A humanized animal model for human influenza virus infection and preparation method

Abstract

The present invention discloses a humanized animal model for human influenza virus infection and a preparation method. The present invention provides a method for constructing a mouse model for human influenza virus infection, comprising the following steps: introducing the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene into wild-type mice; subsequently breeding to obtain the F2 generation, which is a mouse model for human influenza virus infection; and each generation is subjected to genotyping and in vivo imaging identification. The present invention inserts the human ST6GAL1 gene into the mouse gene sequence, overexpresses the human sialyltransferase ST6GAL1 that synthesizes the human α2,6-linked sialic acid receptor, and constructs a mouse model for human influenza virus infection. The model can be directly infected with human influenza virus without the need for an in vivo adaptation process in mice, providing a humanized mouse model that conforms to the clinical characteristics of influenza for in-depth elucidation of the pathogenesis of influenza, verification of new drug targets, and development of new drugs and vaccine evaluation.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a humanized animal model for human influenza virus infection and a preparation method thereof. Background Art

[0002] Animal models play an irreplaceable and important role in humanity's fight against infectious diseases. An ideal animal model must first be susceptible to the virus and, secondly, exhibit pathophysiology, disease progression, symptoms, and host immune responses similar to those seen in humans after infection. Currently, animal models used for human influenza virus infection include ferrets, guinea pigs, non-human primates, and mice, each with its own advantages and disadvantages in research and application:

[0003] Ferrets have been used as an animal model for influenza virus research and have successfully isolated human influenza A viruses in vivo. However, as an influenza animal model, ferrets have significant limitations: (1) there is a lack of reagents for analyzing immune responses to influenza virus infection and vaccination, such as ferret-specific antibodies; (2) ferrets are expensive, resulting in high experimental costs; and (3) ferret husbandry and experimental manipulation are difficult.

[0004] Guinea pigs are occasionally used to study the pathogenesis of influenza viruses because their lung anatomy and physiology are similar to those of humans. When guinea pigs are infected with influenza viruses, the virus replicates primarily in the upper respiratory tract. However, using guinea pigs to study influenza viruses has limitations: (1) guinea pigs rarely show clinical symptoms after infection with influenza viruses, making it difficult to study the pathogenesis of the virus; and (2) there is a lack of specialized reagents for guinea pigs.

[0005] Nonhuman primates (NHPs), which are closely related to humans genetically and share similarities in anatomy, physiology, and immunology, have been used in many laboratories to study the pathogenesis of influenza viruses and evaluate the efficacy of influenza vaccines and antiviral drugs. However, ethical restrictions, high costs, complex husbandry conditions, and the need for specialized personnel have hindered the widespread and convenient use of this model for influenza research.

[0006] Mice are currently the most commonly used mammalian infection model for evaluating influenza virus infection, with significant advantages such as low price, easy breeding, clear genetic lineage, and low variability. However, as an influenza animal model, mice have the following shortcomings: (1) Mice are not natural hosts for influenza viruses and lack or differ from human influenza virus receptors. Except for highly pathogenic strains, viruses must adapt through multiple lung passages to allow infection and replication; (2) Mice cannot transmit viruses, and almost all influenza viruses cannot be horizontally transmitted between mice, making them not an ideal influenza virus transmission model; (3) The ability to infect depends on the species of mouse.

[0007] Sialyltransferases (STs) are key influenza virus receptor determinants whose synthesis is regulated by sialyltransferases (STs). The main sialyltransferases involved in influenza virus infection in humans include Neu5Ac(2-3)Gal sialyltransferases 1-4 (ST3GAL1-ST3GAL 4) and Neu5Acα(2-6)Gal sialyltransferase 1 (ST6GAL1). These transfer Neu5Ac and sialic acid (SA) from the substrate CMP-Neu5Ac to glycolipids or glycoproteins via α(2-3) and α(2-6) glycosidic bonds, respectively, to form receptors. STs regulate the glycosidic bond between SA and Gal. Different glycosidic bond structures can form SA receptors with varying substrate specificity, ultimately affecting the binding of SA receptors to the influenza virus surface hemagglutinin (HA). Summary of the Invention

[0008] The purpose of the present invention is to provide a humanized animal model for human influenza virus infection and a preparation method thereof.

[0009] In a first aspect, the present invention provides a method for constructing a mouse model for infection with human influenza virus, comprising the following steps:

[0010] 1) The endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 gene, and the luciferase gene were introduced into wild-type mice to generate transgenic founder mice;

[0011] 2) performing genotyping and in vivo imaging identification on the transgenic founder mice, selecting mice that are positive in genotyping and in vivo imaging identification and recording them as positive transgenic founder mice; then mating the positive transgenic founder mice with the wild-type mice to obtain F1 generation mice;

[0012] 3) performing genotyping and in vivo imaging analysis on the F1 generation mice, selecting mice that are positive in genotyping and in vivo imaging, and recording them as positive F1 generation mice; then mating the positive F1 generation mice with the wild-type mice to obtain F2 generation mice;

[0013] 4) performing genotyping and in vivo imaging identification on the F2 generation mice, selecting mice that are positive in genotyping and in vivo imaging identification and recording them as positive F2 generation mice, which are used as mouse models for human influenza virus infection;

[0014] The genotype identification is performed by PCR amplification using primers that amplify the full length or part of the gene encoding human sialyltransferase ST6GAL1. If the target fragment is found, the genotype identification is positive;

[0015] The in vivo imaging identification is to introduce a fluorescent substrate into the mouse and then perform in vivo imaging analysis. If there is a fluorescent signal and the site of fluorescent signal expression is the influenza virus infection site, the in vivo imaging identification is positive.

[0016] The primers for amplifying the full or partial length of the gene encoding human sialyltransferase ST6GAL1 are specifically as follows in the embodiments of the present invention:

[0017] K18-ST6F:CGGTACCAATAACAGTAAAAGGCAGTACG

[0018] K18-ST6R:GATACCAAGCATCCCAGAGGATGG

[0019] The above method further includes the following step 5): detecting the expression of human ST6GAL1 in the lung tissue of the positive F2 generation mouse; if human ST6GAL1 is expressed in the lung tissue, the positive F2 generation mouse is a mouse model for human influenza virus infection.

[0020] The expression of human ST6GAL1 in the above-mentioned lung tissues was detected by immunohistochemical staining.

[0021] The mouse model for infection with human influenza virus constructed by the above method is susceptible to human influenza virus and is more easily infected with human influenza virus than wild-type mice, thus becoming a humanized animal model.

[0022] The above method further comprises the following step 6): inoculating the mouse model for human influenza virus infection with human influenza virus; if the infection is successful, a mouse model infected with human influenza virus is obtained.

[0023] The above-mentioned successful detection of human influenza virus infection is used to infect a mouse model with human influenza virus, detect the virus load in the mouse lung tissue and / or the neutralizing antibodies in the mouse serum. If the mouse lung tissue contains the virus, the human influenza virus infection is successful; or if the mouse lung tissue contains the virus and the mouse serum produces neutralizing antibodies, the human influenza virus infection is successful.

[0024] In the above method, the nucleotide sequence of the endothelial cell-specific promoter K18 is sequence 1 or a sequence that is at least 75% identical thereto and has the same function;

[0025] The nucleotide sequence of the gene encoding the human sialyltransferase ST6GAL1 is sequence 2 or a sequence that is at least 75% identical thereto and has the same function;

[0026] The nucleotide sequence of the luciferase encoding gene is sequence 3 or a sequence that is at least 75% identical thereto and has the same function.

[0027] In the above method, the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene are introduced into the mouse via linearized DNA fragments;

[0028] Furthermore, the nucleotide sequence of the linearized DNA fragment is specifically sequence 7.

[0029] In the above method, the linearized DNA fragment is obtained by digesting the recombinant vector with endonucleases Sac1 and Sph1;

[0030] The recombinant vector is a recombinant vector obtained by constructing the DNA fragments of the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene and the luciferase encoding gene into an expression vector;

[0031] The expression vector is puc19L.

[0032] In a second aspect, the present invention provides a linearized DNA fragment comprising the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene in the first aspect.

