Herbicide-tolerant rice hydroxyphenylpyruvate dioxygenase mutant and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a kind of by gene mutation technology to source from rice to para-hydroxyphenylpyruvate dioxygenase (HPPD) is directed evolution, to improve its HPPD inhibitor herbicide resistance, and further discloses the application of the mutant and its coding gene in the field of new HPPD inhibitor resistant crops cultivation.The herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant of the application is obtained by in vitro random mutation technology to the plant source HPPD gene OsHPPD, and then a plant-derived HPPD mutant with HPPD inhibitor resistance is obtained, so that the HPPD inhibitor resistance is improved.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for directed evolution of p-hydroxyphenylpyruvate dioxygenase (HPPD) in rice through gene mutation technology to improve its resistance to HPPD inhibitor herbicides. Furthermore, it discloses the application of this mutant and its encoding gene in the field of cultivating novel HPPD inhibitor-resistant crops. Background Technology

[0002] p-Hydroxyphenylpyruvate dioxygenase (HPPD) is an important enzyme in the metabolism of tyrosine in organisms. Tyrosine is converted into p-hydroxyphenylpyruvate (HPPA) under the action of tyrosine aminotransferase (TAT), and HPPD is the enzyme that catalyzes the conversion of HPPA into tocopherol and the plant precursor of plastoquinone, homogentisic acid (HGA) (Crouch N.P. et al. (1997), Tetrahedron, 53, 20, 6993-7010, Fritze et al. (2004), Plant Physiology 134:1388-1400). Tocopherol is synthesized from homogentisic acid and isopentenyl diphosphate in the chloroplast membrane and is essential for maintaining the integrity of the photosynthetic membrane, playing an important role in photosynthetic protection and membrane-related antioxidant activity. Plastoquinone primarily functions as an electron carrier between PSII and the cytochrome b6 / f complex. Secondly, it is also a redox cofactor for phytoene dehydrogenase, which is involved in carotenoid synthesis.

[0003] To date, over 1000 nucleic acid sequences from various organisms in the NCBI database have been annotated as encoding putative proteins with HPPD domains. However, for most of them, HPPD enzyme activity has not been demonstrated in in vitro assays or botanical methods, nor has it been shown that expression of such HPPD proteins in plants confers herbicide tolerance to HPPD inhibitor herbicides. Several HPPD proteins and their primary sequences have been described in the prior art, particularly those from bacteria, such as *Pseudomonas* spp. Pseudomonas (Rüetschi et al., Eur. J. Biochem., 205, 459-466, 1992, WO96 / 38567), Kordia (WO2011 / 076889), Synechococcus ( Synechococcus (WO2011 / 076877) and Rhodococcus spp. ( Rhodococcus (WO2011 / 076892); Protozoa, such as the genus *Ochracidium* ( Blepharisma (WO2011 / 076882); Archaea ( Euryarchaeota), for example, the genus *Acidophilus* ( Picrophilus (WO2011 / 076885); plants, such as Arabidopsis thaliana ( Arabidopsis (WO96 / 38567), carrot ( Daucus carota (WO 96 / 38567, 87257), Oats ( Avenasa tiva ) (WO2002 / 046387, WO2011 / 068567), wheat ( Triticum aestivum (WO2002 / 046387), Broadleaf Arm-shaped Grass ( Brachiaria platyphylla (WO2002 / 046387), Tribulus terrestris ( Cenchrus echinatus (WO2002 / 046387), stiff ryegrass ( Lolium rigidum (WO2002 / 046387), tall fescue ( Festuca arundinacea (WO2002 / 046387), Great Foxtail Grass ( Setaria faberi (WO 2002 / 046387), Goosegrass ( Eleusineindica (WO2002 / 046387), Sorghum genus ( Sorghum (WO2002 / 046387, WO2012 / 021785), Corn ( Zea mays (WO2012 / 021785), Coccidioides ( Coccicoides ); Japanese Coptis chinensis ( Coptis japonica (WO2006 / 132270); Chlamydomonas rhineland ( Chlamydomonas reinhardtii (ES2275365; WO2011 / 145015); or mammals, such as mice or pigs.

[0004] Studies have shown that HPPD inhibition leads to uncoupling of photosynthesis, a lack of auxiliary light-harvesting pigments, and, most importantly, bleaching of chlorophyll due to the absence of photoprotection normally provided by carotenoids (Norris et al. (1995), Plant Cell 7:2139-2149). Bleaching of photosynthetically active tissues leads to growth inhibition and plant death. Some HPPD-inhibiting molecules, as well as those that specifically bind to the enzyme and inhibit the conversion of HPPD to homogentisic acid, have proven to be highly effective herbicides. Currently, most commercially available HPPD inhibitor herbicides belong to one of the following families of compounds:

