A method for genetic transformation of sea buckthorn by agrobacterium-mediated flower immersion

By using Agrobacterium-mediated flower immersion method and fluorescence detection technology, the mCherry gene was successfully transferred into sea buckthorn fruit, solving the problem of low genetic transformation efficiency in sea buckthorn and achieving rapid and stable gene expression and transformation, providing technical support for sea buckthorn genetic engineering research.

CN117867015BActive Publication Date: 2026-02-03DALIAN NATIONALITIES UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311782371.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-22
Publication Date
2026-02-03
Estimated Expiration
2043-12-22

AI Technical Summary

Technical Problem

There are few reports on genetic transformation research of sea buckthorn in the current technology, which limits the development of sea buckthorn genetic engineering research and results in low efficiency of functional gene transformation.

Method used

A highly efficient genetic transformation system for sea buckthorn was established by using Agrobacterium-mediated flower infiltration, infecting sea buckthorn inflorescences with Agrobacterium solution carrying the pCAMBIA-1300-mCherry expression vector, and verifying gene expression by combining fluorescence detection and real-time quantitative PCR.

Benefits of technology

The transformation cycle was significantly shortened, and a stable gene expression and rapid and reliable transformation method were achieved, laying the foundation for the verification of sea buckthorn gene function and the cultivation of new varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005577023230000061
    Figure GDA0005577023230000061
  • Figure GDA0005577023230000071
    Figure GDA0005577023230000071
  • Figure HDA0004624067490000011
    Figure HDA0004624067490000011
Patent Text Reader

Abstract

The application belongs to the technical field of forest tree genetic engineering, and discloses a genetic transformation method of Hippophae rhamnoides L. mediated by Agrobacterium LBA4404. The method comprises the following steps: flower branch selection, activation and culture of Agrobacterium, preparation of Agrobacterium transformation solution, infection of Hippophae rhamnoides L. plants, mCherry fluorescence detection, and mCherry expression quantity detection. After the Agrobacterium LBA4404 containing the mCherry reporter gene is used to dip the female flower inflorescence of Hippophae rhamnoides L. after pollination, transgenic fruits are obtained. The method can greatly shorten the transformation period, the experimental results are relatively intuitive through fluorescence observation, and the method can be used for long-term stable expression, thereby providing a quick and reliable method for gene function verification of Hippophae rhamnoides L. and laying a foundation for cultivation of new transgenic Hippophae rhamnoides L. varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of forest tree genetic engineering technology, specifically relating to an Agrobacterium-mediated genetic transformation method for sea buckthorn by flower soaking. Background Technology

[0002] Sea buckthorn (Hippophae rhamnoides L.) is a deciduous perennial shrub or small tree belonging to the genus Hippophae in the family Elaeagnaceae, mainly distributed in temperate regions of Eurasia. Sea buckthorn grows rapidly, is drought-tolerant, salt-tolerant, and wind-resistant, making it an important ecological woody oilseed tree species for soil and water conservation and desertification control. Sea buckthorn is dioecious, with 6 species and 13 subspecies. Its fruits, leaves, and stems are rich in various bioactive components beneficial to human health, possessing high nutritional and medicinal value, and are widely used in the food, daily chemical, and pharmaceutical industries.

[0003] While significant progress has been made in molecular biology research on sea buckthorn, studies on its genetic transformation are scarce, which has long hampered the development of sea buckthorn genetic engineering research. Therefore, exploring transgenic methods for sea buckthorn and improving the efficiency of functional gene transformation is one of the key issues urgently needing to be addressed in sea buckthorn genetic engineering and genetic breeding research. Summary of the Invention

[0004] To overcome the shortcomings of existing technologies, this invention provides an Agrobacterium-mediated flower-immersion genetic transformation method for sea buckthorn, prepares an Agrobacterium transformation solution carrying the pCAMBIA-1300-mCherry expression vector, establishes a high-efficiency flower-immersion transformation system for sea buckthorn, and provides technical support for functional genomics research on sea buckthorn.

[0005] The above-mentioned objective of this invention is achieved through the following technical solution: a method for Agrobacterium-mediated genetic transformation of sea buckthorn by flower soaking, comprising the following steps:

[0006] 1. Selection of flowering branches: Select sea buckthorn branches that are 40-60cm in length, free from pests and diseases, and have plump female flowers during the pollination period;

[0007] 2. Activation and culture of Agrobacterium: Plasmids carrying the mCherry reporter gene were extracted and transformed into Agrobacterium, and cultured in YEB liquid medium containing streptomycin, rifampin and kanamycin;

[0008] 3. Preparation of Agrobacterium transformation medium: After centrifuging the cultured Agrobacterium containing the pCAMBIA-1300-mCherry expression vector, the bacterial cells were resuspended in buffer.