[0033] The nucleotide sequence of the linearized DNA fragment described above is Sequence 7.

[0034] In a third aspect, the present invention provides a recombinant vector, which is a recombinant vector obtained by constructing the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene and the luciferase encoding gene in the first aspect into an expression vector;

[0035] The expression vector is puc19L;

[0036] The nucleotide sequence of the recombinant vector in the first aspect or the third aspect above is sequence 6 or sequence 5.

[0037] In a fourth aspect, the present invention further provides a method for preparing the linearized DNA fragment described in the second aspect, which is obtained by digesting the recombinant vector described in the third aspect with endonucleases Sac1 and Sph1.

[0038] In a fifth aspect, the present invention provides the following applications:

[0039] The present invention provides the use of any one of the following substances A1-A3 in constructing a mouse model for human influenza virus infection or constructing a mouse model of human influenza virus infection:

[0040] Alternatively, the present invention provides the use of any of the following substances A1-A4 in any of the following B1-B3:

[0041] A1) the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene in the first aspect;

[0042] A2) the linearized DNA fragment described in the second aspect;

[0043] A3) the recombinant vector according to the third aspect;

[0044] A4) a mouse model for human influenza virus infection or a mouse model of human influenza virus infection constructed by the method of the first aspect;

[0045] B1) Preparation of products for studying human influenza virus infection;

[0046] B2) Preparation and evaluation of human influenza virus vaccine products;

[0047] B3) Develop or screen drugs for the prevention and / or treatment of human influenza virus.

[0048] In the above, the human influenza virus is influenza A virus, specifically H3N2 in the present invention.

[0049] The wild-type mice mentioned above are C57BL / 6 mice.

[0050] The research and development strategy of the present invention for animal models of human infectious diseases including influenza virus is: first, to find or determine the viral receptor, and based on the distribution of the receptor in human tissue cells, determine the strategy for expressing the target gene in humanized mice, and prepare the corresponding humanized mouse model. The prepared model should be phenotypic analyzed to determine the distribution of the receptor protein in various tissue cells of the humanized mouse; then, through the virus challenge test, the clinical symptoms, target organ viral load and pathological changes of the animal model are observed and analyzed to evaluate the animal model.

[0051] The present invention discovered that sialyltransferase is a key regulatory enzyme in the synthesis of sialic acid receptors. In vitro experiments also confirmed that human influenza virus can be more easily bound to cells by introducing human sialyltransferase into mice. Therefore, by introducing human sialyltransferase into mice, the sugar structure of sialic acid receptors is affected, making the receptor distribution in the mouse respiratory tract similar to that of humans, and successfully establishing a humanized influenza mouse model.

[0052] The present invention uses gene editing technology to insert the human ST6GAL1 gene into the mouse gene sequence, overexpresses synthetic human α2,6-linked sialic acid receptor sialyltransferase, and constructs a mouse model of human influenza virus infection. This model can be directly infected with human influenza virus without the need for in vivo adaptation in mice, providing a humanized mouse model that conforms to the clinical characteristics of influenza for in-depth elucidation of the pathogenesis of influenza, verification of new drug targets, new drug development, and vaccine evaluation. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is the electrophoresis result of PCR amplification products of K18, hST6GAL1, PUC19L, luciferase, and PLOYA.

[0054] Figure 2 Schematic diagram of the construction of K18-hST6GAL1-luciferase expression vector.

[0055] Figure 3 The results of PCR and electrophoresis identification of positive clones of K18-hST6GAL1-luciferase recombinant plasmid.

[0056] Figure 4 PCR and electrophoresis identification of K18-hST6GAL1-luciferase recombinant plasmid before enzyme linearization.

[0057] Figure 5 This is the electrophoresis diagram of DNA recovered after linearization of K18-hST6GAL1-luciferase expression vector.

[0058] Figure 6 Genotype identification results of B6-Tg (K18-hST6GAL1-Luc) humanized founder mice.

[0059] Figure 7 Results from characterizing the B6-Tg(K18-hST6GAL1-Luc) humanized mouse founders for small animal in vivo imaging analysis.

[0060] Figure 8 Immunohistochemistry was used to detect the expression of human ST6GAL1 protein.

[0061] Figure 9 The viral load in the lungs of B6-Tg (K18-hST6GAL1-Luc) humanized mice infected with human H3N2 influenza virus.

[0062] Figure 10 The results are shown in Figure 2. Humanized B6-Tg (K18-hST6GAL1-Luc) mice were infected with H3N2 virus. DETAILED DESCRIPTION

[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0064] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0065] Example 1: Construction of a mouse animal model of seasonal human influenza virus infection

[0066] (I) Construction of linearized K18-hST6GAL1-luciferase by pronuclear injection

[0067] The transgenic constructs were designed as follows:

[0068] The vector construction of transgenic mice overexpressing human sialyltransferase ST6GAL1, which synthesizes human α2,6-linked sialic acid receptors, includes three parts: K18, hST6GAL1, and luciferase. K18 is an endothelial cell-specific promoter; hST6GAL1 is the DNA sequence of human sialyltransferase, which is regulated by sialyltransferase to achieve the expression of sialic acid receptors with different binding sites; the Luciferase reporter gene system is a reporter system that uses luciferin as a substrate to detect the activity of firefly luciferase. The bioluminescent system of luciferin and luciferase can detect gene expression with extremely sensitivity and efficiency.

[0069] The K18 and luciferase plasmids were in-house. The hST6GAL1 gene was first searched on the NCBI website, and the complete sequence was downloaded and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The three gene segments were amplified and recovered using PCR, then seamlessly ligated into a vector to construct the K18-hST6GAL1-luciferase vector. After the vector was sequenced correctly, it was further linearized using the Sac1+Sph1 enzymes. A 7100 bp DNA fragment was excised and used for pronuclear microinjection to generate transgenic mice.

[0070] 1. Cloning of K18, hST6GAL1, PUC19L, and luciferase-POLYA fragments

[0071] 1) Amplification of K18, hST6GAL1, PUC19L, and luciferase-POLYA

[0072] (1) Cloning of mouse K18

[0073] Primers were designed based on the K18 plasmid sequence. The primer sequences (5'-3') are as follows:

[0074] K18-FW: CTCGGTACCAATAACAGTAAAAGGCAGT

[0075] K18-RV: GCACTAGTGGCGCGCCTGGAAGT

[0076] The above-mentioned primers were used to synthesize K18 plasmid 1# as template and Merck KOD One TM PCR MasterMix-BLUE (Code: KMM-201) was used for PCR reaction.

[0077] For a 200ul PCR reaction system, add the following solutions to a 200ul PCR tube:

[0078]

[0079] Mix the above solutions evenly and place them in a PCR instrument to perform PCR reaction according to the following conditions.

[0080] PCR reaction conditions: 98°C for 30 seconds; 98°C for 10 seconds, 68°C for 30 seconds (35 cycles); 68°C for 7 minutes; 20°C for 30 minutes.

[0081] A 3384 bp PCR product was obtained, and after sequencing, its nucleotide sequence was sequence 1, specifically the K18 fragment.

[0082] (2) Cloning of hST6GAL1

[0083] Primers were designed based on the hST6GAL1 plasmid sequence. The primer sequences (5'-3') are as follows:

[0084] ST6-FW:GGCGCGCCACTAGTGCCACCATGA

[0085] ST6-RV:TTGGTGGCTCTAGAGCAGTGAATGGT

[0086] The above-mentioned primers were used to synthesize hST6GAL1 gene as template and Merck KOD One TM PCR reaction was performed using PCRMaster Mix-BLUE (Code: KMM-201).

[0087] For a 200ul PCR reaction system, add the following solutions to a 200ul PCR tube:

[0088]

[0089] Mix the above solutions evenly and place them in a PCR instrument to perform PCR reaction according to the following conditions.

[0090] PCR reaction conditions: 98°C for 30 seconds; 98°C for 10 seconds, 68°C for 15 seconds (35 cycles); 68°C for 7 minutes; 20°C for 30 minutes.

[0091] A 1247 bp PCR product was obtained, and after sequencing, its nucleotide sequence was sequence 2, specifically the hST6GAL1 fragment.