[0005] (1) Triketones: For example, sulcotrione [i.e., 2-[2-chloro-4-(methanesulfonyl)benzoyl]-1,3-cyclohexanedione], mesotrione [i.e., 2-[4-(methanesulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione], tembotrione [i.e., 2-[2-chloro-4-(methanesulfonyl)-3-[(2,2,2,-trifluoroethoxy)methyl]benzoyl]-1,3-cyclohexanedione], tefuryltrione [i.e., 2-[2-chloro-4-(methanesulfonyl)-3-[[(tetrahydro-2-furanyl)methoxy]methyl]benzoyl]-1 ,3-cyclohexanedione]], flupyrone [i.e. 4-hydroxy-3-[[2-[(2-methoxyethoxy)methyl]-6-(trifluoromethyl)-3-pyridyl]carbonyl]bicyclo[3.2.1]hept-3-en-2-one], benzobicyclon [i.e. 3-(2-chloro-4-methanesulfonylbenzoyl)-2-phenylthiobicyclo[3.2.1]hept-2-en-4-one];

[0006] (2) Diketonitriles: for example, 2-cyano-3-cyclopropyl-1-(2-methanesulfonyl-4-trifluoromethylphenyl)-propane-1,3-dione and 2-cyano-1-[4-(methanesulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione;

[0007] (3) Isoxazoles: For example, isoxaflutole [i.e., (5-cyclopropyl-4-isoxazolyl)[2-(methanesulfonyl)-4-(trifluoromethyl)phenyl] ketone]. In plants, isoxaflutole is rapidly metabolized to DKN—a diketon nitrile compound that exhibits HPPD inhibitory properties;

[0008] (4) Pyrazolinates: For example, toramezone [i.e., [3-(4,5-dihydro-3-isooxazolyl)-2-methyl-4-(methanesulfonyl)phenyl](5-hydroxy-1-methyl-1H-pyrazol-4-yl) ketone] and pyrasulfotole [i.e., (5-hydroxy-1,3-dimethylpyrazol-4-yl(2-methanesulfonyl-4-trifluoromethylphenyl) ketone], pyrazofen hydrochloride [i.e., 2-[4-(2,4-dichlorobenzoyl)-1,3-dimethylpyrazol-5-yloxy] acetophenone];

[0009] (5) N(1,2,5-oxadiazol-3-yl)benzamide (WO2011 / 035874) and N-(1,3,4-oxadiazol-2-yl)benzamide (WO2012 / 126932), such as 2-methyl-N-(5-methyl-1,3,4-oxadiazol-2-yl)-3-(methanesulfonyl)-4-(trifluoromethyl)benzamide;

[0010] (6) N-(tetrazol-5-yl) or N-(triazol-3-yl)aryl carboxamides (WO2012 / 028579), for example, 2-chloro-3-ethoxy-4-(methanesulfonyl)-N-(1-methyl-1H-tetrazol-5-yl)benzamide; 4-(difluoromethyl)-2-methoxy-3-(methanesulfonyl)-N-(1-methyl-1H-tetrazol-5-yl)benzamide; 2-chloro-3-(methanesulfonyl)-N-(1-methyl-1H-tetrazol-5-yl)-4-(trifluoromethyl)benzamide; 2-(methoxymethyl)-3-(methylthionyl)-N-(1-methyl-1H-tetrazol-5-yl)-4-(trifluoromethyl)benzamide;

[0011] (7) Pyridazinone derivatives, Oxoprazin derivatives or substituted 1,2,5-oxadiazoles.

[0012] These HPPD inhibitor herbicides can be used to combat weeds in crops or plants exhibiting metabolic tolerance, including crops such as maize, rice, and wheat, where the herbicides are rapidly degraded (Schulz et al. (1993), FEBS letters, 318, 162-166; Mitchell et al. (2001), Pest Management Science, Vol 57, 120-128; Garcia et al. (2000), Biochem, 39, 7501-7507; Pallett et al. (2001), Pest Management Science, Vol 57, 133-142). To broaden the application of these HPPD inhibitor herbicides, several attempts have been made to impart acceptable levels of tolerance to plants (especially those lacking or with poor metabolic tolerance) under agronomical field conditions.

[0013] The first strategy currently available is to attempt to circumvent HPPD-mediated hydantoin production (US 6,812,010), which can also be achieved by overexpressing the sensitive enzyme to produce a large quantity of the target enzyme in plants, sufficient relative to the herbicide (WO96 / 38567). The second strategy is to mutate HPPD to obtain the target enzyme, which retains its ability to catalyze the conversion of HPPA to hydantoin while being less sensitive to HPPD inhibitors than the unmutated native HPPD. This strategy has been successfully applied to produce plants resistant to 2-cyano-3-cyclopropyl-1-(2-methanesulfonyl-4-trifluoromethylphenyl)-propane-1,3-dione and 2-cyano-1-[4-(methanesulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione (EP496630), both of which are HPPD inhibitor herbicides belonging to the diketononitrile family (WO99 / 24585). Pro215Leu, Gly336Glu, Gly336Ile, and more specifically Gly336Trp (the position of the mutated amino acids is shown with reference to the HPPD of Pseudomonas fluorescens) were identified as mutations leading to increased tolerance to treatment with these diketonitrile herbicides.