[0009] 4. Infecting sea buckthorn plants: Immerse sea buckthorn branches containing inflorescences in a resuspended bacterial solution for 10-15 minutes; incubate in the dark at 20-24℃ for 2-3 days, then culture normally, and collect mature fruits after 3 months.

[0010] 5. mCherry fluorescence detection: Observation was performed using a LUYOR-3415RG handheld fluorescence observer;

[0011] 6. mCherry expression level detection: Total RNA was extracted from the fruit, and the expression level of the mCherry gene was analyzed using real-time quantitative PCR (qRT-PCR).

[0012] Furthermore, the sea buckthorn branches in step 1 were grown at the Liaoning Provincial Dryland Agricultural and Forestry Research Institute.

[0013] Furthermore, the mCherry reporter gene sequence described in step 2 is shown in SEQ ID NO.1.

[0014] Furthermore, in step 2, the pCAMBIA-1300 plasmid containing the mCherry reporter gene is transformed into LBA4404 Agrobacterium competent cells using a freeze-thaw method.

[0015] Furthermore, the OD600 value of the Agrobacterium-mediated transformation fluid in step 3 is 0.8-1.0.

[0016] Furthermore, in step 4, during the dark culture process, the bacteria are resuspended and reinfected once every 1 day.

[0017] Furthermore, in step 5, a LUV-590A fluorescence imaging filter (LUYOR) is used for red fluorescence observation and imaging.

[0018] Furthermore, the sequences of the specific primers in step 6 are shown in SEQ ID NO.2-5.

[0019] The beneficial effects of this invention compared with the prior art are as follows: by using Agrobacterium LBA4404 containing the mCherry reporter gene to infect the female flower inflorescences of sea buckthorn after pollination, transgenic fruits can be obtained. This not only greatly shortens the transformation cycle, but also makes the experimental results more intuitive through fluorescence observation. Furthermore, the transgenic fruit can be stably expressed over a long period of time, providing a rapid and reliable method for verifying the function of sea buckthorn genes. At the same time, it can lay the foundation for cultivating new transgenic sea buckthorn varieties. Attached Figure Description

[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0021] Figure 1 This is a pCAMBIA-mCherry plasmid map;

[0022] Figure 2 This is an mCherry fluorescence detection image;

[0023] Figure 3This is a graph showing the expression level of mCherry. Detailed Implementation

[0024] The present invention is described in detail below through specific embodiments, but this does not limit the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can all be obtained commercially.

[0025] Example 1: Activation and culture of Agrobacterium

[0026] (1) Extraction of pCAMBIA1300-mCherry plasmid

[0027] pCAMBIA1300-mCherry plasmid image as follows Figure 1 As shown, *E. coli* DH5α containing the pCAMBIA1300-mCherry plasmid, stored at -80℃, was picked and plated on LB agar containing 50 mg / L kanamycin. The culture was incubated upside down at 37℃ for 12–16 h. Single colonies of normal growth were picked and dissolved in a 200 μL centrifuge tube containing 10 μL of sterile water to fully suspend the bacteria. 5 μL of the suspension was used for colony PCR detection. The remaining 5 mL of bacterial suspension was added to LB liquid agar containing 50 mg / L kanamycin and incubated at 37℃ with shaking at 200 rpm for 14–16 h.

[0028] (2) Preparation of Agrobacterium LBA4404 competent cells

[0029] ① Pick Agrobacterium LBA4404 stored at -80℃ and spread it on YEB solid medium containing 100 mg / L rifampicin and 100 mg / L streptomycin. Incubate upside down at 28℃ for 18-20 h.

[0030] ② Pick a single colony that is growing normally and inoculate it into 10 mL of liquid YEB medium containing 100 mg / L rifampicin, 100 mg / L streptomycin and 50 mg / L kanamycin. Incubate at 28°C with shaking at 200 rpm for 18 h.

[0031] ③ Take 0.5 mL of the activated bacterial solution and inoculate it into a 500 mL Erlenmeyer flask containing 50 mL of LYEB liquid medium. Incubate at 28°C with gentle shaking at 200 rpm until the bacterial solution reaches its OD value. 600 The value is 0.5;

[0032] ④ Transfer the bacterial culture to a 50mL polypropylene plastic centrifuge tube, place it on ice for 10 minutes, and centrifuge at 4000rpm for 5 minutes at 4℃ to collect the bacterial precipitate.

[0033] ⑤ Discard the supernatant, gently resuspend the bacterial cells in 4 mL of freshly prepared 20 mmol / L CaCl2, and collect the bacterial cell precipitate by centrifugation at 4000 rpm for 5 min at 4℃.

