A SNP molecular marker related to the thickness of Camellia oleifera pericarp and its application
By developing SNP molecular markers and detection methods related to the thickness of Camellia oleifera pericarp, the problem of early prediction of pericarp thickness in Camellia oleifera breeding has been solved, enabling rapid and accurate breeding selection and improving breeding efficiency and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-29
- Publication Date
- 2026-04-03
AI Technical Summary
In camellia oleifera breeding, pericarp thickness is difficult to predict in the early stages, leading to resource waste and low breeding efficiency. Traditional methods are time-consuming and labor-intensive, and pericarp thickness is a quantitative trait controlled by multiple genes, making it difficult to select directly through phenotypic information.
We developed SNP molecular markers related to the thickness of Camellia oleifera pericarp, along with their primer sets, kits, and gene chips, for rapid detection of pericarp thickness and for breeding based on genomic information.
This method enables rapid and accurate identification of the thickness of the camellia peel, shortens the breeding cycle, improves selection efficiency, increases camellia oil yield and economic benefits, and provides a theoretical basis for camellia breeding.
Smart Images

Figure BDA0004646777460000061 
Figure BDA0004646777460000071 
Figure BDA0004646777460000072
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural molecular biology, specifically relating to a SNP molecular marker related to the thickness of Camellia oleifera pericarp and its application. Background Technology
[0002] Camellia oleifera, a woody oilseed crop, is widely distributed in the middle and lower reaches of the Yangtze River and has a long history of cultivation. Gaozhou Camellia oleifera (Camellia drupifera) is a large-fruited variety, possessing advantages over common Camellia oleifera (Camellia oleifera) such as larger fruits, higher oil content in the kernels, taller plants, and higher fruit-bearing rate, making it extremely high-yielding. However, its pericarp consumes more energy during fruit growth to accumulate pericarp thickness, limiting the accumulation of kernels and oil. If pericarp thickness can be predicted early in the breeding process, varieties with thinner pericarps can be selectively planted to compensate for this resource waste in later production.
[0003] However, Camellia oleifera has a complex genetic background, high heterozygosity, long breeding cycles, and low efficiency. Furthermore, pericarp thickness is a quantitative trait controlled by multiple genes, posing significant challenges to Camellia oleifera breeding and its genetic research. Traditional methods for early identification of Camellia oleifera require continuous tracking and testing of various samples over many years, resulting in a large workload and wasted human and material resources. If individuals could be selected directly at the genomic level early on, without relying on phenotypic information, selection efficiency could be significantly improved, the breeding process accelerated, and the selection time shortened. Therefore, there is an urgent need to provide a method for rapid identification of Camellia oleifera pericarp thickness using molecular markers. Summary of the Invention
[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a SNP molecular marker related to the thickness of Camellia oleifera pericarp.
[0005] The present invention also proposes a primer set for detecting the above-mentioned SNP molecular markers.
[0006] The present invention also proposes a reagent kit.
[0007] This invention also proposes a gene chip.
[0008] This invention also proposes applications of the aforementioned molecular markers, primer sets, kits, and / or gene chips.
[0009] The present invention also proposes a method for detecting the above-mentioned SNP sites.
[0010] This invention also proposes a method for detecting the thickness of camellia peel.
