Genomic DNA fragments, PCR primers, LAMP primers and their applications for sex identification of sturgeons

Abstract

The present invention discloses a genomic DNA fragment, PCR primer, LAMP primer and application thereof for sex identification of sturgeon. The nucleotide sequence of the genomic DNA fragment for sex identification of sturgeon is shown in SEQ ID NO.1. The present invention provides a new genomic DNA fragment, PCR primer and LAMP primer, a kit and a detection application method for sex identification of sturgeon. Compared with the prior art, the LAMP detection kit can more intuitively and time-savingly quickly identify the early sex of farmed sturgeon. It is applicable to Acipenser schrenckii, Acipenser dabryanus, Acipenser siberiensis, Acipenser russianus, Acipenser euryale, Acipenser siberiensis (Acipenser siberiensis♀×Acipenser schrenckii♂), Acipenser dabryanus♀×Acipenser schrenckii♂, etc. The present invention provides a new method for sex identification of sturgeon, which is time-saving and intuitive, simple in method, does not require expensive instruments, is more suitable for first-line sturgeon farms, and has high accuracy.

Description

Technical Field

[0001] The invention belongs to the field of fish breeding, and in particular relates to a genomic DNA fragment, a PCR primer, a LAMP primer and applications thereof for sturgeon sex identification. Background Art

[0002] Sturgeon is an extremely precious fish. Caviar made from sturgeon roe is rich in essential amino acids, multiple unsaturated fatty acids, vitamins and other substances. It has extremely high nutritional value and is known as "black gold". In 2013, its international price was as high as 800-900 US dollars per kilogram. Therefore, female sturgeons have higher economic value than male sturgeons. At present, sturgeon farming and caviar production are emerging industries and are developing very rapidly in my country. According to preliminary statistics, the annual output of commercial sturgeon farming in my country has exceeded 20,000 tons, accounting for 66.17% of the world's total sturgeon production and 72.46% of the total farming production. China has become the largest sturgeon farming country and the main caviar exporter, with huge market potential.

[0003] However, sturgeons are large and mature late. The average age of farmed sturgeons is more than 7 years. Although sturgeons are dioecious, they have no secondary sexual characteristics throughout their lives, and individuals of different genders cannot be distinguished from each other in morphology. This is obviously not good for the sturgeon farming industry. If they cannot be intensively farmed according to the sex of males and females or raised in a certain sex ratio, it will cause a waste of resources to raise too many male individuals, increase the cost of breeding, and hinder the rapid development of sturgeon farming industry. On the contrary, if the sex of sturgeons can be screened early in the breeding process and the female and male groups can be selectively bred, higher economic benefits can be obtained. Therefore, the development of new technologies for sturgeon sex identification is one of the key areas of concern for the sustainable development of the sturgeon farming industry. Summary of the invention

[0004] The first object of the present invention is to provide a genomic DNA fragment for sturgeon sex identification.

[0005] The nucleotide sequence of the genomic DNA fragment used for sex identification of sturgeon is shown in SEQ ID NO.1.

[0006] The second object of the present invention is to provide the use of the above genomic DNA fragment in sturgeon sex identification.

[0007] The third object of the present invention is to provide a PCR primer for sex identification of sturgeon, comprising:

[0008] Asc 418F:5'-CAGAAACCCAGATAACAAGA-3';

[0009] Asc 418R:5'-CCATGAAAATTTGGGGCCCA-3'.

[0010] The fourth object of the present invention is to provide a LAMP primer for sturgeon sex identification, comprising:

[0011] F3: 5'-ATACCCACGCATCACAAG-3';

[0012] B3: 5'-CTGTTCTTTCATTCATACTACCT-3';

[0013] FIP: 5'-ACGCAGGGTTAATGAACTCTTAAAAGTCGAACAACAAGACTGGT-3';

[0014] BIP:

[0015] 5'-TCAGAGCATACATTAAACACAGGAACTATTTAAATGGTGAAAGAAGTGAG-3';

[0016] LF: 5'-GCTAGTGTACATCAGCAATTTGCA-3';

[0017] LB: 5'-AATCACACACTGTTTACAGACAGGT-3'.

[0018] A fifth object of the present invention is to provide a kit for sex identification of sturgeon, comprising the above-mentioned PCR primers or LAMP primers.

[0019] The sixth object of the present invention is to provide the application of the above-mentioned PCR primers or LAMP primers in sturgeon sex identification.