[0034] ⑥ Discard the supernatant, gently resuspend the bacterial cells in 2 mL of 20 mmol / L CaCl2, and dispense 100 μL into each pre-chilled 1.5 mL tube on ice. The bacterial cells can be used directly for transformation.

[0035] (3) Transformation of Agrobacterium LBA4404 and screening of positive strains

[0036] ① Take 1 μL of pCAMBIA1300-mCherry plasmid and add it to LBA4404 competent cells, and let it stand on ice for 30 min;

[0037] ② Place the centrifuge tubes on a float and freeze them in liquid nitrogen for 5 minutes. Then immediately remove them and place them in a water bath at 37°C for 5 minutes for heat shock.

[0038] ③ Add 900 μL of YEB liquid culture medium preheated to 37°C to the heat-shocked competent cells, and culture at 37°C with shaking at 200 rpm for 2 h, followed by centrifugation at 4000 rpm for 5 min.

[0039] ④ Discard 800 μL of supernatant, resuspend the remaining liquid and bacterial precipitate thoroughly, and spread them on YEB solid selection medium (100 mg / L rifampin + 100 mg / L streptomycin + 50 mg / L kanamycin). Incubate upside down at 28°C for 40-48 h. Pick single colonies that grow normally on YEB solid selection medium for colony PCR identification.

[0040] Example 2: Agrobacterium infection of sea buckthorn inflorescence

[0041] (1) Preparation of inoculum

[0042] ① Add Agrobacterium tumefaciens containing pCAMBIA-1300-mCherry to 5mLYEB liquid medium (containing 100mg / L streptomycin, 100mg / L rifampin and 50mg / L kanamycin) for activation, and culture at 180rpm in a shaker at 28℃ for 18-20h.

[0043] ② Add 4 mL of the activated bacterial solution from the above steps to 200 mL of LYEB liquid medium (containing 100 mg / L rifampin, 100 mg / L Str, 50 mg / L kanamycin, 10 mmol / L 2-morpholinoethanesulfonic acid and 150 mmol / L acetosyringone), and incubate at 180 rpm for about 18 h in a shaker at 28 °C.

[0044] ③ Place the bacterial culture obtained in the previous step in a centrifuge at 4℃ and centrifuge at 4000 rpm for 15 min. Discard the supernatant and collect the bacterial cells. Resuspend the bacterial cells in buffer (containing 10 mmol / L magnesium chloride, 10 mmol / L 2-morpholine ethanesulfonic acid and 150 mmol / L acetylsuccinone) to OD. 600 =0.8-1.0.

[0045] (2) Infection of sea buckthorn

[0046] ① Soak the sea buckthorn branches containing inflorescences in the resuspended bacterial solution for 10-15 minutes; repeat the infection once a day using the resuspended bacterial solution.

[0047] ② After dark cultivation at 20-24℃ for 2-3 days, normal cultivation is carried out, and mature fruits are collected after 3 months;

[0048] Example 3: Verification of Conversion Results

[0049] (1) Red fluorescent phenotype

[0050] Observations were conducted using a LUYOR-3415RG handheld fluorescence observer, with a LUV-590A fluorescence imaging filter (LUYOR) used for observing and photographing red fluorescence. Figure 2 As shown, the transformed fruit exhibited red fluorescence, while the control showed no change, indicating that the Agrobacterium tumefaciens flower immersion method successfully transferred the mCherry gene into the sea buckthorn fruit.

[0051] (2) Detection of mCherry gene overexpression effect

[0052] 1) After sampling, the samples were flash-frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted using RNAiso Plus, as follows:

[0053] ① Grind the sample into powder in a mortar with liquid nitrogen, then quickly transfer it to a centrifuge tube containing 1 mL of pre-cooled RNAiso Plus and place it at room temperature for 5 min.

[0054] ② Centrifuge at 12,000 rpm for 5 minutes at 4℃, aspirate the supernatant and transfer it to a new centrifuge tube.

[0055] ③ Add 200 μL of chloroform to the supernatant, invert the centrifuge tube to mix thoroughly until the solution emulsifies and turns milky white, and let stand at room temperature for 5 minutes.

[0056] ④ After centrifuging at 12,000 rpm for 15 minutes at 4℃, carefully remove the centrifuge tube and transfer the supernatant to another new centrifuge tube.

[0057] ⑤ Add 500 μL of isopropanol to the supernatant, invert the centrifuge tube to mix thoroughly, let stand at room temperature for 10 min, and then centrifuge at 12000 rpm for 10 min at 4℃.

