneously constructed the MAD7 vector pGES-MAD7-hFTO expressing hFTO (vector structure see...). Figure 5 The soybean hairy root system was still used to select four target sites (see...). Figure 6 Gene editing efficiency was tested using (horizontal axis labeled), and the results are as follows: Figure 6 As shown, the editing efficiency of pGES-MAD7-hFTO at all four target sites tested was significantly higher than that of the control vector pGES-MAD7, increasing the editing efficiency by 1.3-5.4 times. These results indicate that hFTO can also significantly improve the editing efficiency of MAD7 nuclease in soybean.
[0053] Example 4: hFTO can improve the editing efficiency of guided editing systems in rice.
[0054] To test whether hFTO can improve editing efficiency in different editors in various plants, this embodiment further tested the effect in rice, a monocotyledonous model plant. Primed editors are a new type of editing method developed in recent years, capable of precisely performing different types of base changes and small fragment deletions and insertions within plants, with a wider range of applications. However, the efficiency of primed editing remains low, greatly limiting its use. The inventors added an hFTO expression cassette to the rice primed editor enpPE2 (LI J, CHEN L, LIANG J, et al. Development of a highly efficient primeeditor 2 system in plants[J]. Genome Biol, 2022, 23(1):161.), and to further improve efficiency, used the rice endogenous promoter pOsUBQ to drive hFTO expression. The constructed editing vector was named enpPE2-hFTO (structure shown in...). Figure 7 The editing efficiency of the enpPE2-hFTO vector was evaluated using a stable rice transformation system, and the results are as follows: Figure 8 As shown in the figure, six target sites (OsSERK1, OsSLR1, OsHd1, OsGL2, OsDL, and OsLAZY) were selected for editing. Analysis of the target sites and statistical editing efficiency in the T0 generation stable transformant lines revealed that the average editing efficiency of the enpPE2-hFTO vector at the six target sites was 52.48%, significantly higher than the average editing efficiency of the control vector enpPE2 (33.49%). Further analysis showed that the homozygous editing efficiency mediated by enpPE2-hFTO at the six target sites in the T0 generation stable transformant rice plants was 26.88%, significantly higher than the control vector enpPE2 (13.71%). These results indicate that hFTO can also be used to improve gene editing efficiency in monocotyledonous rice, and it also has a significant effect on improving the editing efficiency of guided gene editing systems.
[0055] Example 5: Overexpression of hFTO can increase chromatin openness and CRISPR-Cas expression levels.
[0056] The inventors further explored the specific mechanism by which hFTO can improve gene editing efficiency. Because hFTO possesses m... 6 The inventors tested the role of A demethylation in poly(A) RNA in transgenic plants expressing pGES401 and pGES501. 6 Level A. Compared with wild-type Wm82 and pGES401, m 6A was significantly reduced in pGES501 transgenic plants, confirming that hFTO expression in pGES501 transgenic lines can indeed cause poly(A)RNA m... 6 A demethylation ( Figure 10 Then, the inventors conducted TUNEL experiments on shoot tips and roots, and found that the degree of chromatin opening in pGES501 transgenic plants was significantly increased compared to pGES401. Figure 11 The inventors also observed upregulation of sgRNA and CRISPR-Cas9 expression in plants using pGES501-based hFTO expression. Figure 12 Furthermore, ChIP-qPCR was performed on the CRISPR / Cas9 gene of pGES401 and pGES501 transgenic plants to detect the histone marker H3K27me3, which represses transcription. The results showed that the expression level of H3K27me3 in CRISPR / Cas9 was significantly lower in pGES501 transgenic plants compared to pGES401 transgenic plants. Figure 13 This indicates that FTO reduces the level of repressive histone modifications, leading to increased chromatin opening and Cas9 transcript expression. This is consistent with m 6 Disorders of A-methylation affect the enrichment of active or repressive histone markers, leading to the consistent finding of transcriptional activation. Therefore, hFTO overexpression results in chromatin opening, affecting the level of repressive histone modifications in CRISPR / Cas9 transgenes and thus increasing their expression. Both of these factors contribute to improved gene editing efficiency.