[0014] Currently, it has been demonstrated that introducing the *Pseudomonas fluorescens* HPPD gene into the plastid genome of tobacco and soybean is more effective than nuclear transformation, conferring tolerance to post-emergence application of isoxaflutole (Dufourmantel et al. (2007), Plant Biotechnol J. 5(1):118-33). For example, in WO2002 / 046387, several domains of plant-derived HPPD proteins have been identified, which may be associated with conferring tolerance to various HPPD inhibitor herbicides, but data in plants or biochemical data are disclosed to confirm the role of these domains. Similarly, in WO2004 / 024928, the inventors attempted to increase the biosynthesis of plastid quinones and tocopherols in plant cells by increasing the flux of HPPA precursors into these cells. This was accomplished by linking the synthesis of the precursors to the shikimic acid pathway through overexpression of prephenylacetic acid dehydrogenase (PDH). Simultaneously, transforming plants with genes encoding both PDH and HPPD enzymes makes it possible to increase the plants' tolerance to HPPD inhibitors. Furthermore, in WO2008 / 150473, the inventors described a combination of two different tolerance mechanisms (a modified oat gene encoding a mutant HPPD enzyme and a CYP450 maize monooxygenase (nsf1 gene)) to obtain improved tolerance to HPPD inhibitor herbicides, but did not disclose data demonstrating the synergistic effect based on the combination of the two proteins. In WO2010 / 085705, several mutants of oat HPPD were disclosed. Some variants showed in vitro tolerance to the triketone "nicosulfuron," however, only a very small number of mutants were expressed in tobacco plants. Additionally, tobacco plants expressing these mutants did not show tolerance to nicosulfuron or isoxaflutole compared to tobacco plants expressing the wild-type oat HPPD gene. Furthermore, US2011 / 0173718 discloses a method for generating HPPD inhibitor-resistant plants by overexpressing genes encoding HPPD tolerance (e.g., from oats) and several plant genes encoding HST (urine solanesyltransferase) proteins. However, tolerance levels to some specific HPPD inhibitor herbicides are quite limited. Additionally, WO2011 / 094199 and US2011 / 0185444 evaluated the tolerance of hundreds of wild-type soybean lines to the HPPD inhibitor isoxaflutole. Very few lines showed reasonable levels of tolerance to the herbicide. QTLs (quantitative trait loci) leading to this tolerance were identified. In this genomic region, a gene encoding an ABC transporter was identified as the major trait leading to the observed improved tolerance to HPPD inhibitor herbicides. However, transgenic plants expressing the identified genes did not show any improvement in tolerance to the tested HPPD inhibitor herbicides.Similarly, US 2012 / 0042413 describes peptides with HPPD activity but also exhibiting some insensitivity to at least one HPPD inhibitor, further suggesting a group of mutations at different locations on the HPPD enzyme, and ultimately disclosing biochemical data and tolerance levels in plants containing a few of these HPPD mutations. Also, EP 2453012 describes several HPPD mutants; however, no improved tolerance of these mutants to several HPPD inhibitor herbicides has been demonstrated in plants.

[0015] Currently reported and partially commercialized HPPD inhibitor herbicides function as slow-binding or slow-tight-binding inhibitors (see Morrison (1982) Trends Biochem. Sci. 7, 102-105). These inhibitors bind slowly but nonvalently (i.e., they have a slow binding rate, kon) to the HPPD enzyme (i.e., they produce time-dependent inhibition), and these inhibitors are released very slowly (i.e., they have a particularly slow dissociation rate, koff) due to their very tight interaction with the enzyme. Such slow-binding or slow-tight-binding inhibitors are not only highly effective HPPD inhibitors, but also possess characteristics that make them attractive agrochemicals for weed control. The slow dissociation rate amplifies the inhibitory efficacy to such an extent that theoretically only one inhibitor molecule per enzyme active site is sufficient to completely inhibit enzyme activity, and this level of inhibition can be maintained for a long time even in the absence of free inhibitor molecules in plant cells. This translates to low application rates of these inhibitors for controlling unwanted weeds in crop-growing areas.

[0016] Therefore, the characteristics of slow-binding or slow-to-tight-binding inhibitors are advantageous when the goal is to achieve both HPPD inhibition and herbicidal activity. However, these characteristics are major disadvantages when designing HPPD enzymes resistant to these inhibitors. Mutations in HPPD enzymes that solely reduce the affinity (pI50) of the inhibitor for the enzyme cannot completely overcome HPPD inhibition, because the binding of the inhibitor and the inhibition of the HPPD enzyme still occur. Therefore, the level of inhibition achieved, even in the absence of free inhibitors in plant cells, will be maintained for a long time.

[0017] In summary, due to the kinetic properties of all the currently documented and partially commercialized HPPD inhibitor herbicides described above, no HPPD inhibitor-tolerant plants with complete tolerance to HPPD inhibitor herbicides have yet been obtained, despite numerous attempts. Summary of the Invention

[0018] Therefore, the technical problem to be solved by the present invention is to provide a herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant, which is obtained by modifying the rice HPPD gene through in vitro random mutagenesis technology and is a plant-derived HPPD with HPPD resistance.