[0058] ⑥ After discarding the supernatant, add 1 mL of 75% ethanol, gently blow and wash the centrifuge tube wall with a pipette, centrifuge at 7500 rpm for 5 min at 4℃, and then discard the supernatant.

[0059] ⑦ After drying the precipitate at room temperature for 10 minutes, add an appropriate amount of RNase-free water to dissolve the precipitate. Electrophoresis shows that the RNA bands are intact.

[0060] 2) Reverse transcription of mRNA

[0061] Prepare the following reaction systems according to List 1, following the instructions for the TransScript First-Strand cDNA Synthesis SuperMix reverse transcription kit:

[0062] Table 1. mRNA reverse transcription reaction system

[0063]

[0064] After mixing, place the mixture in a PCR instrument and set the program as follows: 42℃, 15 min; 85℃, 5 s. After the reaction, store the product at -20℃ for subsequent real-time quantitative PCR reactions.

[0065] 3) Real-time quantitative PCR

[0066] The cDNA obtained in the above steps was used for real-time quantitative PCR. The following reaction systems were prepared according to List 2:

[0067] Table 2. mRNA Real-time Quantitative PCR System

[0068]

[0069] After mixing, place the mixture in a real-time quantitative PCR instrument and set the program as follows: 94℃, 30s; 94℃, 5s, 60℃, 30s, 40 cycles; dissociation phase.

[0070] The internal control used is UBQ11, and the primer sequences are as follows: SEQ ID NO.4-5:

[0071] qmCherry-FP:GACTACTTGAAGCTGTCCTTCC

[0072] qmCherry-RP: CGCAGCTTCACCTTGTAGAT

[0073] qUBQ11-FP:CCAAGATACAGGACAAGGAAGG

[0074] qUBQ11-RP:TGGATGTTGTAGTCAGCAAGG

[0075] Use 2 -△△Ct The relative changes in expression levels were analyzed using a method. The results are as follows: Figure 3 As shown, the expression level of the mCherry gene was significantly increased compared to the control group. Combined with the fluorescence results of the sea buckthorn experimental group fruits, this indicates that the overexpression of mCherry in sea buckthorn fruits mediated by Agrobacterium significantly increased the expression level of this gene.

[0076] Establishing rapid and reliable transformation systems is particularly important for woody oilseed plants, as many plants are difficult to transform. Using our established Agrobacterium-mediated flower-dip method and the mCherry reporter gene, we can rapidly, efficiently, and specifically study our target genes without the need for traditional tissue culture, regeneration, and genetic transformation of sea buckthorn.

[0077] The embodiments described above are merely preferred embodiments of the present invention, and not all feasible embodiments of the present invention. Any obvious modifications made by those skilled in the art without departing from the principles and spirit of the present invention should be considered to be included within the scope of protection of the claims of the present invention.

Claims

1. A method for Agrobacterium-mediated genetic transformation of sea buckthorn flowers, characterized by the following steps: include: S1. Selection of flowering branches: Select sea buckthorn branches that are 40-60 cm in length, free from pests and diseases, and have plump female flowers during the pollination period; S2. Activation and culture of Agrobacterium: The vector pCAMBIA-1300 containing the mCherry reporter gene was transformed into LBA4404 Agrobacterium competent cells using the freeze-thaw method and cultured in YEB liquid medium containing streptomycin, rifampin and kanamycin. The mCherry reporter gene sequence is shown in SEQ ID NO.

1. S3. Preparation of Agrobacterium transformation solution: After centrifuging the cultured Agrobacterium containing the pCAMBIA-1300-mCherry expression vector, the bacterial cells were resuspended in buffer. The OD600 value of the prepared Agrobacterium transformation solution was 0.8-1.

0. S4. Infecting sea buckthorn plants: Immerse sea buckthorn branches containing inflorescences in resuspended bacterial solution for 10-15 minutes; then culture in the dark at 20-24℃ for 2-3 days, followed by normal culture. Collect mature fruits after 3 months. During the dark culture process, re-infect once every 1 day with resuspended bacterial solution. S5.mCherry fluorescence detection: Observation was performed using a LUYOR-3415RG handheld fluorescence observer; S6.mCherry expression level detection: Total RNA was extracted from the fruit, and the expression level of the mCherry gene was analyzed using qRT-pCR.

2. The method for Agrobacterium-mediated genetic transformation of sea buckthorn by flower soaking according to claim 1, characterized in that, The LUV-590A fluorescence imaging filter is used in step S5.

3. The method for Agrobacterium-mediated genetic transformation of sea buckthorn by flower soaking according to claim 1, characterized in that, The sequences of the specific primers in step S6 are shown in SEQ ID NO. 2-5.

Citation Information

Patent Citations

  • Light-operated system based on blue light and application thereof

    CN115261403A