Alkaline protease mutant with improved stability and application thereof

Abstract

The present application relates to the field of genetic engineering and protein modification technology, and particularly relates to a mutant of alkaline protease with improved stability and application thereof. The present application is based on wild-type alkaline protease AprE from B. clausii, and provides a mutant comprising a mutation site selected from T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G and N232D. The mutant has significantly improved enzyme activity stability in detergents, thereby facilitating the wide application of alkaline protease in the field of washing.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of protein engineering, and particularly relates to a basic protease mutant with improved stability and application thereof. BACKGROUND

[0002] The basic protease can hydrolyze various protein stains such as blood, sweat, milk stains and the like, and can release protein-wrapped stains or stains with enhanced adhesion to the substrate due to protein, and has good synergistic stain removal ability with surfactants. Unlike powdered detergents, liquid detergents are typical enzyme inactivation environments, and the components are complex. The basic protease in the liquid detergent is exposed to the solution, directly contacts and reacts with surfactants, chelating agents, bleaching agents and other auxiliaries, which makes the stability of the protease become an industry problem, and the stability improvement strategy becomes a research hotspot.

[0003] Surfactants are also the main active ingredients of synthetic detergents, which can significantly reduce the surface tension of the liquid, so that oily liquid stains are more easily separated from the fabric surface; and the surfactants can be adsorbed to the surface of solid insoluble stains, so that they are transferred from the substrate to the liquid, and then removed by washing action. In addition, surfactants also have the effects of solubilization, emulsification, dispersion and flocculation. Nonionic surfactants are another type of active substances with high usage, which are usually used in combination with anionic surfactants. Anionic surfactants can bind to the positively charged amino residues on the surface of the protease in the detergent through electrostatic interaction and have an inhibitory effect on them. An important indicator for evaluating whether the newly screened basic protease has the potential to be applied in the detergent industry is to determine its tolerance to anionic surfactants.

[0004] The addition of stabilizers, such as boric acid, borate and polyols, etc. is the simplest and most commonly used method to improve the stability of alkaline protease in liquid detergents. However, the selection and dosage of stabilizers should fully consider the matching and cost of detergent formula. At present, the use of most chemical stabilizers still follows experience, which needs further theoretical research as a guide. Chemical modification is also a commonly used method to improve enzyme stability. However, the amino acid residues that can cross-link with chemical reagents must be located on the surface of the enzyme, and are affected by many factors, including the type of modified enzyme, modification site and degree, etc. Therefore, not all amino acid residues can be chemically modified. Protein engineering, which rationally and semi-rationally designs the primary structure of enzyme protein amino acid sequence, can obtain mutants with more excellent performance. At present, most of the alkaline proteases used in liquid detergents are mutants modified by protein engineering. The 275 amino acid sites on the BPN of the subtilisin were saturated mutated to compare the effects of different amino acids at each site on the performance of the protease. Protein technology can also introduce some chemical bonds to enhance the interaction between enzyme protein molecules to enhance the stability of the enzyme, for example, introducing a new disulfide bond between two cysteine sites can improve the stability of the protease structure. SUMMARY

[0005] The purpose of the present application is to provide an alkaline protease mutant with improved stability. The enzyme activity stability of the mutant in detergents is significantly improved compared with the wild type, thereby facilitating the wide application of alkaline protease in the field of washing.

[0006] The present application relates to an alkaline protease mutant comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 1 and comprising a substitution of an amino acid at at least one position selected from the group consisting of 22, 99, 101, 127, 138, 172, 183, 197, 219, 226, 232 compared to SEQ ID NO: 1.

[0007] In some embodiments of the present application, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity compared to SEQ ID NO: 1.

[0008] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity compared to SEQ ID NO: 1.

[0009] In some embodiments of the application, the mutant comprises a substitution of at least one amino acid selected from the group consisting of: T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D.