[0011] According to a first aspect of the present invention, a SNP molecular marker related to the thickness of Camellia oleifera pericarp is proposed, said SNP molecular marker comprising at least one of the following (1)-(10):
[0012] (1) The first SNP molecular marker is located at nucleotide 27899742 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is A or C;
[0013] (2) The second SNP molecular marker is located at nucleotide 27899812 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;
[0014] (3) The third SNP molecular marker is located at nucleotide 27900267 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;
[0015] (4) The fourth SNP molecular marker is located at nucleotide 27900460 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is T or C;
[0016] (5) The fifth SNP molecular marker, which is located at nucleotide 27900829 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;
[0017] (6) The sixth SNP molecular marker, which is located at nucleotide 27901276 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is C or G;
[0018] (7) The seventh SNP molecular marker, which is located at nucleotide 27901300 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is C or T;
[0019] (8) The eighth SNP molecular marker, which is located at nucleotide 27901344 on chromosome HIC_4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;
[0020] (9) The ninth SNP molecular marker, which is located at nucleotide 27902119 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is T or G;
[0021] (10) The tenth SNP molecular marker, which is located at nucleotide 27902242 on chromosome HIC4 of the Camellia oleifera reference genome, and the nucleotide base at this site is G or A;
[0022] The reference genome of Camellia oleifera is the wild Camellia oleifera diploid (https: / / github.com / Hengfu-Yin / CON_genome_data) reference genome.
[0023] According to a second aspect of the present invention, a primer set for amplifying the above-mentioned SNP molecular markers is provided.
[0024] According to a third aspect of the present invention, a kit is provided comprising the aforementioned primer set.
[0025] According to a fourth aspect of the present invention, a gene chip is provided, the gene chip comprising the aforementioned primer set.
[0026] According to a fifth aspect of the present invention, the application of the above-described SNP molecular markers, primer sets, kits, and / or gene chips in any of the following 1)-10):
[0027] 1) Detect the thickness of the camellia fruit peel;
[0028] 2) Identification and screening of Camellia oleifera with different peel thicknesses;
[0029] 3) Select and breed camellia varieties with a pericarp thickness of 4–7 mm;
[0030] 4) Select and breed camellia varieties with a pericarp thickness greater than 8 mm;
[0031] 5) Select and breed camellia varieties with a pericarp thickness of 4–8 mm;
[0032] 6) Select and breed camellia varieties with a pericarp thickness of less than 4 mm;
[0033] 7) Select and breed camellia varieties with a pericarp thickness greater than 12mm;
[0034] 8) Molecular marker-assisted breeding of Camellia oleifera;
[0035] 9) Camellia oleifera breeding;
[0036] 10) Prepare products for Camellia oleifera breeding.
[0037] In some embodiments of the present invention, the application is in the genotyping of Camellia oleifera.
[0038] According to a sixth aspect of the present invention, a method for detecting the thickness of Camellia oleifera pericarp using the above-mentioned SNP molecular markers is provided, the method comprising the following steps:
[0039] S1. Extracting genomic DNA from Camellia oleifera;
[0040] S2. Perform polymorphism detection of the SNP molecular marker on the genomic DNA extracted in step S1, and determine the thickness of the camellia peel based on the detection results.
[0041] In some embodiments of the present invention, when the SNP molecular marker is the first SNP molecular marker, if the detected site base is A, the thickness of the Camellia oleifera pericarp is 4-7 mm; if the detected site base is C, the thickness of the Camellia oleifera pericarp is greater than 8 mm.
[0042] When the SNP molecular marker is the second SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.
[0043] When the SNP molecular marker is the third SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4–8 mm.
[0044] When the SNP molecular marker is the fourth SNP molecular marker, if the detected site base is T, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is C, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4–8 mm.
[0045] When the SNP molecular marker is the fifth SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is less than 4 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is 4–8 mm.
[0046] When the SNP molecular marker is the sixth SNP molecular marker, if the detected site base is C, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.
[0047] When the SNP molecular marker is the seventh SNP molecular marker, if the detected site base is C, the thickness of the Camellia oleifera pericarp is 4-7 mm; if the detected site base is T, the thickness of the Camellia oleifera pericarp is greater than 8 mm.
[0048] When the SNP molecular marker is the eighth SNP molecular marker, if the detected site base is G, the thickness of the Camellia oleifera pericarp is 4-8 mm; if the detected site base is A, the thickness of the Camellia oleifera pericarp is greater than 8 mm; if the detected site is a heterozygous genotype, the pericarp thickness is less than 4 mm.