[0019] The second technical problem to be solved by the present invention is to provide the cloning, expression and application of the above-mentioned herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant.

[0020] To solve the above-mentioned technical problems, the present invention provides a herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant, wherein the mutant is based on a plant-derived HPPD enzyme by mutating cysteine ​​at position 359 to isoleucine, or the mutant is based on a plant-derived HPPD enzyme by site-directed mutation at position 224.

[0021] Specifically, the mutant is based on rice HPPD enzyme, in which cysteine ​​at position 359 is mutated to isoleucine.

[0022] Specifically, the mutant is based on the Nipponbare rice HPPD enzyme, with the cysteine ​​at position 359 mutated to isoleucine.

[0023] Specifically, the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant contains the amino acid sequence shown in SEQ ID No: 2, and is designated as OsC359I; or, the mutant contains the amino acid sequence shown in SEQ ID No: 3, and is designated as OsV224I.

[0024] The present invention also discloses a gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant.

[0025] Specifically, the coding gene contains a nucleotide sequence as shown in SEQ ID No: 5 or SEQ ID No: 6.

[0026] The present invention also discloses an expression vector containing the gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant.

[0027] Preferably, the expression vector includes the recombinant expression vector pGEX. 6p OsC359I or pGEX 6p OsV224I .

[0028] The present invention also discloses a gene cell line containing the gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant.

[0029] The present invention also discloses a recombinant bacterium containing the gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant.

[0030] The present invention also discloses a transgenic crop containing the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant encoding gene.

[0031] Preferably, the transgenic crop includes rice with herbicide-resistant genetically modified rice containing an isoleucine mutation, produced by editing the HPPD site at position 359 of rice using other gene editing technologies such as gene editing.

[0032] Preferably, the genetically modified crop includes herbicide-resistant oats with a mutated HPPD site 224 edited into oats.

[0033] This invention also discloses the application of the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant or the encoding gene in the field of breeding transgenic crops resistant to HPPD inhibitor herbicides.

[0034] The present invention also discloses a method for cultivating transgenic crops resistant to HPPD inhibitor herbicides, comprising the step of converting the encoding gene into the target plant.

[0035] The herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant of this invention is derived from the rice variety Nipponbare (Nipponbare) through gene mutation technology. Oryza sativa Japonica Directed evolution of the rice HPPD gene, specifically 4-hydroxyphenylpyruvate dioxygenase (HPPD), was achieved through in vitro random mutagenesis. OsHPPD The modification was carried out to obtain HPPD mutants derived from plants that are resistant to HPPD inhibitors. OsC359I This leads to an increase in resistance to HPPD inhibitors.

[0036] Enzymatic property analysis of the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant OsC359I described in this invention showed that its HPPD inhibitor tolerance was significantly enhanced. Compared with wild-type OsHPPD, the mutant OsC359I showed a 2.33-fold increase in resistance to mesotrione. The enzymatic data also verified the level of HPPD inhibitor resistance of the mutant, which can provide important genetic resources for breeding new transgenic HPPD inhibitor-resistant crop varieties with better resistance and has broad application value. Attached Figure Description

[0037] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0038] Figure 1 Results of HPPD activity verification (i.e., the ability to produce urea homogentisic acid) for Nipponbare rice;

[0039] Figure 2 This is a flowchart illustrating the mutant library screening process for this invention;

[0040] Figure 3 The expression vector pGEX was constructed 6p Plasmid map of OsC359I;

[0041] Figure 4 The results show the protein composition of HGD, OsHPPD, and the obtained mutant OsC359I in this invention; lane 1 is the HGD (48kDa) protein, and lanes 2 and 3 are the OsHPPD and OsC359I (46.9kDa) proteins, respectively.

[0042] Figure 5 The images show the enzyme kinetic curves of OsHPPD and the mutant OsC359I of this invention; where a is the Km (HPPA) of OsHPPD and b is the Km (HPPA) of OsC359I.

[0043] Figure 6 For nicotinamide to HPPD k cat (mes) result. Detailed Implementation

[0044] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention.

[0045] In the following embodiments of the present invention, "HPPD inhibitor" and "HPPD inhibitor herbicide" refer to the same substance.

[0046] In the following embodiments of the present invention, the HPPD inhibitor is a triketone herbicide, such as sulfadiazine, mesotrione (methylsulfadiazine), cyclosulfonyl ketone, cyclosulfonyl ketone, flupyradifon, and bicyclosulfadiazine. More preferably, the HPPD inhibitor of the present invention is mesotrione.

[0047] Example 1: Obtaining the mutant OsC359I

[0048] like Figure 1As shown in this embodiment, the activity and resistance of HPPD amplified from Nipponbare rice were verified by using different concentration gradients of nicosulfuron. The results showed that OsHPPD has weak activity but very poor resistance.