[0057] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A composition characterized in that, Compositions comprising: 1) an FTO protein having RNA demethylation function; 2) a CRISPR-Cas gene editing system comprising a Cas nuclease and a guide RNA, wherein the Cas nuclease and the guide RNA are capable of forming a complex and editing a target nucleotide; wherein the editing is selected from the group consisting of an insertion of at least one polynucleotide, a deletion of at least one polynucleotide, a molecular alteration of at least one polynucleotide, a substitution of at least one polynucleotide, and a combination of at least two of the foregoing; and the FTO protein of 1) and the Cas nuclease of 2) are not fused together; wherein the FTO protein has an amino acid sequence as set forth in SEQ ID NO: 1; wherein the FTO protein is produced from an expression cassette comprising nucleic acid molecules having sequences as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, connected in order; or an expression cassette comprising nucleic acid molecules having sequences as set forth in SEQ ID NO: 5, SEQ ID NO: 3, SEQ ID NO: 4, connected in order.
2. A vector system capable of producing the composition of claim 1, and the FTO protein and the Cas nuclease are produced from different expression cassettes.
3. A bacterial host cell characterized in that, The host cell contains the composition of claim 1, or the vector system of claim 2.
4. The bacterial host cell according to claim 3, characterized in that The bacterial host cell is an E. coli or Agrobacterium cell.
5. A non-renewable soy host cell characterized by, Compositions comprising, or a vector system producing, the following 1) and 2): 1) an FTO protein having RNA demethylation function, having an amino acid sequence as set forth in SEQ ID NO: 1, produced from an expression cassette comprising nucleic acid molecules having sequences as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, connected in order; 2) a CRISPR-Cas gene editing system comprising a Cas nuclease and a guide RNA, wherein the Cas nuclease and the guide RNA are capable of forming a complex and editing a target nucleotide; wherein the editing is selected from the group consisting of an insertion of at least one polynucleotide, a deletion of at least one polynucleotide, a molecular alteration of at least one polynucleotide, a substitution of at least one polynucleotide, and a combination of at least two of the foregoing; wherein the FTO protein and the Cas nuclease of the composition are not fused together.
6. A non-renewable rice host cell, characterized in that, The host cell contains the composition of the following 1) and 2), or a vector system producing the composition of the following 1) and 2) from different expression cassettes: 1) an FTO protein having RNA demethylation function, having an amino acid sequence as set forth in SEQ ID NO: 1, produced from an expression cassette comprising nucleic acid molecules having sequences as set forth in SEQ ID NO: 5, SEQ ID NO: 3, SEQ ID NO: 4, connected in order; 2) a CRISPR-Cas gene editing system consisting of a Cas nuclease and a guide RNA, wherein the Cas nuclease and the guide RNA are capable of forming a complex and editing a target nucleotide; wherein the editing is selected from the group consisting of an insertion of at least one polynucleotide, a deletion of at least one polynucleotide, a molecular alteration of at least one polynucleotide, a substitution of at least one polynucleotide, and a combination of at least two of the foregoing; wherein the FTO protein and the Cas nuclease are not fused together in the composition.
7. A method of editing a polynucleotide in the genome of a soybean target cell, comprising, The method comprises: 1) providing a Cas nuclease to a cell; 2) providing at least one FTO protein with RNA demethylation function to the cell, and the FTO protein is not fused together with the Cas nuclease in 1); 3) incubating the target cell to allow the Cas nuclease and the guide RNA to form a complex, which recognizes the target polynucleotide, binds to the target polynucleotide, and makes a nick in the target polynucleotide or cuts the target polynucleotide and edits it; wherein the editing is selected from the group consisting of an insertion of at least one polynucleotide, a deletion of at least one polynucleotide, a molecular alteration of at least one polynucleotide, a substitution of at least one polynucleotide, and a combination of at least two of the foregoing; wherein the FTO protein is produced by an expression cassette consisting of nucleic acid molecules of sequences of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 connected in order.
8. A method of editing a polynucleotide in the genome of a target cell of a rice plant, comprising, The method comprises: 1) providing a Cas nuclease to a cell; 2) providing at least one FTO protein with RNA demethylation function to the cell, and the FTO protein is not fused together with the Cas nuclease in 1); 3) incubating the target cell to allow the Cas nuclease and the guide RNA to form a complex, which recognizes the target polynucleotide, binds to the target polynucleotide, and makes a nick in the target polynucleotide or cuts the target polynucleotide and edits it; wherein the editing is selected from the group consisting of an insertion of at least one polynucleotide, a deletion of at least one polynucleotide, a molecular alteration of at least one polynucleotide, a substitution of at least one polynucleotide, and a combination of at least two of the foregoing; wherein the FTO protein is produced by an expression cassette consisting of nucleic acid molecules of sequences of SEQ ID NO: 5, SEQ ID NO: 3, and SEQ ID NO: 4 connected in order.
Citation Information
Patent Citations
A:t to c:g base editors and uses thereof
WO2020181180A1
A transgenic plant cell and a method for producing the transgenic plant
CN108949806A