[0020] A seventh object of the present invention is to provide a method for sex identification of sturgeon, comprising the following steps:

[0021] The genomic DNA of the sturgeon to be tested is extracted, and amplified using the above-mentioned PCR primers or LAMP primers, and the sex of the sturgeon is determined by whether a product is amplified.

[0022] When PCR primers are used, the PCR reaction system is about 20 ng of template DNA; 12.5 ul of premix Taq; the final concentrations of Asc418F / R upstream and downstream primers are 0.4 μM respectively; ddH2O is supplemented to 25 μl; the PCR reaction conditions are pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 30 s, 30-35 cycles; and final extension at 72°C for 10 min.

[0023] When using LAMP primers, the reaction system is template DNA 40ng; primer FIP / BIP final concentration 1.6μM; B3 / F3 final concentration 0.4μM; LF / LB final concentration 0.8μM; LAMP reaction mix 5μl; Bst IIDNA polymerase 2μl; neutral red concentration 100μM; ddH2O supplemented to 25μl; LAMP reaction conditions are 60-65℃, 30-40min.

[0024] The present invention mainly utilizes whole genome resequencing technology and comparative genomics to screen a female-specific expression DNA fragment of Acipenser schrenckii and PCR-specific primers, which are later verified to be applicable to all farmed sturgeons tested and can be used as a specific marker for early sex identification of sturgeons. After technical optimization, the early sex of farmed sturgeons can be quickly identified by the more intuitive and time-saving LAMP method. It is applicable to Acipenser schrenckii, Acipenser dabryanus, Acipenser siberianus, Acipenser russianus, Acipenser europeanus, Western hybrid (Acipenser siberianus ♀×Acipenser schrenckii ♂), Large hybrid (Acipenser dabryanus ♀×Acipenser schrenckii ♂), etc. The present invention provides a new method for sex identification of sturgeons, which is time-saving and intuitive, simple in method, does not require expensive instruments, and has high accuracy.

[0025] The present invention provides a new female sturgeon-specific genomic DNA fragment, PCR primers and LAMP primers, as well as a kit and a detection application method for sturgeon sex identification. Compared with the prior art, the LAMP detection kit can more intuitively and time-savingly quickly identify the early sex of farmed sturgeons. It is applicable to Acipenser schrenckii, Acipenser dabryanus, Acipenser siberiensis, Acipenser russianus, Acipenser sterlete, Acipenser euryale, Acipenser euryale, Acipenser siberiensis (Acipenser siberiensis♀×Acipenser schrenckii♂), Acipenser dabryanus♀×Acipenser schrenckii♂), Acipenser euryale (Acipenser euryale♀×Acipenser siberiensis♂), and Acipenser euryale (Acipenser euryale♀×Acipenser euryale♂). The present invention provides a new method for sturgeon sex identification, which is time-saving and intuitive, has a simple method, does not require expensive instruments, is more suitable for first-line sturgeon farms, and has high accuracy.

[0026] The beneficial effects of the present invention are as follows:

[0027] 1) Provide a new genomic DNA fragment that can be used to identify the sex of common farmed sturgeons and its application.

[0028] 2) Providing PCR primers for detecting the sex identification of the sturgeon.

[0029] 3) Provide LAMP primers for detecting the sex identification of the sturgeon, and the sex identification result time is 2 hours earlier than the PCR method.

[0030] 4) A LAMP method detection kit for detecting the sex of sturgeon is provided, and the sex identification result time is 4 hours earlier than that of the PCR method.

[0031] 5) A new method for sex identification of sturgeons is provided, which is time-saving, intuitive, simple, does not require expensive instruments, and has high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 .Amplification results of the sample from Zhejiang Province. M2000 indicates DL2000 DNA marker, DSH represents the species of the fish, among which DSH♀1-10 individuals can amplify a 418bp specific band, while DSH♂1-10 has no amplification product.

[0033] Figure 2 . Amplification results of Zhejiang sample Dazang (Acipenser dabryanus♀×Acipenser schrenckii♂). M2000 represents DL2000 DNA marker, DZ represents Dazang species, among which DZ♀1-10 individuals can amplify a 418bp specific band, while DZ♂1-10 has no amplification product. NTC refers to negative control.

[0034] Figure 3 . Amplification results of Russian sturgeon samples from Zhejiang. M2000 represents DL2000 DNA marker, ELS represents Russian sturgeon species, among which ELS♀1-10 individuals can amplify a 418bp specific band, while ELS♂1-10 has no amplification product.