[0092] (3) Cloning of luciferase-PLOYA

[0093] Primers were designed based on the luciferase-PLOYA sequence. The sequences of the primers (5'-3') are as follows:

[0094] ployA-FW:GCTCTAGAGCCACCAACTTCAGC

[0095] ployA-RV:TGCATGCCGATCCCCACAGCCTG

[0096] The above-mentioned primers were used to synthesize K18 1# plasmid as template and Merck KOD One TM PCR MasterMix-BLUE (Code: KMM-201) was used for PCR reaction.

[0097] For a 200ul PCR reaction system, add the following solutions to a 200ul PCR tube:

[0098]

[0099] Mix the above solutions evenly and place them in a PCR instrument to perform PCR reaction according to the following conditions.

[0100] PCR reaction conditions: 98°C for 30 seconds; 98°C for 10 seconds, 68°C for 30 seconds (35 cycles); 68°C for 7 minutes; 20°C for 30 minutes.

[0101] A 2488 bp PCR product was obtained, and after sequencing, its nucleotide sequence was sequence 3, specifically the luciferase-PLOYA fragment.

[0102] (4) PUC19L fragment

[0103] Primers were designed based on the PUC19L sequence. The sequences of the primers (5'-3') are as follows:

[0104] puc19L-FW:TGGGGATCGGCATGCAAGCTTGG

[0105] puc19L-RV: TGTTATTGGTACCGAGCTCGAATT

[0106] The above-mentioned primers were used to synthesize the puc19L vector as a template and the Merck KOD One TM PCR MasterMix-BLUE (Code: KMM-201) was used for PCR reaction.

[0107] For a 200ul PCR reaction system, add the following solutions to a 200ul PCR tube:

[0108]

[0109]

[0110] Mix the above solutions evenly and place them in a PCR instrument to perform PCR reaction according to the following conditions.

[0111] PCR reaction conditions: 98°C for 30 seconds; 98°C for 10 seconds, 68°C for 30 seconds (35 cycles); 68°C for 7 minutes; 20°C for 30 minutes.

[0112] A 2675 bp PCR product was obtained, and after sequencing, its nucleotide sequence was sequence 4, specifically the PUC19L fragment.

[0113] The electrophoresis results of the above four PCR products are as follows Figure 1 As shown in the electrophoresis diagram, from left to right are: M (DNA marker, Trans2k Plus BM111), K18 (3363 bp), hST6GAL1 (1208 bp), PUC19L (2626 bp), luciferase-PLOYA (denoted as PLOYA, 2459 bp in the figure). It can be seen that the size of the amplified target band is in line with expectations and can be used for subsequent purification, recovery and ligation.

[0114] 2) Recovery of PCR products

[0115] After gel electrophoresis, each of the above PCR products was recovered using a DNA rapid purification / recovery kit (Mineiute 28604 (50x) from Lamblide). The A260 / 280OD was measured using an ultraviolet spectrophotometer to estimate the concentration and purity of the PCR product. The recovered DNA was stored at -20°C until use.

[0116] The specific steps for recovering PCR products by gel electrophoresis are as follows:

[0117] (1) 0.7% agar gel electrophoresis, cut the gel and weigh it;

[0118] (2) Dissolve in water at 65℃ for 5-10 minutes until the gel is completely dissolved. During this period, shake and dissolve for 2-3 times. After dissolution, add 15ul of solution B at room temperature and mix thoroughly. Add buffer QG equal to 3 times the volume of the gel / liquid to the EP tube (1g of gel is equivalent to 1000ul, i.e. 1ml): Solubilize in a water bath at 50℃ for 10min (this water bath solubilization step is ignored for liquid recovery) to completely dissolve the gel; observe the color. If it is yellow, directly add isopropyl alcohol equal to the weight volume of the gel and mix and invert. If the color is orange or violet, add 10ul of 3M sodium acetate trihydrate (PH5.0) until the mixture turns yellow;

[0119] (3) The above mixture was passed through the column (13000 rpm, 1 min), 800 μl each time, until the filtration was complete. After filtration, let it stand for 1 min;

[0120] (4) Add 500 μl QG and centrifuge at 13,000 rpm for 1 min to remove the gel;

[0121] (5) Add 750 μl of PE at 13,000 rpm for 1 min;

[0122] (6) Run the binding column idle for 1 min to remove PE;

[0123] (7) Replace with a new 1.5ml EP tube, open the lid and let it air dry for 5-10 minutes, then place the binding column in the tube and add buffer TE / sterile water / EB. Let it rest for 1-2 minutes and then centrifuge at 13000 rpm for 1 minute. Elute with 10ul EB and measure the concentration.

[0124] (8) The recovered DNA was measured by UV spectrophotometer to determine the A260 / 280 value and estimate the concentration and purity of the PCR product. The DNA was then stored at -20°C for long-term preservation.

[0125] 2. Construction and identification of K18-hST6GAL1-luciferase expression vector

[0126] 1) Seamless ligation of K18, hST6GAL1, PUC19L, and luciferase-POLYA

[0127] After the PCR products of K18, hST6GAL1, PUC19L and luciferase-PLOYA were recovered, a seamless ligation kit (Beijing Quanshijin Biotechnology Co., Ltd., CU101) was used to seamlessly ligate the PUC19L-K18-hST6GAL1-luciferase vector (eg Figure 2 shown).

[0128] After sequencing, the PUC19L-K18-hST6GAL1-luciferase vector is a recombinant vector obtained by constructing a fragment consisting of K18, hST6GAL1 and luciferase-PLOYA into the PUC19L vector (PUC19L vector, manufacturer TransGen Biotech, product number R31108). The nucleotide sequence of the recombinant vector is sequence 5. The vector expresses the human ST6GAL1 gene and the promoter is K18.

[0129] The details are as follows:

[0130] (1) Establishment of cloning reaction system

[0131] Add the following solutions to a 1.5ml centrifuge tube to a final volume of 10ul:

[0132]

[0133] Calculation of vector and insert amounts:

[0134] pmols = mass in ng / fragment length in bp*0.65 kDa

[0135] In a 10 μl reaction system, the recommended amount of vector and each insert is 0.01-0.25 pmols. The optimal molar ratio of vector to each insert is 1:2 (the amount of vector and insert added is 0.25 pmols, and the molar ratio of vector to each insert is 1:1:1:1). Therefore, the final reaction system is:

[0136]

[0137] (2) Ligation reaction

[0138] After mixing the above 10ul system, mix gently and react in a PCR instrument at 50℃ for 15 minutes. After the reaction is completed, place the centrifuge tube on ice to cool for a few seconds. The recombinant product can then be stored at -20℃ or used directly for transformation.

[0139] (3) Transformation, recovery, and coating

[0140] A. Conversion:

[0141] a. Thaw 100 μl of Trans1-T1 competent cells taken out of a -80°C freezer on ice (or in an ice box at 4°C). After thawing, aliquot 100 μl into tubes A and B2, with 50 μl per tube.

[0142] b. Cold shock: Add 5 μl of the recombinant product (10 μl) from the 15-min reaction at 50°C to tube A and 5 μl to tube B. Place on ice (or in a 4°C refrigerator) for 30 minutes.

[0143] c. Heat shock: Place in a 42°C water bath for 30 seconds, then immediately transfer to ice and let stand for 2 minutes.

[0144] B. Recovery: Add 450 μl of AMP-free LB medium to the competent cell suspension (50 μl + 5 μl) after heat shock and shake at 200 rpm at 37°C for 1 hour.

[0145] C. Plating: Divide the revived cell solution (505ul) into two parts, 150ul and 350ul, and plate them separately. After plating, culture them at 37℃ overnight (16h) to obtain single colonies.

[0146] 2) Selection and identification of recombinant vector-positive colonies

[0147] Select 48 well-dispersed single white colonies and place them into 5 ml of liquid LB medium. Incubate at 37°C and 250 rpm for 12 hours. When the medium becomes turbid, aliquot 1 μl of the culture medium for PCR analysis to identify recombination. The PCR primer sequences (5'-3') are k18-lucF: acaagaggccttcctttggg; k18-lucR: ttcgagtgggtagaatggcg. A positive result of 1754 bp is considered. Store the remaining culture medium at 4°C.