[0049] When the SNP molecular marker is the ninth SNP molecular marker, if the detected site base is T, the thickness of the Camellia oleifera pericarp is in the range of 4 to 8 mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 12 mm.
[0050] When the SNP molecular marker is the tenth SNP molecular marker, if the detected site base is A, the thickness of the Camellia oleifera pericarp is in the range of 4-7 mm; if the detected site base is G, the thickness of the Camellia oleifera pericarp is greater than 8 mm.
[0051] In some embodiments of the present invention, in step S1, the extraction of genomic DNA from Camellia oleifera is performed using a simplified CTAB method (hexadecyltrimethylammonium bromide method).
[0052] In some embodiments of the present invention, in step S2, sequencing is used to detect SNP sites.
[0053] A method for breeding Camellia oleifera includes the following steps: using the above-mentioned SNP molecular marker method to detect the pericarp thickness of Camellia oleifera, selecting Camellia oleifera with a pericarp thickness range of 4-7 mm, Camellia oleifera with a pericarp thickness greater than 8 mm, Camellia oleifera with a pericarp thickness range of 4-8 mm, Camellia oleifera with a pericarp thickness less than 4 mm, or Camellia oleifera with a pericarp thickness greater than 12 mm for subsequent breeding.
[0054] The SNP molecular markers related to the thickness of Camellia oleifera fruit peel according to embodiments of the present invention have at least the following beneficial effects: By using the SNP molecular markers related to the thickness of Camellia oleifera fruit peel of the present invention, the thickness of Camellia oleifera fruit peel can be quickly and accurately identified. This can shorten the Camellia oleifera breeding cycle and increase tea oil yield, economic benefits, and commercial value, laying a theoretical foundation for future cultivation of high-yield, large-fruited Camellia oleifera, and providing a reference for other related studies on Camellia oleifera fruit peel thickness, thus having important theoretical guiding significance for my country's Camellia oleifera industry.
[0055] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description
[0056] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:
[0057] Figure 1 This is a graph showing the normality test results of the peel thickness phenotypic data in Example 1 of the present invention;
[0058] Figure 2 This is a graph showing the normality test results of the peel thickness phenotypic data in Example 1 of the present invention;
[0059] Figure 3 This is a Manhattan diagram showing the relationship between SNP locus genotypes and individual pericarp thickness in Example 1 of this invention.
[0060] Figure 4 This is an agarose gel electrophoresis image from Example 1 of the present invention, where M is the maker and 1-12 are PCR products, respectively.
[0061] Figure 5 This is a sequencing result diagram of SNP1 in Example 1 of the present invention;
[0062] Figure 6 This is a sequencing result diagram of SNP2 in Example 1 of the present invention;
[0063] Figure 7 This is a sequencing result diagram of SNP3 in Example 1 of the present invention;
[0064] Figure 8 This is a sequencing result diagram of SNP4 in Example 1 of the present invention;
[0065] Figure 9 This is a sequencing result diagram of SNP5 in Example 1 of the present invention;
[0066] Figure 10 This is a sequencing result diagram of SNP6 in Example 1 of the present invention;
[0067] Figure 11 This is a sequencing result diagram of SNP7 in Example 1 of the present invention;
[0068] Figure 12 This is a sequencing result diagram of SNP8 in Example 1 of the present invention;
[0069] Figure 13 This is a sequencing result diagram of SNP9 in Example 1 of the present invention;
[0070] Figure 14 This is a sequencing result diagram of SNP10 in Example 1 of the present invention. Detailed Implementation
[0071] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0072] An embodiment of the present invention is: a SNP molecular marker related to the thickness of Camellia oleifera pericarp.