[0035] Figure 4 . Amplification results of Acipenser schrenckii samples from Zhejiang Province. M2000 represents DL2000 DNA marker, SSX represents the species of Acipenser schrenckii, among which SSX♀1-10 individuals can amplify a 418bp specific band, while SSX♂1-10 has no amplification product.

[0036] Figure 5 . Amplification results of Siberian sturgeon samples from Zhejiang. M5000 represents DL5000 DNA marker, XB represents the Siberian sturgeon species, and XB♀1-10 individuals can amplify a 418bp specific band.

[0037] Figure 6 . Amplification results of the hybrid (Acipenser siberiensis♀×Acipenser schrenckii♂) samples from Zhejiang Province. M5000 represents DL5000 DNA marker, XZ represents the hybrid species, and XZ♀1-10 individuals can amplify a 418 bp specific band.

[0038] Figure 7 . Amplification results of European mullet samples from Zhejiang. M5000 represents DL5000 DNA marker, OZH represents European mullet species, and OZH♀1-10 individuals can amplify a 418bp specific band.

[0039] Figure 8. Results of sex detection of Dabryanus dabryanus samples from Heilongjiang. M5000 indicates DL5000 DNA marker, DSH represents the species of Dabryanus dabryanus, 10 fish were randomly sampled, 5 of which amplified a 418bp specific band and were predicted to be female, and 5 were predicted to be male. NTC refers to negative control.

[0040] Fig. 9 . Results of sex detection of Dazang (Acipenser dabryanus♀×Acipenser schrenckii♂) from Heilongjiang. M5000 indicates DL5000 DNA marker, DZ represents Dazang species, 10 fish were randomly sampled, 8 of which showed a 418bp specific band and were predicted to be female, and 2 were predicted to be male. NTC refers to negative control.

[0041] Fig.10 . Results of sex detection of Siberian sturgeon samples from Heilongjiang. M5000 represents DL5000 DNA marker, XB represents the species of Siberian sturgeon. Four sturgeons were randomly sampled, and 2 of them were predicted to be females after amplifying a 418bp specific band, while the other 2 were predicted to be males.

[0042] Fig.11 . Results of sex detection of sterlet sturgeon samples from Heilongjiang. M5000 represents DL5000 DNA marker, XT represents sterlet sturgeon species, 11 sturgeons were randomly sampled, 5 of which showed a 418bp specific band and were predicted to be female, and 6 were predicted to be male. NTC represents negative control.

[0043] Fig.12 . Results of sex detection of Bester sturgeon (Acipenser ulmoides ♀×Acipenser sterlet ♂) from Heilongjiang. M5000 indicates DL5000 DNA marker. Ten sturgeons were randomly sampled. Five sturgeons that could amplify the 418bp specific band were predicted to be female, and five sturgeons were predicted to be male. Fig.13 .LAMP verification of known sex of Acipenser schrenckii samples from Zhejiang Province. The color of 10 ♀ Acipenser schrenckii samples changed significantly after testing.

[0044] Fig.14 .LAMP verification of known sex of the samples of P. dabryanus from Zhejiang Province. The color of 10 individual samples of P. dabryanus changed significantly after the test.

[0045] Fig.15 .LAMP verification of known sex of Zhejiang Dacha samples. After testing, the color of 10 ♀ Dacha individual samples changed significantly.

[0046] Fig.16 .LAMP verification of known sex of Russian sturgeon samples in Zhejiang. After testing, the color of 5 ♀ Russian sturgeon samples changed significantly.

[0047] Fig.17Preparation of LAMP detection kit for sturgeon sex identification. The purple-red area Pc represents the positive control, the orange-yellow area NTC represents the negative control, and the gray area 1-72 represents the samples of different sturgeon individuals to be tested.

[0048] Fig.18 . LAMP test of unknown sex of Bester sturgeon samples from Heilongjiang. After the test, the color of 5 Bester sturgeon samples changed significantly.

[0049] Fig.19 .LAMP test of unknown sex of Heilongjiang sturgeon. After the test, the color of 5 sturgeon samples changed significantly.

[0050] Fig. 20 . LAMP test of unknown sex of Heilongjiang sturgeon samples. After the test, the color of 7 sturgeon samples changed significantly.