[0148] The results are as follows Figure 3 As shown, M. DNA marker, Trans2k Plus BM111; 1-48. 48 randomly selected clones; target band 1773 bp. Electrophoresis results showed that except for 11 clones 12 / 14 / 22 / 26 / 29 / 30 / 34 / 36 / 38 / 41 / 46# which were negative, the rest were positive clones.

[0149] 3) Sequencing and sequence analysis

[0150] Positive clones 2#, 23#, and 24# were randomly selected from the positive clones, and the plasmids were extracted and sent to BGI Biological Co., Ltd. for sequencing, and the obtained sequences were analyzed.

[0151] The nucleotide sequences of the recombinant plasmids in the positive clones 2#, 23#, and 24# were all sequence 6. These positive clones were named recombinant plasmids K18-hST6GAL1-luciferase2#, 23#, and 24#, respectively.

[0152] 4) Amplification of the K18-hST6GAL1-luciferase expression vector verified by sequencing

[0153] The recombinant plasmids K18-hST6GAL1-luciferase2#, 23#, and 24# plasmids that were successfully verified by sequencing were further extracted and purified in large quantities.

[0154] The details are as follows:

[0155] A. Transformation of K18-hST6GAL1-luciferase expression vector

[0156] Take 5ul of K18-hST6GAL1-luciferase2#, 23#, and 24# plasmids and add them to 100ul of Top10 competent cells, ice bath for 30 minutes, incubate at 42℃ for 90 seconds, and then ice bath for 2 minutes. Then transfer them to 0.5ml of LB culture medium and incubate at 37℃ and 100rpm for 45 minutes. Then, aspirate 50ul and evenly spread it on a 10cm diameter LB plate and incubate at 37℃ for 18 hours.

[0157] Specific steps: transformation, recovery, and plating in the seamless connection of K18, hST6GAL1, PUC19L, and luciferase-POLYA.

[0158] B. Extraction of K18-hST6GAL1-luciferase expression vector

[0159] (1) Shake the mushrooms

[0160] Pick one single colony each of the transformed plasmids 2#, 23#, and 24#, add 1 ml of LB (AMP), and incubate at 37°C, 270 rpm, for 6 h;

[0161] Take 10ul of 2#, 23# and 24# culture medium and transfer them into a 10ml conical flask, incubate at 37℃ and 270rpm for 16h;

[0162] (2) Extraction of endotoxin-free plasmids for injection:

[0163] The three recombinant positive clone plasmids were extracted using Tiangen's DP118-02 Endotoxin-Free Mini-Medium Extraction Kit, and the positive recombinant plasmids were further digested with enzymes. Detailed experimental procedures for plasmid extraction are provided in the Tiangen DP118-02 Endotoxin-Free Mini-Medium Extraction Kit instructions.

[0164] The obtained plasmid was subjected to electrophoresis detection, and the results were as follows. Figure 4As shown, M. DNA marker, Trans15KBM161; from left to right, K18-hST6GAL1-luciferase 2#, 23#, and 24#. The positive recombinant plasmid target band is 9747 bp, and the electrophoresis results show the correct band.

[0165] 3. Enzyme linearization and purification of K18-hST6GAL1-luciferase expression vector

[0166] The recombinant plasmid K18-hST6GAL1-luciferase23# vector was digested with Sac1+Sph1 and linearized, and the target fragment of 7100 bp was recovered by gel analysis for microinjection.

[0167] After sequencing, the nucleotide sequence of the linearized plasmid after enzyme digestion was sequence 7, recorded as K18-hST6GAL1-luciferase linearized DNA fragment.

[0168] The details are as follows:

[0169] 1) Enzyme linearization

[0170] The K18-hST6GAL1-luciferase23# plasmid was digested with endonucleases Sac1+Sph1. The reaction system was as follows (450ul):

[0171]

[0172] Incubate in a 37° water bath overnight.

[0173] After mixing, digest at 37°C for 12 hours, and then draw 2 μl of the digestion reaction solution for electrophoresis to check whether the digestion is complete.

[0174] 2) Recovery and purification of the linearized K18-hST6GAL1-luciferase expression vector

[0175] After enzyme digestion, a 7100-bp band was recovered by agarose gel electrophoresis and purified using a DNA Rapid Purification / Recovery Kit (Lambolide, Mineiute 28604 (50x)) to obtain a K18-hS T6GAL1-luciferase linearized DNA fragment. After recovery, the A260 / 280OD value was measured using a UV spectrophotometer to calculate the concentration and purity of the PCR product. The recovered DNA was stored at -20°C until use.

[0176] The specific steps of recovering the PCR products by gel electrophoresis are as follows: the PCR products recovered from the clones of the same K18, hST6GAL1, PUC19L, and luciferase-POLYA fragments.

[0177] The linearized plasmid was recovered by electrophoresis, and the results were as follows: Figure 5 As shown, M.DNA marker, Trans15KBM161; 1: two fragments after K18-hST6GAL1-luciferase23# plasmid was double-digested with Sac1+Sph1. The band size was consistent with expectations, and the K18-hST6GAL1-luciferase linearized DNA fragment was obtained; 2: K18-hST6GAL1-luciferase 23# plasmid before enzyme digestion.

[0178] 3) Preparation of DNA samples for pronuclear injection

[0179] Calculate the DNA concentration by measuring the OD value of the DNA sample at a specific dilution ratio. OD value determination: measure the OD value at 260 nm and the OD value at 280 nm and calculate their ratio. Calculate DNA concentration: 260 nm OD value x 50 x dilution factor = DNA (ug / ml). Based on the measurement results, add an appropriate amount of TE to dilute the DNA (K18-hST6GAL1-luciferase linearized DNA fragment) to a concentration of 2-5 ng / ul. Centrifuge at 12,000g for 10 min at 4°C. Carefully aspirate the upper 1 / 3 of the solution after centrifugation and aliquot into a thoroughly washed 0.2ml tube at 20ul / tube (the upper 1 / 3 can be transferred to a clean 0.6ml tube before aliquoting). Finally, freeze the aliquoted DNA at -20°C or -80°C until ready for pronuclear injection. This is the K18-hST6GAL1-luciferase linearized DNA fragment solution (solvent: TE).

[0180] (II) Construction of B6-Tg (K18-hST6GAL1-Luc) humanized mice

[0181] 1. Preparation of B6-Tg (K18-hST6GAL1-Luc) humanized mice

[0182] The K18-hST6GAL1-luciferase linearized DNA fragment solution (solvent: TE) purified according to step (I) 3 above at a concentration of 2-5 ng / ul (3 ng / ul was used in the experiment) was used for pronuclear microinjection to generate B6-Tg (K18-hST6GAL1-Luc) humanized mice. The specific experimental steps are as follows:

[0183] (1) 4-5 week old female C57BL / 6 mice were selected as donors with their vaginal opening sealed. At around 3:00 pm, 10 IU pregnant mare serum (PMSG) was injected intraperitoneally into each mouse.

[0184] (2) After 47 to 48 hours, each mouse was intraperitoneally injected with 10 IU of human chorionic gonadotropin (HCG) and housed with a normal male mouse. Several C57BL / 6 female mice (over 2 months old) of appropriate age were selected as recipients. Female mice in estrus with flushed vaginal openings were selected and housed with the ligated male mice.

[0185] (3) Observe the donor and recipient before 9:00 am the next day. If there is sperm plug, remove it for future use. Remove the recipient cage and take isolation measures;

[0186] (4) Around 10:30, the donor was killed by cervical dislocation, and the entire fallopian tube was surgically removed and placed in M2 medium (M2 medium, SIGMA, catalog number M7167) containing 0.05% hyaluronidase. Under a microscope, the ampulla of the fallopian tube was torn open with forceps, and the fertilized egg and granulosa cells flowed out together;

[0187] (5) Carefully observe the fertilized egg placed in the hyaluronidase M2 solution. When the granulosa cells around the fertilized egg are detached, the fertilized egg is aspirated, placed in the M2 solution for washing, and finally placed in the M16 solution and cultured in a 5% CO2, 37°C CO2 incubator;

[0188] (6) Observe under a microscope and select fertilized eggs with plump cells, clear zona pellucida, and clearly visible male pronuclei for use;

[0189] (7) Install the egg holding needle and injection needle so that their ends are parallel to the stage. Place a drop of M2 solution in the center of the concave glass slide, cover with paraffin oil, and transfer the fertilized egg to be injected. All bubbles in the injection needle should be ejected beforehand.