[0073] 1. Obtaining SNP molecular markers
[0074] (1) Selecting materials
[0075] The *Camellia oleifera* materials used in this invention were sourced from the Zhongkai Camellia oleifera base in Huizhou, and were harvested in late October 2022 (October 19-25), totaling 100 germplasm resources. The harvested fruits were uniformly oriented and intact across all three sides of the tree, with 30 fruits collected from each germplasm resource for phenotypic data collection. The harvested leaves were used for molecular library construction.
[0076] 2. Sample processing and phenotypic analysis
[0077] Phenotypic analysis of the pericarp thickness of 100 harvested samples of Camellia oleifera was performed. The specific analysis method is as follows: the pericarp of the Camellia oleifera was cut along the transverse diameter with a knife, and the widest and narrowest points were measured. Finally, the mean and standard deviation of three fruits were calculated. The results of the pericarp thickness of the 100 fruits are as follows. Figure 1-2 As shown.
[0078] 3. Genotype data collection and analysis
[0079] Genotypic data for all samples were obtained through sequencing, with the specific steps as follows:
[0080] (1) Genomic DNA was extracted from tea leaves using a modified CTAB method.
[0081] (2) Construction of RAD-seq library
[0082] The library construction method is referenced in (Rapid SNP Discovery and Genetic Mapping Using Sequenced RAD Markers), as follows:
[0083] 1) Digest the genome obtained in step (1) with Taq I and ligate the P1 adapter (containing barcode);
[0084] 2) Randomly interrupt and connect to connector P2;
[0085] 3) Sequences containing both P1 and P2 adapters were screened by PCR;
[0086] 4) Select fragments of 400bp-700bp for sequencing. On average, each sample yielded 3G of data, with an average sequencing depth of 15×.
[0087] 4. Genome-wide association analysis and locus mining
[0088] Genome-wide association analysis (GWAS) was performed using Plink software. Specifically, after quality control of the genome, highly homogeneous SNPs with minor allele frequencies ≥0.05 and locus integrity ≥0.8 were used as genotypes. GWAS was conducted using three software programs: TASSEL, FaST-LMM, and EMMAX, with the pericarp thickness of *Camellia oleifera* from Gaozhou as the phenotype, combined with genotype data. Ultimately, an association result was obtained for each variant locus. The calculated p-values were further used to plot Manhattan plots, as shown below. Figure 3 As shown in Table 1, 10 SNP loci associated with the pericarp thickness of Camellia oleifera in Gaozhou were selected based on the P-value. The specific SNP locus information is shown in Table 1. The reference genome of Camellia oleifera is the wild Camellia oleifera diploid genome (https: / / github.com / Hengfu-Yin / CON_genome_data).
[0089] Table 1. Statistical information of 10 SNP sites
[0090]
[0091]
[0092] 5. Correlation analysis between genotype and phenotype
[0093] After analyzing the phenotypes of the above 10 SNP markers and the pericarp thickness of 100 Camellia oleifera germplasm resources, it was found that the above SNP markers were significantly correlated with the pericarp thickness of Camellia oleifera. The range of pericarp thickness corresponding to different SNP markers is shown in Table 2.
[0094] Table 2
[0095]
[0096]
[0097] 6. Specificity verification
[0098] The aforementioned 10 SNP molecular markers were used to genotype 20 different Camellia oleifera samples (completely different from the 100 Camellia oleifera samples mentioned above). The genotyping method is as follows:
[0099] (1) Collection of tea leaf samples from Gaozhou and extraction of DNA
[0100] The camellia oil leaf samples to be tested were from Gaozhou camellia oil from the Xinfeng base. Twenty samples were randomly selected, and DNA was extracted using a modified CTAB method.
[0101] (2) Amplify nucleotide fragments containing SNP sites
[0102] Using the genomic DNA extracted from the Gaozhou tea leaf samples as templates, the fragments were amplified using forward primer F and reverse primer R.
[0103] The primer sequences are as follows:
[0104] F:ATGGAATCTTCAGCAAAAACCAAGTTGG (SEQ ID NO: 2);
[0105] R: CTTATAAAACTCCATGACACAGAAGTTGC (SEQ ID NO: 3).
