An InDel molecular marker for identifying the oil content of *Vernicia fordii* seeds and its application.

By developing InDel molecular markers, PCR primer A, and SacⅠ enzyme digestion, the problem of identifying the oil content of *Vernicia fordii* germplasm resources was solved, enabling rapid and efficient screening and breeding of *Vernicia fordii*, optimizing the breeding system, and shortening the breeding cycle.

CN117925889BActive Publication Date: 2025-10-28INST OF BOTANY CHINESE ACAD OF SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410176832.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-08
Publication Date
2025-10-28
Estimated Expiration
2044-02-08

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and effectively identify the oil content of *Vernicia fordii* germplasm resources, resulting in long breeding cycles and severely restricting the development of the *Vernicia fordii* industry.

Method used

InDel molecular markers were developed, and the oil content of *Vernicia fordii* was rapidly identified by agarose gel electrophoresis analysis using PCR primer A and restriction endonuclease SacⅠ, achieving efficient screening and breeding in the seedling stage.

Benefits of technology

This technology enables rapid identification of high-oil-content materials during the seedling stage of *Vernicia fordii*, optimizes the breeding system, reduces workload, improves breeding efficiency, and shortens the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004702376230000011
    Figure HDA0004702376230000011
  • Figure HDA0004702376230000012
    Figure HDA0004702376230000012
  • Figure HDA0004702376230000013
    Figure HDA0004702376230000013
Patent Text Reader

Abstract

This invention relates to the application of molecular markers, and particularly to an InDel molecular marker for identifying the oil content of *Vernicia fordii* and its application. One technical problem this invention aims to solve is how to identify the oil content of *Vernicia fordii*. One technical solution of this invention is the application of the InDel molecular marker or a substance that detects the InDel molecular marker in identifying or assisting in the identification of the oil content of *Vernicia fordii*. The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in positions 95-100 of SEQ ID No. 3. To further accelerate the breeding process of *Vernicia fordii*, ensure stable and high yields of *Vernicia fordii* oil, and improve economic benefits, this invention develops primers at the molecular level for rapid detection of the oil content of *Vernicia fordii* seedlings, solving the problem of oil content identification in the seedling stage, thereby improving breeding efficiency and possessing great application potential and good economic value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of molecular markers, and particularly to an InDel molecular marker for identifying the oil content of *Vernicia fordii* seeds and its application. Background Technology

[0002] Woody oilseed tree species do not compete with farmland or people for food, effectively alleviating the contradiction between food and oil supply and demand and import pressure. *Vernicia fordii* is a woody oilseed tree species with high oil content in its fruits and seeds, rich in linoleic acid and other polyunsaturated fatty acids, making it an ideal woody oilseed tree species.

[0003] Due to the dioecious nature of *Vernicia fordii*, each *Vernicia fordii* germplasm resource possesses unique genomic information, resulting in a wide range of oil content in its fruits, varying from 22% to 42%. Identifying high-oil-content parental materials is the first step in breeding and cultivating breakthrough new varieties. To rapidly identify the oil content of existing *Vernicia fordii* germplasm resources, molecular markers for high oil content in *Vernicia fordii* are being developed, laying the foundation for breeding and cultivating breakthrough new varieties. Currently, the traditional breeding method for high oil content in *Vernicia fordii* involves measuring the oil content after fruiting to determine the hybridization combination, hoping to obtain high-oil-content materials, and then waiting for fruiting to verify the results. This process requires 3-5 years during the juvenile stage of *Vernicia fordii*, with the entire breeding cycle exceeding 20 years. The acquisition of new varieties cannot meet actual production needs, severely restricting the development of the *Vernicia fordii* industry.