[0051] Fig.21 .LAMP detection of unknown sex of Heilongjiang sturgeon samples. After the test, the color of 5 sturgeon samples changed significantly. DETAILED DESCRIPTION

[0052] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0053] Embodiment 1:

[0054] 1. Obtaining female-specific fragments of Acipenser schrenckii

[0055] Acipenser schrenckii of known sex at 3 years old was selected as the research object. The genomic DNA of liver or spleen was extracted using the universal DNA extraction kit (D3018) of Magen Company. The extraction quality and genome integrity were tested by agarose gel electrophoresis. The genomic DNA of 10 female individuals and 10 male individuals of qualified quality were selected to build libraries for whole genome sequencing of different individuals.

[0056] Using the genome of the small-bodied sturgeon as the reference genome, the whole genome resequencing data of male and female individuals were compared through sequence maps to find the short fragments that differ between males and females. Primers were designed and PCR amplified to obtain the female-specific fragment of Acipenser schrenckii of Asc-418bp.

[0057] Primer sequences: Asc 418F: 5'-CAGAAACCCAGATAACAAGA-3' and Asc 418R: 5'-CCATGAAAATTTGGGGCCCA-3'.

[0058] Asc-418bp sequence (SEQ ID NO.1):

[0059] 5'-CAGAAACCCAGATAACAAGAAGTTACATTTAAGAACAATGCTATGAGTTTTGCTCAATTCTCACAGGCAGCATAGCGCTATACCCACGCATCACAAGGTCGAACAACAAGACTGGTGATTGCAAATTGCTGATGTACACTAGCTATGTACAGATTAATTTTAAGAGTTCATTAACCCTGCGTTGATTCAGAGCATACATTAAACACAGG AAAATCACACACTGTTTACAGACAGGTTCAATGATTTCTCACTTCTTTCACCATTTAAATAGGAAGCATAATCAACAGGTAGTATAATGGAAAAGAACAGATGGcTGATGAAACAATAAGAGCTTGTGCAATTTAACTGGAAAAACCTAGTGATACATTCAGTAGCGGCTGCAGGATTTAATTCTTGGCTGGGCCCCAAATTTTCATGG-3'

[0060] PCR reaction system and procedure:

[0061] The reaction system was about 20 ng of template DNA; 12.5 ul of premix Taq (TaKaRa Taq 2.0 plus dye, RR901); the final concentrations of Asc418F / R upstream and downstream primers were 0.4 μM respectively; and ddH2O was supplemented to 25 μl.

[0062] The corresponding PCR reaction conditions were: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 30 s, 30-35 cycles; final extension at 72°C for 10 min; and storage at 12°C.

[0063] After the PCR amplification was completed, 1% agarose gel was prepared for electrophoresis detection. A 418 bp specific band was amplified for female individuals, and no specific band was amplified for male individuals.

[0064] 2 Application of specific DNA fragments in sex identification of farmed sturgeons:

[0065] 2.1 Sampling location and sampling information

[0066] In order to fully verify the applicability of the female-specific fragments, two sampling locations were involved: one was a sturgeon breeding company in Quzhou, Zhejiang, and the other was a sturgeon company in Mudanjiang, Heilongjiang. Sampling tissue: Sturgeon dorsal fin samples were preserved in 95% anhydrous ethanol.

[0067] The sampling information in Quzhou, Zhejiang Province mainly includes: 1) 20 Acipenser schrenckii of known sex (10 ♀, 10 ♂); 2) 20 Russian sturgeons of known sex (10 ♀, 10 ♂); 3) 20 large hybrids (Acipenser dabryanus ♀×Acipenser schrenckii ♂) of known sex (10 ♀, 10 ♂); 4) 20 Acipenser dabryanus of known sex (10 ♀, 10 ♂); 5) 10 ♀ Siberian sturgeons; 6) 10 ♀ Western hybrids (Acipenser siberianus ♀×Acipenser schrenckii ♂); 7) 10 ♀ European sturgeons.

[0068] The sturgeon sampling information in Mudanjiang, Heilongjiang mainly includes: 1) 4 Siberian sturgeons of unknown sex; 2) 11 small-sterlet sturgeons of unknown sex; 3) 10 large hybrids of unknown sex (Acipenser dabryanus♀×Acipenser schrenckii♂); 4) 10 Acipenser dabryanus of unknown sex; 5) 10 Bester sturgeons of unknown sex (Acipenser euryale♀×Acipenser schrenckii♂).