[0049] In this embodiment, the wild-type HPPD inhibitor resistance gene was obtained. OsHPPD The nucleotide sequence is shown in SEQ ID NO: 4, with a full length of 1338 bp, encoding a sequence of 446 amino acid residues, as shown in SEQ ID NO: 1.

[0050] like Figure 2 The diagram shows the process flow of the gene mutation described in this embodiment, which involves constructing a random mutant library of OsHPPD using error-prone PCR, and then obtaining the mutant OsC359I through resistance screening at a certain concentration of mesotrione.

[0051] The mutant OsC359I is based on the aforementioned wild-type HPPD enzyme, with cysteine ​​at position 359 mutated to isoleucine. The amino acid sequence of the mutant OsC359I is shown in SEQ ID No: 2, and the gene encoding the OsC359I mutant contains the nucleotide sequence shown in SEQ ID No: 5.

[0052] Example 2 pGEX 6p OsC359I The acquisition

[0053] In this embodiment, the polypeptide chain shown in SEQ ID No: 1 was optimized using the gene synthesis project of Jinkairui Company to obtain pGEX codons for E. coli. 6p OsHPPD Plasmid.

[0054] like Figure 3 The flowchart shown uses pGEX 6p OsHPPD Using this template, a mutant library was constructed via error-prone PCR. Primers were designed as follows:

[0055] Forward primer 6P-OsHPPD-F:

[0056] 5'- TTCCAGGGGCCCCTGGGATCC ATGCCGCCTACCCCG-3';

[0057] Reverse primer 6P-OsHPPD-R:

[0058] 5'- GTCACGATGCGGCCGCTCGAG TTAGCTACCCTGCACGGTCG-3';

[0059] The underlined parts represent homologous arms, and the primers were synthesized by Kinkairui Biotechnology Co., Ltd.

[0060] In this embodiment, the specific PCR reaction system is shown in Table 1 below.

[0061] Table 1 PCR reaction system

[0062]

[0063] In this embodiment, the PCR reaction procedure is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 40 sec, for a total of 34 cycles; 25℃ incubation for 5 min.

[0064] In this embodiment, the pGEX-6p-1 linear vector was obtained by double enzyme digestion, followed by overnight digestion in a 37°C water bath, and detected by agarose gel electrophoresis. The specific double enzyme digestion system is shown in Table 2 below.

[0065] Table 2. Enzymatic digestion system of pGEX-6p-1 linear vector

[0066]

[0067] In this embodiment, after verifying the correctness of agarose gel electrophoresis, the PCR products and enzyme digestion products were recovered. The recovery of PCR products was carried out according to the instructions of the gel recovery kit. The specific steps were as follows: the target band was cut out under UV light and placed in a 1.5 mL centrifuge tube. 100 μL of binding buffer was added for every 100 mg of the target band. The tube was incubated in a 55 °C water bath for 10 min until the gel was completely melted. The sol solution was added to a 2 mL adsorption tube and centrifuged at 12,000 rpm for 1 min at 4 °C. 600 μL of elution buffer was added and centrifuged for 1 min. Another 600 μL of elution buffer was added and centrifuged for 1 min. The buffer was discarded and the tube was centrifuged for another 2 min. The tube was then allowed to air dry at room temperature for 5 min. 20 μL of double-distilled water was added to elute and collect the DNA.

[0068] In this embodiment, the recovered PCR product and the linear vector pGEX-6p-1 were used to prepare a homologous recombination reaction system. The specific recombination system is shown in Table 3 below.

[0069] Table 3. Homologous recombination systems (10 μL system)

[0070]

[0071] Based on the above recombination system, the product was incubated at 37°C for 30 min and then immediately cooled on ice to transform the recombinant product. E. coli BL21 (DE3).

[0072] Mix 10 μL of the homologous recombinant product with 100 μL of E. coli competent cells BL21(DE3) and chemically transform BL21(DE3). After incubating on ice for 30 min, heat shock at 42℃ for 90 s, then incubate on ice again for 5-10 min. Add 1 mL of preheated antibiotic-free LB medium, and incubate at 37℃ and 180 rpm for 1 h. Centrifuge at 5000 rpm for 5 min to collect the cells, discard most of the supernatant, and resuspend the cells in the remaining supernatant (about 200 μL). Spread the cells on LB agar plates containing 50 μg / mL ampicillin and incubate overnight at 37℃.

[0073] Single colonies were selected and inoculated into TLB medium (LB medium containing Tyr), and a certain concentration of mesotrione was prepared. The culture was carried out in 300 μl of 96-well plates under the following conditions: 37℃, 240 rpm, and 24 hours.

[0074] The mutant with improved resistance, OsC359I, was screened because it was found to produce homogentisic acid in a mutant with better resistance compared to the wild type.

[0075] Example 3 pGEX 6p OsV224I, C359I The acquisition

[0076] In this embodiment, the OsV224I single-point mutation is the corresponding site of AvV218I in oat-derived HPPD enzymes that have been reported to have enhanced resistance to HPPD inhibitors.