[0004] With the continuous development of sequencing technology and the decreasing cost of sequencing, high-throughput sequencing has enabled the acquisition of Single Nucleotide Polymorphisms (SNPs). Based on SNPs, molecular markers are developed for targeted material screening, optimization of breeding systems, and improvement of breeding efficiency. Cleaved Amplified Polymorphic Sequences (CAPS) molecular markers are co-dominant molecular markers based on PCR. They involve designing specific PCR primers based on the known DNA sequence at a given site, amplifying a specific DNA fragment, and then digesting the amplified band with a specific restriction endonuclease for restriction fragment length polymorphism (RFLP) analysis. The numerous combinations of SNPs and restriction endonucleases increase the chances of revealing polymorphisms. CAPS molecular markers exhibit co-dominant characteristics, distinguishing between homozygous and heterozygous genotypes; only one pair of primers is needed for PCR amplification and restriction enzyme digestion, followed by agarose gel electrophoresis analysis, making the overall operation simple and rapid. Applying high-oil-content CASP molecular markers to the breeding of *Vernicia fordii* will accelerate the healthy development of the *Vernicia fordii* industry, screen superior parent plants, rapidly identify high-oil-content hybrid combinations in the seedling stage, and optimize the breeding system. This will not only reduce workload but also improve breeding efficiency. Summary of the Invention

[0005] One of the technical problems to be solved by this invention is how to determine the oil content of *Vernicia fordii* seeds.

[0006] This invention first provides the application of InDel molecular markers or substances that detect InDel molecular markers in the identification or auxiliary identification of the oil content of *Vernicia fordii*, wherein the InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in positions 95-100 of SEQ ID No. 3.

[0007] In particular, positions 95-100 of SEQ ID No.3 consist of 6 nucleotides.

[0008] In the above applications, the substance is either a) or b):

[0009] a) Contains PCR primer A, which amplifies the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker for the oil content of *Vernicia fordii*;

[0010] b) Contains PCR primer B and restriction endonuclease SacⅠ for amplifying the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker for oil content and its five downstream nucleotide residues.

[0011] In the above applications, the PCR primer A can be primer pair A, which consists of a forward primer A and a reverse primer A. The forward primer A is a single-stranded DNA that specifically binds upstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*, and the reverse primer A is a single-stranded DNA that specifically binds downstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*.

[0012] Furthermore, the forward primer sequence A may specifically be a single-stranded DNA with a nucleotide sequence of SEQ ID No. 1, and the reverse primer A may specifically be a single-stranded DNA with a nucleotide sequence of SEQ ID No. 2.

[0013] In the above applications, the PCR primer B can be a primer pair, and the PCR can be primer pair B. The primer pair B consists of a forward primer B and a reverse primer B. The forward primer B is a single-stranded DNA that specifically binds to the upstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*. The reverse primer B is a single-stranded DNA that specifically binds to the downstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*.

[0014] Furthermore, the forward primer sequence B may specifically be a single-stranded DNA with the nucleotide sequence of SEQ ID No. 1, and the reverse primer B may specifically be a single-stranded DNA with the nucleotide sequence of SEQ ID No. 2.

[0015] In the above applications, the *Vernicia fordii* can be a self-pollinated line of *Vernicia fordii*.

[0016] This invention also provides a method for identifying or assisting in the identification of the oil content of *Vernicia fordii* seeds, comprising the following steps:

[0017] The substance was used to detect whether the genomic DNA of the *Vernicia fordii* material to be identified contained the InDel molecular marker. The oil content of the *Vernicia fordii* material containing the InDel molecular marker was higher than that of the *Vernicia fordii* material not containing the InDel molecular marker.

[0018] This invention also provides a method for breeding *Vernicia fordii*, comprising the following steps:

[0019] The substance is used to detect whether the genomic DNA of the *Vernicia fordii* material to be identified contains the InDel molecular marker, and the *Vernicia fordii* material containing the InDel molecular marker is selected for breeding.

[0020] In the above-mentioned methods for identifying or assisting in the identification of the oil content of *Vernicia fordii* or the above-mentioned breeding methods, the *Vernicia fordii* to be identified can be a *Vernicia fordii* inbred line. The substance is either a) or b) as follows:

[0021] a) Contains PCR primer A, which amplifies the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker for the oil content of *Vernicia fordii*;

[0022] b) Contains PCR primer B and restriction endonuclease SacⅠ for amplifying the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker for the oil content of *Vernicia fordii* and the following 5 nucleotide residues.