[0010] In some embodiments of the application, the mutant comprises a substitution or combination of substitutions selected from the group consisting of:

[0011] T22S;

[0012] T22S / S99A;

[0013] T22S / S101G;

[0014] T22S / P127Q;

[0015] T22S / N138Q;

[0016] T22S / G172A;

[0017] T22S / F183D;

[0018] T22S / V197I;

[0019] T22S / P219W;

[0020] T22S / A226G;

[0021] T22S / N232D;

[0022] T22S / S99A / S101G;

[0023] T22S / S101G / N138Q;

[0024] T22S / P127Q / G172A;

[0025] T22S / G172A / F183D;

[0026] T22S / F183D / V197I;

[0027] T22S / V197I / N232D;

[0028] T22S / P219W / A226G;

[0029] T22SA226G / N232D;

[0030] T22S / S99A / S101G / P127Q;

[0031] T22S / P127Q / N138Q / G172A;

[0032] T22S / F183D / V197I / P219W;

[0033] T22S / F183D / A226G / N232D;

[0034] T22S / V197I / P219W / A226G;

[0035] T22S / P219W / A226G / N232D;

[0036] T22S / S99A / P127Q / N138Q / G172A;

[0037] T22S / S101G / / N138Q / F183D / V197I;

[0038] T22S / P127Q / G172A / V197I / P219W;

[0039] T22S / N138Q / V197I / P219W / A226G;

[0040] T22S / G172A / V197I / P219W / N232D;

[0041] T22S / V197I / P219W / A226G / N232D;

[0042] T22S / S99A / N138Q / F183D / V197I / A226G;

[0043] T22S / S101G / P127Q / G172A / A226G / N232D;

[0044] T22S / N138Q / F183D / V197I / A226G / N232D;

[0045] T22S / F183D / V197I / P219W / A226G / N232D

[0046] T22S / S99A / P127Q / N138Q / F183D / A226G /

[0047] T22S / S101G / G172A / F183D / P219W / N232D;

[0048] T22S / P127Q / F183D / V197I / P219W / A226G;

[0049] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D;

[0050] T22S / S101G / N138Q / G172A / V197I / A226G / N232D;

[0051] T22S / P127Q / F183D / V197I / P219W / A226G / N232D;

[0052] T22S / N138Q / G172A / F183D / V197I / P219W / A226G;

[0053] T22S / G172A / F183D / V197I / P219W / A226G / N232D;

[0054] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I;

[0055] T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G;

[0056] T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / N232D;

[0057] T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0058] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W;

[0059] T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G;

[0060] T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0061] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G;

[0062] T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0063] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0064] S99A;

[0065] S99A / S101G;

[0066] S99A / P127Q;

[0067] S99A / N138Q;

[0068] S99A / G172A;

[0069] S99A / F183D;

[0070] S99A / V197I;

[0071] S99A / P219W;

[0072] S99A / A226G;

[0073] S99A / N232D;

[0074] S99A / S101G / P127Q;

[0075] S99A / N138Q / F183D;

[0076] S99A / G172A / V197I;

[0077] S99A / F183D / P219W;

[0078] S99A / V197I / A226G;

[0079] S99A / A226G / N232D;

[0080] S99A / S101G / P127Q / N138Q;

[0081] S99A / N138Q / G172A / F183D;

[0082] S99A / F183D / V197I / P219W;

[0083] S99A / V197I / P219W / A226G;

[0084] S99A / P219W / A226G / N232D;

[0085] S99A / S101G / P127Q / N138Q / G172A;

[0086] S99A / F183D / V197I / A226G / N232D;

[0087] S99A / S101G / N138Q / G172A / V197I / P219W;

[0088] S99A / P127Q / F183D / V197I / P219W / N232D;

[0089] S99A / G172A / F183D / V197I / P219W / A226G;

[0090] S99A / S101G / N138Q / G172A / F183D / P219W / A226G;

[0091] S99A / G172A / F183D / V197I / P219W / A226G / N232D;

[0092] S99A / S101G / N138Q / G172A / F183D / V197I / P219W / A226G;

[0093] S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0094] S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G;

[0095] S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0096] S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D

[0097] S101G;

[0098] S101G / P127Q;