[0077] OsV224I circular point mutation, design of point mutation primers:

[0078] Forward primer OsV224I-F: 5'-CTTTGATCATATTGTGGGCAATGTGCC-3';

[0079] Reverse primer OsV224I-R: 5'-ATTGCCCACAATATGATCAAAGCGGC-3'.

[0080] Primers were synthesized by Kinkai Biotechnology Co., Ltd. for use with pGEX-6P- OsV224I The site-directed mutagenesis and PCR system are shown in Table 4.

[0081] Table 4 PCR Reaction System

[0082]

[0083] PCR reaction program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 3 min 30 sec, for a total of 34 cycles; incubation at 25℃ for 5 min. The PCR was recovered using a gel extraction kit.

[0084] The mutant OsV224I was obtained by mutating at the corresponding site of AvV218I of oat-derived HPPD enzyme, which has been reported to have enhanced resistance to HPPD inhibitors. The amino acid sequence of the mutant OsV224I is shown in SEQ ID No: 3, and the gene encoding the OsV224I mutant contains the nucleotide sequence shown in SEQ ID No: 6.

[0085] Example 4: Purification of wild-type and mutant rice proteins

[0086] The pGEX constructed above will be used respectively 6p OsHPPD pGEX 6p OsC359I pGEX-6P- OsV224I, C359I and pGEX-6p- HGD plasmid transformation to E. coli BL21(DE3) competent cells were activated overnight with identified positive clones and then transferred at a 5% (v / v) inoculum to 10 mL of LB broth containing 100 μg / mL ampicillin. The cells were incubated at 37°C for 3–5 h until OD (dose retardation) was achieved. 600 When the concentration reaches approximately 0.6, add the inducing agent IPTG to bring the final concentration to 0.1 mM, and induce culture at 18℃ and 180 r / min for 16 h.

[0087] The bacterial cells were collected by centrifugation, then washed twice with PBS buffer, and resuspended in 1 mL of PBS buffer before being sonicated. The cell lysis buffer was centrifuged at 12000 rpm for 10 min at 4 °C, and the supernatant and precipitate were collected separately. The precipitate was washed twice with PBS buffer and resuspended in 100 μL of PBS buffer. The expression of the target protein was detected by SDS-PAGE. The SDS-PAGE formulation is shown in Table 5 below.

[0088] Table 5 SDS-PAGE formulation

[0089]

[0090] Take 20 μL of cell lysis buffer, add 5 μL of 5× protein loading buffer, mix well, incubate in boiling water for 10 min, then spot 10 μL of the mixture into the comb wells. Electrophoresis is performed at 80 V until the bromophenol blue reaches the boundary between the upper and lower gel layers. The voltage is then adjusted to 120 V, and the power is turned off when the bromophenol blue is 1 cm from the bottom of the gel. The upper gel is peeled off, stained with staining solution for 1.5 h, washed away, and destained with destaining solution at room temperature and 75 rpm until clear bands are visible.

[0091] Since large-scale purification was performed after small-scale induction of expression, samples containing recombinant plasmids were selected. E. coli A single colony of BL21(DE3) was inoculated into 10 mL of LB liquid medium containing 100 μg / mL ampicillin and cultured overnight at 37°C with shaking at 180 rpm. A 1% inoculum was then transferred to a large Erlenmeyer flask containing 1 L of LB liquid medium and cultured at 37°C for 3-4 h. When the OD600 reached approximately 0.6, IPTG was added to a final concentration of 0.1 mM / L, and the culture was induced at 18°C ​​and 180 rpm for approximately 16 h. After induction, the cells were collected by centrifugation at 8000 rpm for 10 min, washed with pre-chilled PBS buffer (pH 7.0), centrifuged twice to remove the supernatant, and then resuspended in 100 mL of fresh PBS buffer. The cells were then disrupted using a low-temperature autoclave, and the cell lysate was collected and centrifuged at 10,000 rpm for 60 min at 4°C. The supernatant was then purified by GST affinity chromatography.

[0092] Add 1 mL of GST-Sepharose 4 B column material to the chromatography column. First, wash away the ethanol with pre-cooled ddH2O, then wash the column material with about 100 mL of PBS buffer to ensure complete equilibration. Add the equilibrated column material to the cell lysis supernatant and incubate on ice with shaking at 75 rpm for 2 hours. Add the incubated cell lysis supernatant to the chromatography column and run it 2-3 times to ensure that the column material binds as much protein as possible. After loading the sample, add about 1 L of PBS buffer to the chromatography column and wash the column material thoroughly. Mix a certain concentration of 3C protease with 1 mL of PBS buffer and add it to the chromatography column, ensuring that the 3C protease is thoroughly mixed with the column material. Incubate overnight at 4°C for enzymatic digestion. Collect the digested protein, and if necessary, add another 1 mL of PBS buffer for elution.