[0023] In the above-mentioned methods for identifying or assisting in the identification of the oil content of *Vernicia fordii* or the above-mentioned breeding methods, the PCR primer A may be primer pair A, which consists of a forward primer A and a reverse primer A. The forward primer A is a single-stranded DNA that specifically binds to the upstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*, and the reverse primer A is a single-stranded DNA that specifically binds to the downstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*.

[0024] Furthermore, the forward primer sequence A may specifically be a single-stranded DNA as shown in SEQ ID No. 1, and the reverse primer A may specifically be a single-stranded DNA as shown in SEQ ID No. 2.

[0025] In the above-mentioned methods for identifying or assisting in the identification of the oil content of *Vernicia fordii* or the above-mentioned breeding methods, the PCR primer B can be a primer pair, the PCR can be primer pair B, the primer pair B consists of a forward primer B and a reverse primer B, the forward primer B is a single-stranded DNA that specifically binds to the upstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*, and the reverse primer B is a single-stranded DNA that specifically binds to the downstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*.

[0026] Furthermore, the forward primer sequence B may specifically be a single-stranded DNA as shown in SEQ ID No. 1, and the reverse primer B may specifically be a single-stranded DNA as shown in SEQ ID No. 2.

[0027] The above-mentioned methods for identifying or assisting in the identification of the oil content of *Vernicia fordii* or the above-mentioned breeding methods, which utilize the InDel molecular marker substance for detecting the oil content of *Vernicia fordii*, to identify the oil content of *Vernicia fordii*, include the following steps Q1 or Q2:

[0028] Q1. Using the genomic DNA of *Vernicia fordii* as a template, amplify the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker of oil content of *Vernicia fordii* using the PCR primer A.

[0029] Q2. Using the genomic DNA of *Vernicia fordii* as a template, the genomic DNA fragment containing the *Vernicia fordii* oil content InDel molecular marker and the following 5 nucleotide residues was amplified using the PCR primer B to obtain the PCR amplification product, which was then digested with restriction endonuclease SacⅠ.

[0030] This invention also provides the application of the InDel molecular marker for oil content in *Vernicia fordii* in germplasm resource analysis or marker-assisted breeding.

[0031] This invention also provides the application of PCR primer A or PCR primer B in the analysis of Germplasm Resources of *Vernicia fordii* or in molecular marker-assisted breeding.

[0032] The purpose of the molecular marker-assisted breeding mentioned above includes cultivating *Vernicia fordii* with high oil content.

[0033] To further accelerate the breeding process of *Vernicia fordii*, ensure stable and high yields of *Vernicia fordii* oil, and improve economic benefits, this invention develops primers at the molecular level for rapid detection of oil content in *Vernicia fordii* seedlings. This solves the problem of identifying oil content in *Vernicia fordii* seedlings, thereby improving breeding efficiency and possessing great application potential and good economic value. Attached Figure Description

[0034] Figure 1 This is the CAPS molecular marker design site for the IpSTP5 gene in Example 1 of this invention.

[0035] Figure 2 The image shows the electrophoresis result of enzyme digestion of the PCR product of IpSTP5 in Example 1 of this invention (M: DNA marker M600).

[0036] Figure 3 This is an analysis of the oil content of *Vernicia fordii* seeds in Example 1 of the present invention. Detailed Implementation

[0037] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0039] The *Vernicia fordii* used in the following examples are *Vernicia fordii* plants grown at the Institute of Botany, Chinese Academy of Sciences, Xiangshan, Beijing.

[0040] Example 1: IpSTP5 Haplotype Analysis and Enzyme Dot Design

[0041] The IpSTP5 gene in *Vernicia fordii* affects the oil content of the fruit. The *Vernicia fordii* used were those grown at the Institute of Botany, Chinese Academy of Sciences, in Xiangshan, Beijing. DNA was extracted from the fruits of high-oil and low-oil materials using the Tiangen reagent kit (Cat:DP360).