[0069] 2.2 Standard testing

[0070] Sturgeon fin genomic DNA extraction, PCR amplification and electrophoresis detection were as described above, with the same conditions.

[0071] 2.3 Results Analysis

[0072] 1) First, the sturgeons with known gender in Zhejiang samples were used for verification. The results showed that the female-specific fragments of Acipenser schrenckii submitted by the present invention can also be well applied to the detected sturgeon species with an accuracy rate of 100%. The specific results are shown in Figure 1-7 .

[0073] 2) The test was conducted using sturgeons of unknown sex from Heilongjiang. The test results are shown in Figure 8-14 , the test prediction results are consistent with the later actual confirmation.

[0074] 3LAMP method is intuitive and time-saving to detect the sex of sturgeons

[0075] LAMP primers, sequences are as follows:

[0076] F35'-ATACCCACGCATCACAAG-3'

[0077] B35'-CTGTTCTTTCCATCATACTACCT-3'

[0078] FIP 5'-ACGCAGGGTTAATGAACTCTTAAAAGTCGAACAACAAGACTGGT-3'

[0079] BIP

[0080] 5'-TCAGAGCATACATTAAACACAGGAACTATTTAAATGGTGAAAGAAGTGAG-3'

[0081] LF 5'-GCTAGTGTACATCAGCAATTTGCA-3'

[0082] LB 5'-AATCACACACTGTTTACAGACAGGT-3'

[0083] LAMP amplification system and reaction procedure:

[0084] The reaction system is about 40 ng of template DNA; primers (FIP / BIP final concentration 1.6 μM; B3 / F3 final concentration 0.4 μM; LF / LB final concentration 0.8 μM); LAMP reaction mix 5 μl; Bst II DNA polymerase 2 μl; neutral red concentration 100 μM; supplemented with ddH2O (pH about 8.0) to 25 μl.

[0085] The corresponding LAMP reaction conditions are 63°C for 30-40 min.

[0086] Observation results: The reaction system of female sturgeon individual samples changed from orange-yellow to dark red, while the color of male sturgeon individual samples and NTC negative control reaction system remained unchanged before and after detection and remained orange-yellow.

[0087] 4. Verification of the accuracy of LAMP detection by using samples of sturgeon with known sex in Zhejiang

[0088] The gender of sturgeon samples in Zhejiang Province was known. The method for extracting genomic DNA was as described in 1. The LAMP method was amplified with the addition of the visualization reagent neutral red. The results were consistent with the PCR specific identification results. Figure 13-16 .

[0089] 5. Preparation of LAMP Detection Kit for Sturgeon Sex Identification

[0090] Special Proprietary 6 for Sturgeon Sexing Kit LAMP primers (including F3 / B3, FIP / BIP, LF / LB) were packaged and stored in a 96-well mobile plate (12 8-well tubes were placed at the same time, numbered from 1-12). The specific sequence information is as follows:

[0091] F3 5′-ATACCCACGCATCACAAG-3′

[0092] B3 5'-CTGTTCTTTCCATCATACTACCT-3'

[0093] FIP 5'-ACGCAGGGTTAATGAACTCTTAAAAGTCGAACAACAAGACTGGT-3'

[0094] BIP 5'-TCAGAGCATACATAAACACAGGAACTATTTAAATGGTGAAAGAAGTGAG-3'

[0095] LF 5'-GCTAGTGTACATCAGCAATTTGCA-3'

[0096] LB 5'-AATCACACACTGTTTACAGACAGGT-3'

[0097] The above-mentioned preferred primer pairs are stored in each well of a 96-well movable plate (12 8-well tubes are placed at the same time, numbered from 1-12), including a PC positive area (purple area), a sample test area (1-72 gray area) and a negative NTC control area (orange-yellow area), and the arrangement is as follows: Fig.17 As shown. When using this 96-well active plate (i.e., the LAMP nucleic acid detection chip for sturgeon sex identification) to detect samples, we can accurately obtain the test results of the samples to be tested based on the detection conditions of the PC positive area (purple area) and the negative NTC control area (orange-yellow area), thereby making an accurate prediction of the sex of the sturgeon samples to be tested. This 96-well active plate can be flexibly used for personalized sex detection of 72 sturgeon individuals (no sample duplication) to at least 6 sturgeon individuals (no sample duplication) at one time as needed.