[0190] (8) Under a high-power microscope, gently touch the oviduct with the injection needle to allow the DNA to flow out slowly and control its flow rate. Repeatedly blow and suck the fertilized egg to keep it in the optimal position. Insert the injection needle into the male pronucleus of the fertilized egg until the pronucleus swells and then withdraw the needle. Place the injected and uninjected fertilized eggs separately up and down to prevent mixing. After the injection is completed, place them in a 37°C 5% CO2 incubator for culture.

[0191] (9) The recipient is anesthetized and injected with 0.01 ml / g of 1% sodium pentobarbital intraperitoneally. The ovary is surgically removed and connected to the fallopian tube. It is fixed with fat forceps and the opening of the fallopian tube is found under a microscope. The fertilized egg that has survived the injection and culture is aspirated. The aspiration method is to first aspirate a longer section of M2, aspirate a bubble, then aspirate the fertilized egg, arranging it as closely as possible, aspirate a section of liquid, aspirate a bubble, and then aspirate a section of liquid, for a total of four sections of liquid and three bubbles. Except for the longer section of liquid, the rest of the liquid is about 1 cm, and the bubble is about 0.2 cm. Insert the transplant tube into the fallopian tube opening and gently blow the liquid in the transplant tube into the fallopian tube. When the ampulla of the fallopian tube is seen to swell and three bubbles are clearly seen, the transplant is successful. The ovary and fallopian tube are returned to the abdominal cavity and the muscles and skin are sutured.

[0192] (10) The recipient is weighed once a week. If the second weight is higher than the first, it can be preliminarily determined to be pregnant. The pups are born 19 to 21 days after the operation and are the transgenic founder mice.

[0193] II. Identification of B6-Tg (K18-hST6GAL1-Luc) Humanized Mice

[0194] After 3 weeks of transgenic founder mice, their toes were clipped and numbered, and their tails were cut to extract DNA for PCR analysis. After 6-7 weeks, in vivo analysis in mice was used to determine the expression of luciferase associated with the hST6GAL1 gene. The specific method is as follows:

[0195] 1. Genotype identification

[0196] 1) Extraction of mouse tail DNA

[0197] (1) Cut the tail of the mouse: Cut 1-3 mm of the tail and place it in a centrifuge tube (200 μl EP tube);

[0198] (2) Lysis: Add 100 μl of rat tail lysis buffer (with 1% proteinase K) to each sample, and place the EP tube horizontally on a shaker at 56°C, 270 rpm, overnight.

[0199] (3) Inactivation: Inactivate at 95°C for 15 min on a PCR instrument.

[0200] 2) PCR

[0201] (1) Primer design:

[0202] Based on the sequence of K18-hST6GAL1-luciferase transgenic mice, the sequences of PCR primers (5'-3') are as follows:

[0203] K18-ST6F:CGGTACCAATAACAGTAAAAGGCAGTACG

[0204] K18-ST6R:GATACCAAGCATCCCAGAGGATGG

[0205] (2) PCR reaction:

[0206] The above-mentioned primers were synthesized and mouse tail DNA was used as template. TM PCR MasterMix-BLUE (Code: KMM-201) was used for PCR reaction.

[0207] For a 10ul PCR reaction system, add the following solutions to a 10ul PCR tube:

[0208]

[0209] Mix the above solutions evenly and place them in a PCR instrument. Perform the PCR reaction according to the following conditions: 98°C for 30 seconds; 98°C for 10 seconds, 68°C for 30 seconds (35 cycles); 68°C for 7 minutes; 20°C for 30 minutes.

[0210] 3) Electrophoresis analysis

[0211] (1) Preparation of agarose gel: Weigh 0.8 g of agarose and dissolve it in 100 ml of 1xTAE electrophoresis buffer. Heat in a microwave oven until completely dissolved. Add 10 μl of EB and shake well to prepare a 0.8% agarose gel solution. Gently pour the agarose solution, cooled to 60°C, onto the horizontal plate of the electrophoresis tank. After the agarose gel solidifies, add electrophoresis buffer to the electrophoresis tank and remove the comb.

[0212] (2) Sample electrophoresis: After adding DNA sample, adjust the voltage to 120V for 25 minutes.

[0213] (3) Observation results: After the electrophoresis time is over, remove the gel, observe the position of the DNA bands under ultraviolet light, and take a photo under ultraviolet light to record the electrophoresis pattern.

[0214] The results are as follows Figure 6 As shown, M. DNA marker, Trans15K BM161; 1-20 represent 20 mice born. The target fragment is 4366 bp, of which 4, 8, 12, 14, 15, 17, and 20 are transgenic positive mice.

[0215] The mice obtained above were identified by PCR, and the target fragment (4366bp) was identified as a transgenic mouse with positive genotype identification. The results determined that there were 7 transgenic founder mice with positive genotype identification, which were numbered 4, 8, 12, 14, 15, 17, and 20 respectively.

[0216] 2. In vivo imaging analysis and identification of mice

[0217] D-luciferin potassium salt solution (15 mg / mL) was prepared in sterile DPBS (without Mg2+ and Ca2+), filtered through a 0.2 μm filter membrane for sterilization, and recorded as luciferin solution (luciferin substrate). Genotype-positive transgenic founder mice (numbered 4, 8, 12, 14, 15, 17, and 20; denoted as f0-4#, f0-8#, f0-12#, f0-14#, f0-15#, f0-17#, and f0-20# in the figure) and wild-type C57BL / 6 mice were injected with the corresponding amount of 15 mg / mL luciferin solution at a concentration of 10 μl / g body weight. The images were taken 10-15 minutes after intraperitoneal injection using a small animal imaging system (PerkinElmer, Inc.). III) Perform imaging analysis.

[0218] The results are as follows Figure 7 As shown, the control group was C57BL / 6; the experimental groups were humanized mice 4, 8, 12, 14, 15, 17, and 20. The results showed that five transgenic founder mice with positive genotype identification, f0-8#, f0-14#, f0-15#, f0-17#, and f0-20#, had fluorescent expression and the expression sites were consistent with the characteristics of influenza virus infection (such as expressing fluorescent signals in the respiratory tract or intestine infected by influenza virus), and were recorded as mice with positive in vivo imaging identification. The remaining mice had no fluorescent expression and were negative in vivo imaging identification.

[0219] The mice with positive genotype identification and positive in vivo imaging identification are the B6-Tg (K18-hST6GAL1-Luc) humanized mouse founders.

[0220] III. Breeding of B6-Tg (K18-hST6GAL1-Luc) Humanized Mice

[0221] 1. F1 generation K18-hST6GAL1-luciferase transgenic mice

[0222] B6-Tg (K18-hST6GAL1-Luc) humanized mice, founder f0-17#, were mated with C57BL / 6 mice to obtain the F1 generation. F1 generation mice that were positive for the same genotype as described above and positive for in vivo imaging analysis were designated as F1 generation K18-hST6GAL1-luciferase transgenic mice (B6-Tg (K18-hST6GAL1-Luc) humanized mice).

[0223] 2. F2 generation K18-hST6GAL1-luciferase transgenic mice

[0224] The F1 generation K18-hST6GAL1-luciferase transgenic mice were mated with C57BL / 6 mice to obtain the F2 generation. The F2 generation mice were identified as having the same positive genotype as the above two methods and as positive by in vivo imaging, and the stably inherited F2 generation K18-hST6GAL1-luciferase transgenic mice were obtained, namely B6-Tg (K18-hST6GAL1-Luc) humanized mice.