[0093] SDS-PAGE electrophoresis was used to detect the purity of purified OsHPPD, OsC359I, OsV224I, C359I, and HGD proteins, respectively. The results are attached. Figure 4 As can be seen, after digestion with 3C protease, the size of the target protein was consistent with the predicted size of 48kDa and 46.9kDa after digestion.

[0094] In this embodiment, protein concentration was determined using the Braford Rapid Protein Quantification Kit. The Bradford diluent and stock solution were freshly prepared at a ratio of 47:3; coarse impurities were then removed by centrifugation or filter paper filtration. The 1 mg / mL bovine serum albumin (BSA) protein standard provided with the kit was diluted to different concentrations: 200 μg / mL, 175 μg / mL, 150 μg / mL, 125 μg / mL, 100 μg / mL, 75 μg / mL, 50 μg / mL, 25 μg / mL, and 0 μg / mL. 20 μL of each solution was mixed with 200 μL of the freshly prepared Bradford chromogenic solution, incubated at room temperature for 5 min, and 200 μL was then plotted in a 96-well shallow plate to measure OD595, thus creating a standard curve.

[0095] 20 μL of protein sample was mixed with Bradford chromogenic solution and the OD595 was measured. The protein concentration was calculated based on the standard curve. The results showed that the protein concentrations were 219 ng / μL, 90 ng / μL, 195 ng / μL, and 162 ng / μL, respectively.

[0096] Example 5: Enzyme activity assays of OsHPPD, OsC359I, OsV224I, and C359I.

[0097] In this embodiment, the activity of HPPD is determined by measuring the amount of maleic acetoacetic acid produced by the coupling of HPPD and HGD, and maleic acetoacetic acid has a maximum absorption peak at a wavelength of 330 nm.

[0098] In this embodiment, the HPPD activity assay of the target protein was performed according to the HGD coupling method reported in the literature (Bin Liu et al 2020). All enzyme activity assays were designed with one control group and three parallel groups. Enzyme data processing was performed using GraphPad Prism 8.0 from GraphPad Software.

[0099] When performing enzyme activity assays, the OD values ​​of the experimental group and the control group were compared. 330 After subtracting the values, the concentration of maleicoacetoacetic acid produced during the reaction can be obtained using the molar absorptivity. The reaction rate of the enzyme is the increase in product concentration per unit time.

[0100] K m(HPPA) Assay: 200 μL reaction system: Add 0.25 mM FeSO4 solution, 10 ng / L ascorbic acid solution, and 20 μg / mL purified HPPD protein and an appropriate amount of purified HGD protein to PBS buffer at pH 7.4. Simultaneously add different concentrations of HPPA solution (0 mM, 0.10 mM, 0.20 mM, 0.30 mM, 0.50 mM, 0.80 mM, 1.00 mM, 1.20 mM, 1.50 mM). Take 200 μL of each solution and add it to a 96-well plate. Incubate at 30℃ and 500 rpm for 20 min using a thermostat. Measure the OD using a preheated microplate reader. 330 Values. The control group received no enzyme, and each experimental group was designed with four replicates. A graph was plotted with HPPA concentration on the x-axis and reaction rate on the y-axis to obtain... K m The results of the (HPPA) test, such as Figure 5 As shown.

[0101] In this embodiment, the measurement K m As a result, according to the formula V = V max [S] / ( K m +[S]), where V It's the reaction rate. V max [S] is the maximum reaction rate, and [S] is the measured corresponding [S]. K m The substrate concentration at that time. Catalytic constant. k cat for V max Divide by enzyme concentration.

[0102] In this embodiment, by setting different concentrations of substrate, the affinity of HPPD for the substrate was determined, based on the aforementioned constructed OsHPPD, OsC359I, and OsV224I, C359I. K m kinetic curves such as Figure 5 As shown. Calculate the wild type. K m The value was 0.50 mM, while the mutants were all 0.53 mM, indicating that the enzyme’s affinity for the substrate HPPA remained almost unchanged after mutation.

[0103] Example 6

[0104] In this embodiment, to simulate the intracellular environment of plants, the substrate concentration was designed using the Km value of OsHPPD, and the concentration of nicosulfuron was set to 1 μM, the concentration of nicosulfuron that can be obtained by plant meristems. Ethylene glycol and KCl were added to assist in the simulation, specifically: 0.50 mM HPPA, 1 μM Mesotrione, 100 mM KCl, and 5% ethylene glycol. A 200 μL enzyme activity reaction system was used. The buffer solution in the above reaction system was replaced with a simulated buffer solution, while other components and reaction conditions remained unchanged. The conversion number was measured. k cat (mes).

[0105] In this embodiment, the specific enzyme kinetic values ​​of OsHPPD, OsC359, OsV224I, and C359I are shown in Table 5 below. The effect of nicosulfuron on HPPD... k cat (mes) Results are attached. Figure 6 As shown.

[0106] It can be seen that the catalytic constant of OsC359I k cat The catalytic efficiency of OsC359I is 1.14 times that of the wild type. k cat / K m It is slightly higher than the wild type, OsC359I. k cat (mes) is 2.33 times that of the wild type, OsV224I, C359I k cat (mes) is 2.38 times that of the wild type.