[0098] The total amount of primer pairs in each 96-well mobile plate well is preferably 1.4 to 5.6 μmol. B3 / F3: LF / LB: The final concentration ratio of FIP / BIP is 1:2:4. It is preferably stored in a -20 degree refrigerator.

[0099] Other components of the kit: Bst II DNA polymerase, LAMP reaction Mix, neutral red indicator and sterile deionized water (pH value about 8.0).

[0100] The LAMP nucleic acid detection chip and other reagents for sturgeon sex identification are packaged and placed in a box together with the instruction manual to form a detection kit.

[0101] 6Test kit verification application

[0102] The unknown gender samples from Heilongjiang were selected as the sturgeon samples to be tested. The fin tissue genomic DNA was extracted according to the method 1, and the LAMP detection kit method for sturgeon gender identification was used for detection. The gender of the unknown sturgeon sample was determined based on the color of the PC positive control and the NCT negative control after detection. The results showed that the chip method detection using the LAMP detection kit for sturgeon gender identification of the present invention was basically consistent with the PCR detection results, and the female and male unknown sturgeon samples could be effectively distinguished. See attached Figure 18-21 .

Claims

1. A genomic DNA fragment for sturgeon sex identification, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the genomic DNA fragment according to claim 1 in sex identification of sturgeons, wherein the sturgeons are Acipenser schrenckii, Acipenser dabryanus, Acipenser siberiensis, Acipenser russianensis, Acipenser euryale, a hybrid fish of Acipenser siberiensis ♀×Acipenser schrenckii ♂, and a hybrid fish of Acipenser dabryanus ♀×Acipenser schrenckii ♂.

3. A PCR primer for sturgeon sex identification, characterized in that: include: Asc 418F:5'-CAGAAACCCAGATAACAAGA-3'; Asc 418R:5'-CCATGAAAATTTGGGGCCCA-3'.

4. A LAMP primer for sturgeon sex identification, characterized in that: include: F3: 5'-ATACCCACGCATCACAAG-3'; B3: 5'-CTGTTCTTTCATTCATACTACCT-3'; FIP: 5'-ACGCAGGGTTAATGAACTCTTAAAAGTCGAACAACAAGACTGGT-3'; BIP: 5'-TCAGAGCATACATTAAACACAGGAACTATTTAAATGGTGAAAGAAGTGAG-3'; LF: 5'-GCTAGTGTACATCAGCAATTTGCA-3'; LB: 5'-AATCACACACTGTTTACAGACAGGT-3'.

5. A kit for sex identification of sturgeon, characterized in that: It comprises the PCR primers according to claim 3 or the LAMP primers according to claim 4.

6. Use of the PCR primers according to claim 3 or the LAMP primers according to claim 4 in sex identification of sturgeons, wherein the sturgeons are Acipenser schrenckii, Acipenser dabryanus, Acipenser siberiensis, Acipenser russianus, Acipenser euryale, a hybrid fish of Acipenser siberiensis ♀×Acipenser schrenckii ♂, and a hybrid fish of Acipenser dabryanus ♀×Acipenser schrenckii ♂.

7. A method for identifying the sex of sturgeons, characterized in that: The following steps are involved: Extract the genomic DNA of the sturgeon to be tested, amplify it using the PCR primers described in claim 3 or the LAMP primers described in claim 4, and judge the sex of the sturgeon by whether the amplified product is obtained, wherein the sturgeon is a hybrid fish of Acipenser schrenckii, Acipenser dabryanus, Acipenser siberiensis, Acipenser russianus, Acipenser europeanus, Acipenser siberiensis♀×Acipenser schrenckii♂, or Acipenser dabryanus♀×Acipenser schrenckii♂.

8. The method according to claim 7, characterized in that When PCR primers are used, the PCR reaction system is 20 ng of template DNA; 12.5 ul of premix Taq; the final concentrations of Asc 418F / R upstream and downstream primers are 0.4 μM respectively; ddH2O is supplemented to 25 μl; the PCR reaction conditions are pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 30 s, 30-35 cycles; and final extension at 72°C for 10 min.

9. The method according to claim 7, characterized in that: When using LAMP primers, the reaction system is template DNA 40ng; primer FIP / BIP final concentration 1.6μM; B3 / F3 final concentration 0.4μM; LF / LB final concentration 0.8μM; LAMP reaction mix 5μl; Bst II DNA polymerase 2μl; neutral red concentration 100μM; supplemented with ddH2O to 25μl; LAMP reaction conditions are 60-65℃, 30-40min.

Images