[0225] IV. Expression Analysis of B6-Tg (K18-hST6GAL1-Luc) Humanized Mice

[0226] Immunohistochemical staining was used to detect human ST6GAL1 expression in the lungs of F2 generation K18-hST6GAL1-luciferase transgenic mice (i.e., B6-Tg (K18-hST6GAL1-Luc) humanized mice). Paraffin-embedded sections were then sectioned and immunostained using Human ST6 Gal sialyltransferase 1 / ST 6GAL1 Antibody (bio-techne, AF5924). Wild-type C57BL / 6 mice served as controls. The experimental methods of paraffin-embedded sections and immunohistochemical staining can be found in reference (Han F, Liu C, Zhang L, Chen M, Zhou Y, Qin Y, Wang Y, Chen M, Duo S, Cui X, Bao S, Gao F. Globozo ospermia and lack of acrosome formation in GM130-deficient mice. Cell Death Dis. 2017 Jan 5; 8(1):e2532. doi:10.1038 / cddis.2016.414 IF:9.0Q1. PMID:28055014; PMCID:PMC5386352.).

[0227] The results are as follows Figure 8 Shown are: A: B6-Tg (K18-hST6GAL1-Luc) humanized mouse lung; B: C57BL / 6 mouse lung; human ST6GAL1 antibody signal is brown. The results show that the lung tissue of B6-Tg (K18-hST6GAL1-Luc) humanized mice expresses a large amount of human ST6GAL1 protein (A), while the lung tissue of wild-type C57BL / 6 mice does not express human ST6GAL1 protein (B).

[0228] V. Functional Characterization of Influenza Virus Infection in Humanized B6-Tg (K18-hST6GAL1-Luc) Mice

[0229] 1. Amplification assay of seasonal human influenza virus A / Hainan / CAS-HNGH78-0610 / 2022 (H3N2)

[0230] 1) Cell culture

[0231] (1) Cell recovery and culture

[0232] The frozen MDCK cells (purchased from the American type culture collection (ATCC)) were quickly placed in a water bath preheated to 37°C. The frozen cell fluid was shaken back and forth to quickly thaw. All of the cells were transferred to 10 mL of complete DMEM medium (added with 10% FBS + 1% SP), mixed well, and transferred to a T75-sized cell culture flask. It was placed in a cell culture incubator at 37°C and 5% CO2 for culture.

[0233] (2) Cell passage

[0234] MDCK cells can be passaged after 90% of the cells have formed into sheets. Gently wash with a small amount of PBS and add an appropriate amount of 0.25% trypsin solution to digest the cells (until the intercellular spaces increase and the cells become rounded). Then add an appropriate amount of complete DMEM and gently pipette the cells on the flask wall to detach the cells from the cell flask. Centrifuge (1000 rpm / min, 5 min) and discard the supernatant. Resuspend the cells in cell growth medium, transfer to a cell culture flask, and transfer to a cell culture incubator (37°C, 5% CO2) for static culture.

[0235] (3) Cryopreservation of cells

[0236] Prepare freezing solution (dimethyl sulfoxide (DMSO): fetal bovine serum = 1:9) in advance. Digest cells in the logarithmic growth phase in a T-75 cell culture flask, centrifuge (1000 rpm / min, 5 min), discard the supernatant, add 3 mL of freezing solution, and mix thoroughly. Aliquot into cryovials and slowly freeze (4°C / 1 hour, -20°C / 1 hour, -80°C overnight, then quickly transfer to liquid nitrogen for storage) or place in a cell freezing box to achieve a gradual cooling process to prevent ice crystal formation and cell rupture.

[0237] 2) Cellular infection

[0238] (1) Prepare a T75 flask containing MDCK cells to a cell confluence of approximately 80-90%.

[0239] (2) Discard the culture medium in the bottle and wash the cells twice with PBS;

[0240] (3) 30 μl of human influenza virus A / Hainan / CAS-HNGH78-0610 / 2022 (H3N2) (from Bi Yuhai's group at the Institute of Microbiology, Chinese Academy of Sciences, NMDC accession number of viral gene: NMDCN0001DIR-NMDCN0001DJ2) was added to the cells, and then 2970 μl of DMEM was added. The T75 flask was incubated at 37°C for 1 h.

[0241] (4) After the incubation is completed, discard the incubation liquid and add 15 ml of virus maintenance solution (DMEM + double antibody + 2 μg / ml trypsin);

[0242] (5) Observe the cell pathological changes daily. When the cell shedding rate is greater than 50%, place the cells in a -80°C refrigerator and freeze-thaw them 1-2 times. Aspirate the culture medium and centrifuge at 1000 g for 5 minutes. Filter the supernatant with a 0.22 μm filter and aliquot to obtain the amplified virus.

[0243] 3) Virus concentration

[0244] (1) Virus preparation: Take the amplified virus out of -80°C in advance and thaw it at 4°C;

[0245] (2) Ultrafiltration tube filling: 100 ml of virus sample was injected into a 100 kd ultrafiltration tube in batches using a syringe;

[0246] (3) Ultrafiltration: Place the ultrafiltration tube in a centrifuge and centrifuge at 5000g for 30 minutes. Through ultrafiltration, larger particles and impurities will be filtered out, while the virus will be concentrated in the ultrafiltration tube;

[0247] (4) Virus sample collection and storage: Use a pipette to carefully collect 1 ml of ultrafiltration-concentrated virus sample into a cryopreservation tube for the next experiment.

[0248] 4) Viral toxicity assay

[0249] (1) Hemagglutination test (HA)

[0250] A. Preparation of 2% guinea pig red blood cell suspension

[0251] a. Mix the red blood cells stored in Alsever's solution, aspirate an appropriate amount of the red blood cell suspension with a graduated pipette, and transfer it to a centrifuge tube. Each tube should not exceed 1 / 3 of the total volume. Centrifuge at 1500 rpm for 5 minutes and discard the supernatant (use a graduated pipette to aspirate and discard).

[0252] b. Pour PBS solution into the separatory tank, add at least 2 volumes of PBS with a pipette, wash three times, and mix well;

[0253] c. Centrifuge at 1500 rpm for 5 minutes for the first two times and discard the supernatant. Centrifuge at 1500 rpm for 10 minutes for the final time and discard the supernatant. The sedimented cells are concentrated guinea pig red blood cells.

[0254] d. Aspirate guinea pig red blood cells at 2 / 100 of the final volume of the required solution, pipette and swirl with PBS for more than 10 times to make a 2% guinea pig red blood cell suspension, label it, and store at 4°C until ready to use.

[0255] B. Red blood cell agglutination test

[0256] a. Add PBS: Install an 8-channel pipette with a 200µl filter dropper. Pipette 50µl of PBS into the sample reservoir and add it to the second column of the microplate. Continue adding 50µl of PBS to the last column.

[0257] b. Add the virus to be tested. Install a 200ul filter-cartridge dropper on the single-channel pipette, draw up 100ul of the virus solution to be tested, and add it to the corresponding well in the first column of the marked microtiter plate.

[0258] c. Equip an 8-channel pipette with a 200µl filter-tipped dropper. Pipette 50µl of virus solution from each well in the first column and add it to the corresponding wells in the second column. Mix several times. Perform two-fold serial dilutions from the second to the twelfth columns of the microplate. Discard 50µl of solution from each well in the last column.

[0259] d. Install a 200µl filter-tipped dropper into the 8-channel pipette and pipette 50µl of red blood cell suspension into the sample reservoir. Add 50µl of 1% red blood cell suspension to each well and gently tap the microplate to thoroughly mix the red blood cells and virus.

[0260] e. Incubate at room temperature for 40 minutes, observe red blood cell agglutination, and record the results. Determination of Result: The red blood cell agglutination titer is determined based on the highest dilution at which complete agglutination occurs. The reciprocal of this dilution is the viral red blood cell agglutination titer. Complete red blood cell agglutination is recorded as "+"; no or partial agglutination is recorded as "-".

[0261] Results: In 2 8 No obvious agglutination of red blood cells can be observed at different dilution multiples.

[0262] (2) TCID50 determination

[0263] A. MDCK cell lines in 96-well plates:

[0264] Madin-Darby canine kidney cells (MDCK) are passaged, and MDCK cells within 30 generations are generally used to determine the TCID50 of the virus.

[0265] a. Rinse MDCK cells in a T75 medium twice with PBS, add 2 ml of Trypsin and digest in a 37°C, 5% CO2 incubator. After digestion, add 4 ml of Trypsin and repeatedly pipette.