[0099] S101G / N138Q;

[0100] S101G / G172A;

[0101] S101G / F183D;

[0102] S101G / V197I;

[0103] S101G / P219W;

[0104] S101G / A226G;

[0105] S101G / N232D;

[0106] S101G / P127Q / N138Q;

[0107] S101G / G172A / F183D;

[0108] S101G / V197I / P219W;

[0109] S101G / A226G / N232D;

[0110] S101G / P127Q / N138Q / G172A;

[0111] S101G / F183D / P219W / A226G;

[0112] S101G / V197I / P219W / N232D;

[0113] S101G / P127Q / N138Q / G172A / F183D;

[0114] S101G / P127Q / N138Q / G172A / F183D;

[0115] S101G / G172A / V197I / P219W / A226G;

[0116] S101G / V197I / P219W / A226G / N232D;

[0117] S101G / P127Q / N138Q / G172A / F183D / V197I;

[0118] S101G / G172A / V197I / P219W / A226G / N232D;

[0119] S101G / P127Q / F183D / V197I / P219W / A226G / N232D;

[0120] S101G / G172A / F183D / V197I / P219W / A226G / N232D;

[0121] S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0122] S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0123] S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0124] P127Q;

[0125] P127Q / N138Q;

[0126] P127Q / G172A;

[0127] P127Q / F183D;

[0128] P127Q / V197I;

[0129] P127Q / P219W;

[0130] P127Q / A226G;

[0131] P127Q / N232D;

[0132] P127Q / N138Q / G172A;

[0133] P127Q / F183D / V197I;

[0134] P127Q / P219W / A226G;

[0135] P127Q / N138Q / G172A / F183D;

[0136] P127Q / F183D / V197I / P219W;

[0137] P127Q / P219W / A226G / N232D;

[0138] P127Q / N138Q / G172A / F183D / V197I;

[0139] P127Q / F183D / V197I / A226G / N232D;

[0140] P127Q / N138Q / G172A / F183D / V197I / P219W;

[0141] P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0142] P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0143] P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0144] P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0145] N138Q;

[0146] N138Q / G172A;

[0147] N138Q / F183D;

[0148] N138Q / V197I;

[0149] N138Q / P219W;

[0150] N138Q / A226G;

[0151] N138Q / N232D;

[0152] N138Q / G172A / F183D;

[0153] N138Q / V197I / P219W;

[0154] N138Q / P219W / A226G;

[0155] N138Q / A226G / N232D;

[0156] N138Q / G172A / F183D / V197I;

[0157] N138Q / V197I / P219W / A226G;

[0158] N138Q / G172A / V197I / P219W / A226G;

[0159] N138Q / F183D / P219W / A226G / N232D;

[0160] N138Q / G172A / F183D / V197I / P219W / A226G;

[0161] N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0162] N138Q / G172A / F183D / V197I / P219W / A226G / N232D;

[0163] G172A;

[0164] G172A / F183D;

[0165] G172A / V197I;

[0166] G172A / P219W;

[0167] G172A / A226G;

[0168] G172A / N232D;

[0169] G172A / F183D / V197I;

[0170] G172A / P219W / A226G;

[0171] G172A / A226G / N232D;

[0172] G172A / F183D / V197I / P219W;

[0173] G172A / P219W / A226G / N232D;

[0174] G172A / F183D / V197I / P219W / A226G;

[0175] G172A / V197I / P219W / A226G / N232D;

[0176] G172A / F183D / V197I / P219W / A226G / N232D;

[0177] F183D;

[0178] F183D / V197I;

[0179] F183D / P219W;

[0180] F183D / A226G;

[0181] F183D / N232D;

[0182] F183D / V197I / P219W;

[0183] F183D / A226G / N232D;

[0184] F183D / V197I / P219W / A226G;

[0185] F183D / P219W / A226G / N232D;

[0186] F183D / V197I / P219W / A226G / N232D;

[0187] V197I;

[0188] V197I / P219W;

[0189] V197I / A226G;

[0190] V197I / N232D;

[0191] V197I / P219W / A226G;

[0192] V197I / P219W / N232D;

[0193] V197I / A226G / N232D;

[0194] V197I / P219W / A226G / N232D;

[0195] P219W;

[0196] P219W / A226G;

[0197] P219W / N232D;

[0198] P219W / A226G / N232D;

[0199] A226G;

[0200] N232D;

[0201] A226G / N232D

[0202] T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D.