[0106] (3) Sequencing to identify SNP loci genotypes
[0107] The PCR products obtained in the aforementioned steps were first detected by 1.5% agarose gel electrophoresis, and the result showed a single specific band (see...). Figure 4 The target fragment is 1311 bp, and then unidirectional sequencing is performed on a sequencer to identify the genotypes at positions 32, 53, 180, 211, 223, 329, 338, 364, 374, and 563 bp (i.e., the SNP markers of this invention) in the sequence of SEQ ID NO: 1. Exemplary diagrams of the sequencing peaks at the SNP sites are shown below. Figure 5-14 As shown.
[0108] The sequence SEQ ID NO:1 is as follows:
[0109]
[0110] The typing and phenotypic results of 20 Camellia oleifera samples are shown in Table 3-12.
[0111] Table 3
[0112]
[0113]
[0114] Table 4
[0115]
[0116]
[0117] Table 5
[0118]
[0119]
[0120] Table 6
[0121]
[0122]
[0123] Table 7
[0124]
[0125] Table 8
[0126]
[0127]
[0128] Table 9
[0129]
[0130]
[0131] Table 10
[0132]
[0133]
[0134] Table 11
[0135]
[0136]
[0137] Table 12
[0138]
[0139]
[0140] The test results are shown in Tables 3-12. As can be seen from the tables, the SNP molecular markers of the present invention can be accurately used for the detection of Camellia oleifera peel thickness, and can realize the rapid breeding of varieties with different Camellia oleifera peel thicknesses.
[0141] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. The application of a reagent for detecting SNP molecular markers associated with the thickness of Camellia oleifera pericarp in any of the following 1)-4): 1) Detect the thickness of the camellia peel; 2) Identification and screening of Camellia oleifera with different peel thicknesses; 3) Camellia oleifera breeding; 4) Preparation of products for Camellia oleifera breeding; The camellia oleifera breeding program is a program for breeding camellia oleifera fruit peel thickness. The SNP molecular marker is located at 53 bp of the sequence shown in SEQ ID NO:1, and the nucleotide base is G or A; When the SNP molecular marker detects a site base of G, the thickness of the camellia peel is 4-8 mm; if the detected site base is A, the thickness of the camellia peel is greater than 8 mm; if the detected site is a heterozygous genotype, the peel thickness is less than 4 mm.
2. The application according to claim 1, characterized in that, The reagent is a primer set, the sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:
3.
3. A method for detecting the thickness of Camellia oleifera pericarp using the SNP molecular markers as described in claim 1, characterized in that, The method includes the following steps: S1. Extracting genomic DNA from Camellia oleifera; S2. Perform polymorphism detection of the SNP molecular markers on the genomic DNA extracted in step S1, and determine the thickness of the camellia peel based on the detection results. When the SNP molecular marker detects a site base of G, the thickness of the camellia peel is 4-8 mm; if the detected site base is A, the thickness of the camellia peel is greater than 8 mm; if the detected site is a heterozygous genotype, the peel thickness is less than 4 mm.
4. The method according to claim 3, characterized in that, Genomic DNA was extracted from Camellia oleifera using a simplified CTAB method.
5. The method according to claim 3, characterized in that, The polymorphism detection was performed using sequencing.
6. A method for breeding Camellia oleifera, characterized in that, The method includes the following steps: using the method described in any one of claims 3-5, selecting Camellia oleifera with a peel thickness range of 4-8 mm or Camellia oleifera with a peel thickness of less than 4 mm for subsequent breeding.
Citation Information
Patent Citations
SNP molecular marker related to content of eicosenoic acid in camellia oleifera seed oil and application of SNP molecular marker
CN111518943A
SNP (Single Nucleotide Polymorphism) molecular marker for identifying camellia oleifera variety and application thereof
CN115852027A