[0266] b. Spread MDCK cells in a 96-well plate at a ratio of 1:6, with 100 μl per well. Pour the cell solution into the separatory tank and add with a dispenser.

[0267] c. Place in a 37°C, 5% CO2 incubator for 12 to 24 hours. When the monolayer cells grow to 80% to 90%, they can be infected.

[0268] B. Virus Dilution and Inoculation

[0269] a. Prepare virus culture medium

[0270] Note that the virus culture medium must be prepared before use, and the virus culture medium must be used to dilute the virus.

[0271] For one 96-well plate, use 10 ml of virus culture medium. The amount to be added is:

[0272] 10ml (DMEM + 1% SP) + 1ml 10% BSA + 10l TPCK-trypsin

[0273] After mixing, shake well, pour into the separatory tank and add with a spray gun.

[0274] b. Virus Dilution: Add 146µl (actually 148µl, pipetting at first setting) of 1:100 diluted virus solution to each of the four wells in the first column. Add 100µl of virus culture solution to each well in the remaining columns. Then, use a multichannel pipette to pipette 46µl from the first well into the second well, pipetting and mixing thoroughly. Perform serial half-log dilutions to 10-2, 10-2.5, 10-3, 10-3.5, and so on to 10-7. The last column serves as a control. Each well contains 100µl of virus solution.

[0275] c. Wash cells:

[0276] Pour out the culture medium in the MDCK 96-well plate, pour PBS into the separatory tank, rinse twice with 100ul / well of PBS and pour out the medium, gently turn it upside down on absorbent paper to absorb the residual PBS.

[0277] d. Inoculate 100 μl of the diluted virus solution into a 96-well MDCK plate using a dispenser (please be careful not to blow it up). Make four sets of wells for each dilution and incubate in a 37°C, 5% CO2 incubator for 72 h.

[0278] e. After 72 hours, freeze the 96-well culture plate at -80°C. Repeat freezing and thawing three times (on ice or at room temperature) to disrupt the cells and release the virus. Perform a hemagglutination assay on the supernatant from each well using 50 μl of viral supernatant plus 50 μl of red blood cells. Record the hemagglutination results for each dilution well and calculate the TCID50 (50% tissue cell culture infectious dose) of the influenza virus being tested using the Reed-Muench method.

[0279] Results: The H3N2 influenza virus was concentrated and used to infect mice. 4 TCID 50 / 100ul.

[0280] 2. Influenza virus infection in B6-Tg (K18-hST6GAL1-Luc) humanized mice

[0281] The F2 generation B6-Tg (K18-hST6GAL1-Luc) humanized mice prepared above were cultured for one week. On the day of infection, each mouse was anesthetized with an inhalation anesthesia machine and 10 4 TCID 50 The mice were infected with 100ul of H3N2 influenza virus (A / Hainan / CAS-HNGH78-0610 / 2022) solution. The control group of C57BL / 6J mice was intranasally dripped for 10 4 TCID 50A 100 μL H3N2 influenza virus (A / Hainan / CAS-HN GH78-0610 / 2022) solution was administered intranasally to C57BL / 6J mice in the blank control group. The mice's body weight and survival rate were recorded for 14 days, and tissue and whole blood samples were collected.

[0282] Specific experimental steps:

[0283] (1) B6-Tg (K18-hST6GAL1-Luc) humanized mice were acclimatized for 7 days before the experiment.

[0284] (2) On the day of infection, the 10 4 TCID 50 / 100ul H3N2 influenza virus (A / Haina n / CAS-HNGH78-0610 / 2022) solution was taken out from -80℃ freezer. After each mouse was anesthetized with an inhalation anesthesia machine, 10 4 TCID 50 / 100ul virus solution 100ul infected mice. Control group C57BL / 6J mice 100ul nasal drops 10 4 TCID 50 The blank control group (C57BL / 6J mice) received 100 μl of PBS per nasal drip. Each group consisted of 3 mice.

[0285] (3) Weigh the mice every day

[0286] The results are as follows Figure 10 As shown, after B6-Tg (K18-hST6GAL1-Luc) mice were infected with H3N2 virus (denoted as B6-Tg (K18-hST6GAL1-Luc) + H3N2 in the figure), the body weight of two (out of three) mice dropped to less than 20% on the third day after infection, while C57BL / 6 mice did not lose weight after being infected with H3N2 (denoted as C57BL / 6 + H3N2 in the figure) and PBS (denoted as C57BL / 6 + PBS in the figure).

[0287] (4) Tissue sampling:

[0288] In the above (2), 3 mice in each group were nasally instilled with 10 4 TCID 50On the 3rd and 5th day after infection with / 100ul diluted virus solution, one mouse was dissected every day. The collected nasal concha, lungs and trachea were placed in EP tubes (PBS containing 3% PS and 1 steel ball). The mouse tissue was finely ground using Tissue Lyser I at 25Hz for 2 times / 1min and then centrifuged at 12000rpm for 3min at 4℃. The supernatant was dispensed into sterile tubes and stored in a -80℃ refrigerator for later use. The right upper lobe of the mouse lung was fixed with 4% paraformaldehyde. On the 21st day of infection, whole blood was collected from surviving mice, serum was separated, and stored at -80℃ for antibody determination.

[0289] Neutralizing antibodies are determined by the hemagglutination inhibition test:

[0290] (1) Mouse serum treatment

[0291] Place 1 volume of mouse serum in a sterile EP tube, add 3 volumes of RED and 1 volume of PBS, mix thoroughly by pipetting, and place in a 37°C water bath for 16-18 hours, overnight;

[0292] Remove the mouse serum from the water bath, adjust the water bath to 56°C, wait for the water temperature to rise, inactivate it in a water bath for 30 minutes, and store it at 4°C until use.

[0293] Dilute the RED-treated mouse serum sample: Serially dilute the RED-treated mouse serum in a 96-well V-shaped plate. Add 25 μl of serum to the first column of wells. Add 25 μl of PBS buffer to each well in columns 1-11. Add 50 μl of PBS buffer to column 12. Pipette 25 μl of mouse serum sample from the first column into the second column, mix thoroughly, and discard the pipette tip. Use a new pipette tip to transfer 25 μl of serum dilution from the second column into the third well, mix thoroughly, and so on until well 10. Finally, discard the 25 μl of virus dilution from well 10. The serum dilutions are now 10, 20, 40, 80, and so on to 2160.

[0294] (2) Prepare 4 agglutination units of antigen:

[0295] According to the hemagglutination titer of influenza virus, influenza virus was diluted to a hemagglutination titer of 8 and used as 4 units of antigen.

[0296] (3) Neutralization effect:

[0297] After serum dilution, add 25ul of freshly prepared 4 units of antigen to each well of the 96-well V-shaped plate.

[0298] Gently tap the microplate to fully mix the antigen and serum, and incubate at 37°C for 1 h;

[0299] (4) Result determination: Add 50 μl of 2% guinea pig red blood cell suspension to each well, mix well, and incubate for 40-60 minutes according to the above HA method. After incubation, observe and record the results of the red blood cell agglutination inhibition test.

[0300] Results: The hemagglutination inhibition titer of F2 generation B6-Tg (K18-hST6GAL1-Luc) humanized mice infected with human H3N2 influenza virus was 640; the hemagglutination inhibition titer of C57BL / 6 mice infected with human H3N2 influenza virus was 40; the hemagglutination inhibition titer of C57BL / 6 mice infected with PBS was 0; the cutoff value hemagglutination inhibition titer was set at 40, indicating that B6-Tg (K18-hST6GAL1-Luc) humanized mice had produced antibodies after infection with human H3N2 influenza virus, and were more susceptible to human H3N2 influenza virus than C57BL / 6 mice.

[0301] 3. Viral Load Determination in B6-Tg (K18-hST6GAL1-Luc) Humanized Mice Infected with Influenza Virus

[0302] 1) Extraction of influenza virus RNA

[0303] A tissue virus extraction kit (QIAGEN RNeasy Fibrous Tissue Mini Kit (50) catalog number: 74704) was used.