[0203] The present application also relates to a gene encoding the alkaline protease mutant.

[0204] The present application also relates to a recombinant expression vector comprising the gene encoding the mutant.

[0205] In some embodiments of the present application, a host cell is Bacillus subtilis (Bacillus subtilis ), comprising the recombinant expression vector described above.

[0206] The present application provides single-point mutants comprising T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D mutation sites, respectively, based on wild-type alkaline protease AprE from B. clausii, which have enzyme activity residual rates of 73.1%-85.8% and 16.2%-35.4% after being stored in liquid detergent at 37°C and 45°C for 4 weeks, respectively, which are 37.4%-61.3% and 138.2%-420.6% higher than the wild type. The present application also provides mutants comprising two or more than two combined mutation sites, which have enzyme activity residual rates 14.6%-25.3% and 31.5%-42.3% higher than the corresponding single-point mutants after being stored in liquid detergent at 37°C and 45°C for 4 weeks, respectively. The mutation sites provided by the present application can significantly enhance the resistance of alkaline protease to commonly used surfactants, effectively improve the storage stability of alkaline protease in liquid detergent, and promote its wide application in the field of washing industry. DETAILED DESCRIPTION

[0207] The method of the present application is further illustrated below in conjunction with examples. The experimental methods not specified in the examples can be performed according to conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual" by J. Sambrook et al., or according to the conditions recommended by the manufacturer. Those skilled in the art can better understand and master the present application with the help of the examples. However, the method for implementing the present application should not be limited to the specific method steps described in the examples of the present application.

[0208] In the present application, the nomenclature used to define the amino acid positions is based on the amino acid sequence of alkaline protease from Bacillus sp. deposited in Genbank as WP_094423791.1, which is given as SEQ ID NO: 1 in the sequence listing (amino acids 1-269 of SEQ ID NO: 1). Thus, in the present context, the base SEQ ID NO: 1 for position numbering starts with A1 (Ala1) and ends with R269 (Arg269). SEQ ID NO: 1 serves as the standard for position numbering and thus as the basis for nomenclature.

[0209] Annotation of alkaline protease mutants: the amino acid in alkaline protease mutants is represented by "original amino acid position replaced by amino acid". For example, V30I, which means the amino acid at position 30 is replaced by Ile (I) from the original Val (V) of alkaline protease. The position number corresponds to the number in the attached sequence table SEQ ID NO: 1.

[0210] The formula of the culture medium involved in the embodiment of the application is as follows:

[0211] LB liquid medium: tryptone 1%, yeast powder 0.5%, NaCl 0.5%;

[0212] LB plate: tryptone 1%, yeast powder 0.5%, NaCl 0.5%, agar 2%;

[0213] Skim milk plate: tryptone 1%, yeast powder 0.5%, NaCl 0.5%, skim milk 1%, agar 1.5%;

[0214] The preparation method of GM I is as follows: 1* minimal salt solution 95.6 ml, 20% glucose 2.5 ml, 5% hydrolyzed casein 0.4 ml, 10% yeast powder juice 1 ml; wherein the preparation method of 1* minimal salt solution is as follows: K2HPO4 14 g / L, KH2PO4 6 g / L, (NH4)2SO4 2 g / L, trisodium citrate 1 g / L, MgSO4•7H2O 0.2 g / L, sequentially dissolved in distilled water;

[0215] The preparation method of GM II is as follows: 1* minimal salt solution 96.98 ml, 20% glucose 2.5 ml, 5% hydrolyzed casein 0.08 ml, 10% yeast powder juice 0.04 ml, 1 M MgCl2 0.25 ml, 1 M CaCl2 0.05 ml;

[0216] Seed medium: yeast extract powder 0.5%, tryptone 0.5%, Nacl 0.5%;

[0217] Fermentation medium: glucose 1%, disodium hydrogen phosphate 0.2%, protein peptone 1%, sodium chloride 1%, yeast powder 0.5%.