[0107] Table 5. Results of kinetic measurements

[0108]

[0109] As can be seen, the enzymatic properties of the mutants constructed in this invention show that OsC359I and OsV224I, C359I significantly enhance tolerance to HPPD inhibitor herbicides.

[0110] sequence list 1 446

[0113] PRT

[0114] OsHPPD 1

[0116] >rf 1 Untitled

[0117] mpptptptat tgavsaaaaa genagfrlvg hrrfvranpr sdrfqalafh hvelwcadaa

[0118] saagrfafal gaplaarsdl stgnsahasl llrsasvafl ftapyggdhg vgadaattas

[0119] ipsfspgaar rfaadhglav havalrvada adafrasvaa garpafqpad lgggfglaev

[0120] elygdvvlrf vshpdgadap flpgfegvsn pgavdyglrr fdhvvgnvpe lapvaayisg

[0121] ftgfhefaef taedvgtaes glnsvvlann aetvllplne pvhgtkrrsq iqtyldhhgg

[0122] pgvqhialas ddvlgtlrem rarsamggfe flappppnyy dgvrrragdv lseeqinecq

[0123] elgvlvdrdd qgvllqiftk pvgdrptffl emiqrigcme kdesgqeyqk ggcggfgkgn

[0124] fselfksiee yeksleakqa ptvqgs 2 446

[0127] PRT

[0128] OsC359I 1

[0130] >rf 1 Untitled

[0131] mpptptptat tgavsaaaaa genagfrlvg hrrfvranpr sdrfqalafh hvelwcadaa

[0132] saagrfafal gaplaarsdl stgnsahasl llrsasvafl ftapyggdhg vgadaattas

[0133] ipsfspgaar rfaadhglav havalrvada adafrasvaa garpafqpad lgggfglaev

[0134] elygdvvlrf vshpdgadap flpgfegvsn pgavdyglrr fdhvvgnvpe lapvaayisg

[0135] ftgfhefaef taedvgtaes glnsvvlann aetvllplne pvhgtkrrsq iqtyldhhgg

[0136] pgvqhialas ddvlgtlrem rarsamggfe flappppnyy dgvrrragdv lseeqineiq

[0137] elgvlvdrdd qgvllqiftk pvgdrptffl emiqrigcme kdesgqeyqk ggcggfgkgn

[0138] fselfksiee yeksleakqa ptvqgs 3 446

[0141] PRT

[0142] OsV224I 1

[0144] >rf 1 Untitled

[0145] mpptptptat tgavsaaaaa genagfrlvg hrrfvranpr sdrfqalafh hvelwcadaa

[0146] saagrfafal gaplaarsdl stgnsahasl llrsasvafl ftapyggdhg vgadaattas

[0147] ipsfspgaar rfaadhglav havalrvada adafrasvaa garpafqpad lgggfglaev

[0148] elygdvvlrf vshpdgadap flpgfegvsn pgavdyglrr fdhivgnvpe lapvaayisg

[0149] ftgfhefaef taedvgtaes glnsvvlann aetvllplne pvhgtkrrsq iqtyldhhgg

[0150] pgvqhialas ddvlgtlrem rarsamggfe flappppnyy dgvrrragdv lseeqineiq

[0151] elgvlvdrdd qgvllqiftk pvgdrptffl emiqrigcme kdesgqeyqk ggcggfgkgn

[0152] fselfksiee yeksleakqa ptvqgs 4 1338

[0155] DNA

[0156] OsHPPD

[0157] 5 1338

[0160] DNA

[0161] OsC359I

[0162] 6 1338

[0165] DNA

[0166] OsV224I、C359I

[0167]

[0168] The embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only for the purpose of helping to understand the method and core ideas of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. A herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant, characterized in that: The mutant is based on the plant-derived HPPD enzyme shown in SEQ ID NO: 1, by mutating cysteine ​​at position 359 to isoleucine. The amino acid sequence of the mutant is shown in SEQ ID No:

2. The mutant is denoted as OsC359I. Alternatively, the mutant is based on the plant-derived HPPD enzyme shown in SEQ ID NO: 1, by site-directed mutation of valine at position 224 to isoleucine and cysteine ​​at position 359 to isoleucine; the amino acid sequence of the mutant is shown in SEQ ID No: 3, and the mutant is denoted as OsV224I-C359I.

2. A gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant of claim 1; The nucleotide sequence of the encoding gene is shown in SEQ ID No: 5 or SEQ ID No:

6.

3. An expression vector containing the gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant as described in claim 2.

4. A recombinant bacterium containing the gene encoding the herbicide-resistant rice hydroxyphenylpyruvate dioxygenase mutant as described in claim 2.

5. The application of the encoding gene of claim 2 in the field of breeding transgenic rice resistant to HPPD inhibitor herbicides.

6. A method for cultivating transgenic rice resistant to HPPD inhibitor herbicides, characterized in that, It includes the step of converting the encoding gene of claim 2 into the target rice.

Images