[0042] Using DNA from both high-oil and low-oil sources of *Vernicia fordii* as templates, the IpSTP5 gene fragment was amplified using primers composed of primers IpOC-M001-F and IpOC-M001-R. The primer sequences are as follows:

[0043] IpOC-M001-F: 5'-CCTTTCCATGTCCTTGTCATT-3' (SEQ ID No. 1, same as the first 21st positions of SEQ ID No. 3, and same as the first 21st positions of SEQ ID No. 4);

[0044] IpOC-M001-R: 5'-ATGAGACCACTTGATGCAGC-3' (SEQ ID No. 2, reverse complementary to bits 265-284 of SEQ ID No. 3, and reverse complementary to bits 259-278 of SEQ ID No. 4).

[0045] The PCR amplification reaction system and PCR reaction procedure are as follows:

[0046] Table 1. Conventional PCR reaction system

[0047] Reaction components Dosage 2×Taq MasterMix 10μL IpOC-M001-F 1μL IpOC-M001-R 1μL <![CDATA[ddH2O]]> 7μL DNA 1μL Total Volume 20 μL

[0048] After instantaneous centrifugation to ensure homogeneity, the PCR reaction was performed using a touch-down annealing program, with the annealing temperature decreasing by 0.5°C for the first 10 cycles. The program settings were as follows:

[0049] Table 2. Conventional PCR Amplification Procedure

[0050] step Temperature (℃) time Remark Pre-variation 95 5min transsexual 95 30s annealing 62 30s -0.5℃ extend 72 30s 10cyc transsexual 95 30s annealing 62 30s extend 72 30s 24cyc extend 72 5min save 4 ∞

[0051] Sequencing revealed that the nucleotide sequence of the PCR product fragment of the high-oil-content *Vernicia fordii* material was SEQ ID No. 3, and the haplotype of the high-oil-content material was designated as haplotype I; the nucleotide sequence of the PCR product fragment of the low-oil-content *Vernicia fordii* material was SEQ ID No. 4, and the haplotype of the low-oil-content material was designated as haplotype II.

[0052] SEQ ID No. 3

[0053] CCTTTCCATGTCCTTGTCATTCCTGTGAAGGCATAAAAGGACCCACCATTTGATTATAAAAGGTATTGTCATAGCTGGATGCCTAGGAGCCCTGGACTTAAGCTCTCTCTCTTGACTTAAATAAGTGCTCCTCCCTTGTTAA TTTGGACTCCGAGGAAGAGTTAATCCAAGGAGAAAATGGCCGGAGGAGGTTTTGTTGCCGATGGACCTGCCAGTGGCTTTAACGGTAAGATAACTGTGTCAGTGGTGATCACCTGCATTGTTGCTGCATCAAGTGGTCTCAT

[0054] SEQ ID No. 4

[0055] CCTTTCCATGTCCTTGTCATTCCTGTGAAGGCATAAAAGGACCCACCATTTGATTATAAAAGGTATTGTCATAGCTGGATGCCTAGGAGCCCT GAGCTC TCCTCTCTTGACTTAAATAAGTGCTCCTCCCTTGTTAATTTGGACTCCGAGGAAGAGTTAATCCAAGGAGAAAATGGCCGGAGGAGGTTTTGTTGCCGATGGACCTGCCAGTGGCTTTAACGGTAAGATAACTGTGTCAGTGGTGATCACCTGCATTGTTGCTGCATCAAGTGGTCTCAT

[0056] The IpSTP5 gene fragment (SEQ ID No. 3, haplotype I) from high-oil-content *Vernicia fordii* and the IpSTP5 gene fragment (SEQ ID No. 4, haplotype II) from low-oil-content *Vernicia fordii* were compared at different sites. The results are shown in [Figure 1]. Figure 1The difference between the two samples of *Vernicia fordii* was identified by the InDel molecular marker located at positions 95-100 of SEQ ID No. 3, consisting of 6 nucleotides, with the specific sequence as follows:

[0057] InDel:5'-GACTTA-3' (bits 95-100 of SEQ ID No. 3).