[0218] The enzyme activity and protein content determination method of alkaline protease in the embodiment of the application is as follows:

[0219] (I) enzyme activity determination method:

[0220] 1. Principle

[0221] Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent is reduced to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, thus allowing the calculation of the product's enzyme activity.

[0222] 2. Definition of enzyme activity

[0223] The definition of protease activity, expressed in units, is as follows: 1 g of solid enzyme powder (or 1 ml of liquid enzyme) hydrolyzes casein to produce 1 μg of tyrosine in 1 minute under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as u / g (u / ml).

[0224] 3. Reagents and solutions

[0225] (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 g / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.

[0226] 4. Measurement Method

[0227] (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 g / mL, 10 g / mL, 20 g / mL, 30 g / mL, 40 g / mL and 50 g / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin reagent working solution, shake well, and place in a 40℃ water bath for color development for 20 min. Remove and use a spectrophotometer at a wavelength of 680 nm with a 10 mm cuvette, using a tyrosine-free tube (C) as a blank, to measure the absorbance of each. Plot the standard curve with absorbance A as the ordinate and the concentration of tyrosine C as the abscissa (this line should pass through the zero point).

[0228] (2) Enzyme activity assay

[0229] Take a pre-diluted amount of enzyme solution, then add an equal volume of 10% casein preheated at 40℃, and react at 40℃ for 10 min. Then add an equal volume of trichloroacetic acid (6.54% concentration) to the reaction system, mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and perform a colorimetric reaction at 40℃ for 20 min. Finally, measure the OD608 value.

[0230] (3) Calculation

[0231] The enzyme activity of the sample final diluent is read from the standard curve, and the unit is u / mL. The enzyme activity of the sample is calculated according to the following formula:

[0232] X = A x K x 4 / 10 x n = 2 / 5 x A x K x n.

[0233] In the formula: X - enzyme activity of the sample (u / g or u / ml);

[0234] A - average absorbance of the sample parallel test;

[0235] K - absorbance constant;

[0236] 4 - total volume of the reaction reagent (ml);

[0237] 10 - reaction time 10 min, 1 min;

[0238] n - dilution multiple.

[0239] The following is a description of the present application in conjunction with the specific embodiments.

[0240] Example 1 Construction of alkaline protease mutant

[0241] The alkaline protease gene derived from Bacillus clausii (B. clausii) (SEQ ID NO: 2) was synthesized by Beijing Lihe Huada Gene Technology Co., Ltd. according to the codon bias of Bacillus. The amino acid sequence of the protease gene is SEQ ID NO: 1. Bacillus clausii aprE The leader peptide and mature peptide segment of the alkaline protease gene were optimized according to the codon bias of Bacillus. The optimized nucleotide sequence was synthesized by Beijing Lihe Huada Gene Technology Co., Ltd. aprE The amino acid sequence of the protease gene is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.

[0242] The aprE-F: gcactgctggcaggaggcgcaactcaagcttttgccgctgaagaagcaaaagaaaaata; aprE aprE-Rv: ggaaacagctatgaccatgattacgccaagctttagcgtgttgccgcttctgcattg.

[0243]

[0244]

[0245] ​​​PCR conditions: 98℃ 2min; 98℃ 10s; 58℃ 20s, 72℃ 45s, 30 cycles; 72℃ 5min. The PCR amplification product was recovered by gel recovery kit, and then was digested by HindIII enzyme and connected with the vector pX131 digested by HindIII enzyme. The enzyme digestion conditions of the expression vector pX131 were as follows:

[0246] pX131 20 uL 10*Buffer 5ul HindIII 2.5 uL ddH2O 22.5ul Total volume 50ul

[0247] 37℃ water bath enzyme digestion treatment for 2h, electrophoresis, and then the target fragment was recovered and dissolved in 20 ul ddH2O.

[0248] The NEB Gbison assembly kit was used, and the molar ratio of the gene aprE fragment and the vector pX131 was 1:3 in a 20 uL reaction system, and the reaction was carried out at 50℃ for 60min.

[0249] Example 2 Screening of alkaline protease mutants with improved storage stability

[0250] The above 20 uL assembly reaction solution was transformed into host cells Bacillus subtilis 1A751 by the competent method, and the specific transformation process was as follows: fresh activated Bacillus subtilis 1A751 was inoculated from LB plate to 5 ml GMI solution, and cultured at 30℃, 125 rpm overnight; the next day, 1 ml was transferred to 9 ml GMI, and cultured at 37℃, 220 rpm for 3.5h; then 1 ml of the culture solution of the previous step was transferred to 9 ml GMII solution, and cultured at 37℃, 125 rpm for 90min, then centrifuged at 5000g, 10min to collect the bacterial cells; the bacterial cells were suspended with 1 ml of GMII solution, and the suspended bacterial cells were the competent cells. Then 0.2 ml of competent cells were added to 20 uL assembly reaction solution, and cultured at 37℃, 200 rpm for 60min, then spread on skim milk plates containing 30 ug / mL kanamycin, and cultured at 37℃ overnight. The next day, the transformants and the corresponding transparent circles were checked, and the wild type gene aprE was used as a control.

[0251] The transparent circle good transformants were picked from the mutant transformation plate, streaked and purified on skim milk plates containing 30 μg / mL kanamycin to obtain transparent circle good single colonies, which were inoculated into 96-well plates with a toothpick, 200 uL of LB solution was added to each well, and the plates were incubated at 37°C, 500 rpm for about 48 h; the alkaline protease enzyme activity of the fermentation supernatant in the plates was determined by using a high-throughput assay kit. Finally, the applicants screened more than 2000 strains of transformants with alkaline protease enzyme activity not less than that of the wild type from more than 20000 transparent circle good transformants.

[0252] Further, the surfactant fatty alcohol polyoxyethylene ether sodium sulfate (AES) solution was added to the fermentation liquid of the above-mentioned more than 2000 screened transformants to a final concentration of 4% (v / v), and after 72 h, the alkaline protease enzyme activity of the fermentation supernatant in the plates was determined. The enzyme activity residual rate was calculated based on the initial enzyme activity of 100%. Different mutants have different storage stabilities in the surfactant solution. Finally, the applicants screened the mutation sites that can significantly improve the stability of alkaline protease: T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D.

[0253] On the basis of the wild type alkaline protease aprE, the present application provides single point mutants each comprising any one of the mutation sites T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D.

[0254] The application also provides a mutant comprising at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven mutation sites of T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D. For example, two-point mutant of T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, P219W / A226G; three-point mutant of T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226G / N232D, F183D / V197I / P219W, V197I / A226G / N232D; four-point mutant of T22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V197I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, V197I / P219W / A226G / N232D; five-point mutant of T22S / S101G / / N138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232D.T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101 G / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D, S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eight-point mutant;T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D nine-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutant; T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eleven-point mutant.

[0255] Example 3 Analysis of storage stability of alkaline protease mutants in surfactant

[0256] The recombinant B. subtilis engineering bacteria constructed in Example 2, which expressed wild-type alkaline protease AprE or its mutants, were inoculated into 50 mL fermentation medium (yeast extract powder 0.5%, tryptone 0.5%, glucose 1%, K2HPO41.8%) and subjected to shake flask fermentation for 48 h. The supernatant was collected by centrifugation at 5000 rpm for 10 min, and the alkaline protease activity in the supernatant was determined.

[0257] The surfactant sodium fatty alcohol polyoxyethylene ether sulfate (AES) solution was added to the fermentation supernatant to a final concentration of 4% (v / v), and the alkaline protease activity in the fermentation supernatant was determined after 72 h. The enzyme activity retention rate was calculated based on the initial enzyme activity of 100%. The specific results are shown in Table 1.