[0058] Restriction endonuclease selection of the InDel site revealed that positions 94-99 of the IpSTP5 gene fragment sequence SEQ ID No. 4 in low-oil materials is the SacⅠ recognition site (see [link]). Figure 1 Based on this, the CAPS tag was developed, as follows:

[0059] (1) The DNA template of the test material of *Vernicia fordii* was amplified using primers composed of IpOC-M001-F (SEQ ID No.1) and IpOC-M001-R (SEQ ID No.2). The PCR reaction system is shown in Table 1, and the PCR amplification program is shown in Table 2. The PCR amplification products were obtained.

[0060] (2) The PCR amplification products were digested with SacI enzyme and incubated at 37°C for 1 hour to obtain the digested products. The digestion reaction system is shown in Table 3.

[0061] Table 3 Enzyme digestion reaction system

[0062] Reaction components Dosage 10×Buffer 1μL PCR products 3μL Sac Ⅰ 0.2μL <![CDATA[ddH2O]]> 5.8μL Total Volume 10μL

[0063] (3) Take 8 μL of enzyme digestion product and detect it by 2% agarose gel electrophoresis. The test material of *Vernicia fordii* with a single band of 284 bp is a high-oil material, and the test material of *Vernicia fordii* with two bands (99 bp and 179 bp) is a low-oil material.

[0064] Example 2: Identification of oil content in *Vernicia fordii* seeds

[0065] This embodiment uses the CAPS marker developed in Example 1 to identify the oil content of *Vernicia fordii* seeds.

[0066] Eighteen samples of *Vernicia fordii* were randomly collected, blanched at 120℃ for 30 minutes, dried at 65℃, and the oil content of the fruit was detected by nuclear magnetic resonance. The experiment was performed three times, and the average value of the three results was taken.

[0067] DNA was extracted from the 18 *Vernicia fordii* fruits using the Tiangen reagent kit (Cat: DP360). Haplotype detection was performed on these 18 *Vernicia fordii* materials using the CAPS marker developed in Example 1.

[0068] (1) The DNA template of the test material of *Vernicia fordii* was amplified using primers composed of IpOC-M001-F (SEQ ID No.1) and IpOC-M001-R (SEQ ID No.2). The PCR reaction system is shown in Table 1, and the PCR amplification program is shown in Table 2. The PCR amplification products were obtained.

[0069] (2) The PCR amplification product was digested with SacⅠ and incubated at 37℃ for 1 hour to obtain the digested product. The digestion reaction system is shown in Table 3.

[0070] (3) Take 8 μL of enzyme digestion product and detect it by 2% agarose gel electrophoresis. The test material of *Vernicia fordii* with a single band of 284 bp has the PCR amplification product sequence of SEQ ID No. 3, which is a high-oil material; the test material of *Vernicia fordii* with a double band (99 bp and 179 bp) has the PCR amplification product sequence of SEQ ID No. 4, which is a low-oil material.

[0071] The results are shown in Table 4:

[0072] Table 4. Results of Genotyping and Oil Content Determination of *Vernicia fordii*

[0073] Mangosteen material Electrophoresis strips haplotype Oil content (%) IpH1 284bp I 27.09 IpH2 284bp I 28.74 IpH3 284bp I 34.67 IpH4 284bp I 35.88 IpH5 284bp I 38.02 IpH6 284bp I 33.80 IpH7 284bp I 38.09 IpH8 284bp I 37.59 IpH9 284bp I 30.24 IpL1 180bp+98bp II 18.90 IpL2 180bp+98bp II 20.27 IpL3 180bp+98bp II 15.14 IpL4 180bp+98bp II 19.40 IpL5 180bp+98bp II 20.18 IpL6 180bp+98bp II 27.64 IpL7 180bp+98bp II 23.01 IpL8 180bp+98bp II 17.52 IpL9 180bp+98bp II 23.70

[0074] The statistics are shown in Table 4. The results indicate that the haplotype of the InDel site is associated with the oil content trait, suggesting that this CAPS marker can be used to identify or assist in identifying the oil content of *Vernicia fordii* materials.