[0258] Table 1 Storage stability of alkaline protease single-point mutants in surfactant solution

[0259] Alkaline protease mutants Enzyme activity residual rate Wild-type AprE 83.6% T22S 99.0% S99A 94.6% S101G 100.7% P127Q 97.4% N138Q 98.9% G172A 95.2% F183D 96.9% V197I 93.6% P219W 96.7% A226G 97.0% N232D 106.3%

[0260] As can be seen from the data in Table 1, compared with wild-type alkaline protease AprE, the alkaline protease mutants provided by the present application, each containing a single mutation site of T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, or N232D, generally have an enzyme activity residual rate increased by 12.0%-27.2% after being stored in a 4% fatty alcohol polyoxyethylene ether sodium sulfate (AES) solution for 72 h, and the stability is significantly improved.

[0261] In addition, the application provides T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, P219W / A226G two-point mutants; T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226G / N232D, F183D / V197I / P219W, V197I / A226G / N232D three-point mutants; T22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V197I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, V197I / P219W / A226G / N232D four-point mutants; T22S / S101G / / N138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232D five-point mutants; T22S / S99A / N138Q / F183D / V197I / A226G, T22S / S101G / G172A / F183D / P219W / N232D, S99A / S101G / N138Q / G172A / V197I / P219W, S101G / P127Q / N138Q / G172A / F183D / V197I, P127Q / F183D / V197I / P219W / A226G / N232D, G172A / F183D / V197I / P219W / A226G / N232D six-point mutants;T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D, S99A / S101 G / N138Q / G172A / F183D / P219W / A226G, S101 G / G172A / F183D / V197I / P219W / A226G / N232D, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, N138Q / G172A / F183D / V197I / P219W / A226G / N232D seven-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101 G / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D, S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eight-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D nine-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutants;The T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eleven-point mutant has a residual enzyme activity that is generally 9.7%-19.2% higher than that of the corresponding single-point mutant after being stored in a 4% fatty alcohol polyoxyethylene ether sodium sulfate (AES) solution for 72 hours, and an unexpected technical effect is achieved.

[0262] Storage stability analysis of alkaline protease mutants in liquid detergents

[0263] The most commonly used anionic component fatty alcohol polyoxyethylene ether sodium sulfate (AES) and non-ionic component fatty alcohol polyoxyethylene ether (AEO9) are selected to evaluate the storage stability of the alkaline protease mutants in a complex formula liquid detergent (see Table 2).

[0264] The fermentation supernatant of the Bacillus subtilis engineering bacteria expressing the wild-type alkaline protease AprE or the mutants thereof according to Example 3 is diluted with a 0.15M, pH 10.5 borate buffer solution to a protease enzyme activity of 10,000 U / mL, and then added to the above-mentioned complex formula liquid detergent at a volume ratio of 0.2%. After being stirred uniformly, the detergent is stored at 37°C and 45°C for 1, 2, and 4 weeks, respectively. The alkaline protease enzyme activity in the detergent is detected, and the residual enzyme activity is calculated based on the initial enzyme activity of 100%. The specific results are shown in Tables 3 and 4.

[0265] Enzyme activity residual rate (%) = enzyme activity after storage / initial enzyme activity x 100%.

[0266] Table 2 Liquid detergent formula

[0267] Formulation ingredients Content (%) Fatty alcohol polyoxyethylene ether sodium sulfate (AES) 80 mL / L Fatty alcohol polyoxyethylene ether (AEO9) 80 mL / L Calcium salt 0.24 g / L Phosphate 5 g / L Preservative 0.2 g / L Antistatic agent 0.1 g / L

[0268] Table 3 Storage stability of alkaline protease single-point mutants in liquid detergents at 37°C

[0269]

[0270] Table 4 Storage stability of alkaline protease single-point mutants in liquid detergents at 45°C

[0271]

[0272] As shown in Table 3, after being placed at 37°C for 4 weeks, the residual enzyme activity of the wild-type alkaline protease in the liquid detergent is reduced to 53.2%, while the residual enzyme activity of the 11 single-point mutants provided by the present application is 73.1%-85.8%, which is 37.4%-61.3% higher than that of the wild-type.

[0273] From the data of Table 4, it can be seen that after being placed at 45°C for 4 weeks, the residual enzyme activity of the wild-type alkaline protease in the liquid detergent is only 6.8%, while the residual enzyme activity of the 11 single-point mutants provided by the application is 16.2%-35.4%, which is increased by 138.2%-420.6% compared with the wild type.

[0274] In addition, the application provides T22S / S99A, T22S / G172A, S99A / F183D, S101G / P219W, P127Q / A226G, G172A / N232D, P219W / A226G two-point mutants; T22S / P127Q / G172A, S99A / N138Q / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A, N138Q / A226G / N232D, F183D / V197I / P219W, V197I / A226G / N232D three-point mutants; T22S / S99A / S101G / P127Q, S99A / N138Q / G172A / F183D, S101G / V197I / P219W, P127Q / N138Q / G172A / F183D, N138Q / G172A / F183D / V197I, N138Q / V197I / P219W / A226G, G172A / F183D / V197I / P219W, F183D / V197I / P219W / A226G, V197I / P219W / A226G / N232D four-point mutants; T22S / S101G / / N138Q / F183D / V197I, S99A / F183D / V197I / A226G / N232D, S101G / P127Q / N138Q / G172A / F183D, S101G / G172A / V197I / P219W / A226G, P127Q / F183D / V197I / A226G / N232D, N138Q / G172A / V197I / P219W / A226G, G172A / V197I / P219W / A226G / N232D, F183D / V197I / P219W / A226G / N232D five-point mutants; T22S / S99A / N138Q / F183D / V197I / A226G, T22S / S101G / G172A / F183D / P219W / N232D, S99A / S101G / N138Q / G172A / V197I / P219W, S101G / P127Q / N138Q / G172A / F183D / V197I, P127Q / F183D / V197I / P219W / A226G / N232D, G172A / F183D / V197I / P219W / A226G / N232D six-point mutants;T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D, S99A / S101 G / N138Q / G172A / F183D / P219W / A226G, S101 G / G172A / F183D / V197I / P219W / A226G / N232D, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, N138Q / G172A / F183D / V197I / P219W / A226G / N232D seven-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I, T22S / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101 G / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / G172A / F183D / V197I / P219W / A226G / N232D, S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eight-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W, T22S / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, S99A / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D nine-point mutants; T22S / S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G, T22S / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D, S99A / S101 G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D ten-point mutants;The T22S / S99A / S101G / P127Q / N138Q / G172A / F183D / V197I / P219W / A226G / N232D eleven-point mutant is further improved in stability in the detergent, and the residual rate of enzyme activity is generally increased by 14.6%-25.3% than the corresponding single-point mutant after being placed at 37 DEG C for 4 weeks; the residual rate of enzyme activity is generally increased by 31.5%-42.3% than the corresponding single-point mutant after being placed at 45 DEG C for 4 weeks.

[0275] In conclusion, the T22S, S99A, S101G, P127Q, N138Q, G172A, F183D, V197I, P219W, A226G, N232D mutation sites can significantly enhance the resistance of alkaline protease to the commonly used surfactants in the detergent, effectively improve the storage stability of alkaline protease in the liquid detergent, and achieve unexpected technical effects.

[0276] The alkaline protease mutant provided by the application can be widely applied in the field of detergent production.

Claims

1. A mutant of alkaline protease, characterized in that, The mutant is obtained by mutating the 22th amino acid of the alkaline protease with amino acid sequence of SEQ ID NO: 1 from Thr to Ser.

2. A DNA molecule encoding the alkaline protease mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 3; and the host cell is a non-plant cell.

5. The host cell of claim 4, wherein The host cell is Pichia pastoris (MUT+) Pichia pastoris ) or Trichoderma reesei (P1) Trichoderma reesei .

6. Use of the alkaline protease mutant of claim 1 in the field of washing.

Images