[0075] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. The application of InDel-labeled substances in the identification or auxiliary identification of oil content in *Vernicia fordii* seeds, characterized by: The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No. 3 or SEQ ID No. 4; The substance is either a) or b): a) Contains PCR primer A for amplifying the genomic DNA fragment of *Vernicia fordii* containing positions 95-100 of SEQ ID No. 3; b) Contains PCR primer B and restriction endonuclease for amplifying the genomic DNA fragment of *Vernicia fordii* containing positions 94-99 of SEQ ID No.

4. Sac I. Enzymes.

2. The application according to claim 1, characterized in that: The PCR primer A is primer pair A, which consists of forward primer A and reverse primer A. The forward primer A is a single-stranded DNA that specifically binds upstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*. The reverse primer A is a single-stranded DNA that specifically binds downstream of the double-stranded DNA shown in SEQ ID No. 3 (95-100) in the genomic DNA of *Vernicia fordii*.

3. The application according to claim 2, characterized in that: The forward primer sequence A is a single-stranded DNA nucleotide sequence of SEQ ID No. 1, and the reverse primer A is a single-stranded DNA nucleotide sequence of SEQ ID No.

2.

4. The application according to claim 1, characterized in that: The PCR primer B is primer pair B, which consists of a forward primer B and a reverse primer B. The forward primer B is a single-stranded DNA that specifically binds upstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*. The reverse primer B is a single-stranded DNA that specifically binds downstream of the double-stranded DNA shown in positions 94-99 of SEQ ID No. 4 in the genomic DNA of *Vernicia fordii*.

5. The application according to claim 4, characterized in that: The forward primer sequence B is a single-stranded DNA nucleotide sequence of SEQ ID No. 1, and the reverse primer B is a single-stranded DNA nucleotide sequence of SEQ ID No.

2.

6. A method for identifying or assisting in the identification of the oil content of *Vernicia fordii* seeds, characterized in that: Includes the following steps: Using any one of the substances described in claims 1-5, the InDel molecular marker of claim 1 was detected in the genomic DNA of the *Vernicia fordii* material to be identified. The oil content of the *Vernicia fordii* material containing DNA molecules with nucleotide sequences as shown in SEQ ID No. 3 was higher than that of the *Vernicia fordii* material to be identified without DNA molecules with nucleotide sequences as shown in SEQ ID No.

3.

7. A method for breeding *Vernicia fordii*, characterized in that: Includes the following steps: Using any one of the substances described in claims 1-5, the InDel molecular marker described in claim 1 is detected in the genomic DNA of the *Vernicia fordii* material to be identified. The *Vernicia fordii* material containing DNA molecules with nucleotide sequences as shown in SEQ ID No. 3 is selected for breeding; the purpose of the breeding is to cultivate *Vernicia fordii* with high oil content.

8. The method according to claim 6 or 7, characterized in that: The method of detecting the InDel molecular marker of claim 1 in the genomic DNA of the *Vernicia fordii* material to be identified using any one of the substances described in claims 1-5 includes the following steps Q1 or Q2: Q1. Using the genomic DNA of *Vernicia fordii* as a template, amplify the genomic DNA fragment of *Vernicia fordii* containing the InDel molecular marker of oil content of *Vernicia fordii* using the PCR primer A. Q2. Using the genomic DNA of *Vernicia fordii* as a template, amplify the genomic DNA fragment containing the *Vernicia fordii* oil content InDel molecular marker using the PCR primer B to obtain the PCR amplification product, and then use restriction endonuclease... Sac I. Enzyme digestion.

Citation Information

Patent Citations

  • SSR marker primer group for idesia polycarpa genetic resource analysis and application thereof

    CN113388696A

  • Specific sex identification DNA (deoxyribonucleic acid) sequence and primer pair of idesia polycarpa as well as application and identification method of specific sex identification DNA sequence

    CN116814825A