[0304] Specific steps:

[0305] (1) Place 300 μl of the lung tissue of B6-Tg (K18-hST6GAL1-Luc) humanized mice infected with influenza virus on days 3 and 5 in a solution of buffer RLT (with DTT added) and grind at 20 Hz until the tissue is completely homogenized.

[0306] (2) Add 590 μl of RNase-free water to the lysate, then add 10 μl of proteinase K solution and mix. Incubate at 55°C for 10 min, then centrifuge at 10,000 rpm for 3 min at 15-25°C.

[0307] (3) Add 0.5 times the volume of anhydrous ethanol to the supernatant and transfer it to the centrifuge column provided by the kit and centrifuge at 10,000 rpm for 30 seconds.

[0308] (4) Discard the supernatant and add 350 μl of buffer RW1 to the centrifuge column. Centrifuge at 10,000 rpm for 15 seconds and discard the supernatant.

[0309] (5) Add DNase I incubation mixture (10 μl DNase I stock solution added to 70 μl Buffer RDD) to the RNeasy Mini spin column membrane for 15 minutes;

[0310] (6) Add 350 μl of buffer RW1 to the RNeasy Mini spin column and centrifuge at 10,000 rpm for 15 seconds.

[0311] (7) Add 500 μL of buffer RPE to the centrifuge column, centrifuge at 10,000 rpm for 15 s, discard the supernatant, and repeat the centrifugation at 10,000 rpm for 2 min.

[0312] (8) Transfer the centrifuge column to a new 2 ml collection tube and centrifuge at 12,000 rpm / min for 1 min; transfer the centrifuge column to a 1.5 ml EP tube, add 35 μL of RNase-free water, centrifuge at 10,000 rpm / min for 2 min, and collect the RNA extract.

[0313] 2) Real-time RT-PCR

[0314] Using TaKaRa's One-Step PrimeScript TM Reverse transcription and real-time PCR reactions were performed using RT-PCR Kit (Cat. No. RR064A).

[0315] (1) The system is

[0316]

[0317] (2) Amplification reaction:

[0318] The sequences of the upstream and downstream primers (5'-3') are:

[0319] InfA-Fwd: CTTCTAACCGAGGTCGAAACGTA

[0320] InfARev:GGTGACAGGATTGGTCTTGTCTTTA

[0321] InfA-Prb: 5'TCAGGCCCTCTCAAAGCCGAG[5']Fam[3']BHQ-I-3'.

[0322] Real-time PCR reaction conditions were: 42°C for 5 min; 95°C for 10 min; 95°C for 5 s, 60°C for 34 s, for 40 cycles.

[0323] 3) Establishment of standard curve

[0324] A viral plasmid (expressing A / Hainan / CAS-HNGH78-0610 / 2022 genomic fragments, obtained by amplifying genomic DNA from InfA-Fwd and InfARev and inserted into the pMD18-T vector) was used as a standard and serially diluted. After real-time RT-PCR, a straight line was established based on the quantitative relationship between copies and Ct values ​​of the serially diluted standard: copies (log, 2) = -1.0674 Ct value + 39.811.

[0325] 4) Calculation of sample viral load

[0326] Substitute the Ct value of the sample into the standard curve equation.

[0327] The results are as follows Figure 9 As shown, the three groups from left to right are: B6-Tg (K18-hST6GAL1-Luc) humanized mice infected with human influenza virus (denoted as K18-hST6GAL1+H3N2 in the figure); C57BL / 6 mice infected with virus (denoted as C57BL / 6+H3N2 in the figure); C57BL / 6 mice infected with PBS (denoted as C57BL / 6+PBS in the figure); It can be seen that B6-Tg (K18-hST6GAL1-Luc) humanized mice infected with H3N2 influenza virus were dissected and their lungs were taken for real-time analysis on the 3rd and 5th days. PCR, the CT values ​​of the transgenic mice on the 3rd and 5th day of infection were both 21, while the CT values ​​of the control group and the blank control were both above 30. The standard curve was used to calculate that the lung viral load of the transgenic mice on the 3rd day of infection was 1809230.188 copies / g, and on the 5th day of infection was 1088031.717 copies / g. The viral load of the control group and the blank control was both 500 copies / g.

[0328] The results showed that compared with C57BL / 6 mice, B6-Tg (K18-hST6GAL1-Luc) humanized mice were more susceptible to infection with H3N2 influenza virus.

[0329] Therefore, B6-Tg (K18-hST6GAL1-Luc) humanized mice are a mouse model of human influenza virus infection and can be used to screen H3N2 influenza virus drugs.

Claims

1. A method for constructing a mouse model for infection with human influenza virus, comprising the following steps: 1) The endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 gene, and the luciferase gene were introduced into wild-type mice to generate transgenic founder mice; 2) performing genotyping and in vivo imaging identification on the transgenic founder mice, selecting mice that are positive in genotyping and in vivo imaging identification and recording them as positive transgenic founder mice; then mating the positive transgenic founder mice with the wild-type mice to obtain F1 generation mice; 3) performing genotyping and in vivo imaging analysis on the F1 generation mice, selecting mice that are positive in genotyping and in vivo imaging, and recording them as positive F1 generation mice; then mating the positive F1 generation mice with the wild-type mice to obtain F2 generation mice; 4) performing genotyping and in vivo imaging identification on the F2 generation mice, selecting mice that are positive in genotyping and in vivo imaging identification and recording them as positive F2 generation mice, which are used as mouse models for human influenza virus infection; The genotype identification is performed by PCR amplification using primers that amplify the full length or part of the gene encoding human sialyltransferase ST6GAL1. If the target fragment is found, the genotype identification is positive; The in vivo imaging identification is to introduce fluorescein into mice and then perform in vivo imaging analysis, and the presence of fluorescence expression is considered positive in the in vivo imaging identification; The nucleotide sequence of the endothelial cell-specific promoter K18 is sequence 1 or a sequence that is at least 75% identical thereto and has the same function; The nucleotide sequence of the gene encoding the human sialyltransferase ST6GAL1 is sequence 2 or a sequence that is at least 75% identical thereto and has the same function; The nucleotide sequence of the luciferase encoding gene is sequence 3 or a sequence that is at least 75% identical thereto and has the same function.

2. The method according to claim 1, wherein: The method further comprises the following step 5): detecting the expression of human ST6GAL1 in the lung tissue of the positive F2 generation mice; if human ST6GAL1 is expressed in the lung tissue, the positive F2 generation mice are a mouse model for human influenza virus infection.

3. The method according to claim 2, wherein: The method further comprises the following step 6): inoculating the mouse model for human influenza virus infection with human influenza virus; if the infection is successful, a mouse model infected with human influenza virus is obtained.

4. The method according to any one of claims 1 to 3, characterized in that: The endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene are introduced into the mouse via linearized DNA fragments; Furthermore, the nucleotide sequence of the linearized DNA fragment is specifically sequence 7.

5. The method according to claim 4, characterized in that: The linearized DNA fragment is a recombinant vector Sac 1 and Sph 1 obtained by enzyme digestion; The recombinant vector is a recombinant vector obtained by constructing the DNA fragments of the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene and the luciferase encoding gene into an expression vector; The expression vector is puc19L.

6. A linearized DNA fragment comprising the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene and the luciferase encoding gene in claim 1; the nucleotide sequence of the linearized DNA fragment is sequence 7.

7. A recombinant vector, which is obtained by constructing the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene into an expression vector according to claim 1; The expression vector is puc19L.

8. A method for preparing the linearized DNA fragment according to claim 6, comprising digesting the recombinant vector according to claim 7 with endonucleases Sac1 and Sph1.

9. Use of the combination of the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene according to claim 1 in constructing a mouse model for human influenza virus infection or a mouse model of human influenza virus infection.

10. Use of the linearized DNA fragment according to claim 6 in constructing a mouse model for human influenza virus infection or constructing a mouse model of human influenza virus infection.

11. Use of the recombinant vector according to claim 7 in constructing a mouse model for human influenza virus infection or constructing a mouse model of human influenza virus infection.

12. Use of the endothelial cell-specific promoter K18, the human sialyltransferase ST6GAL1 encoding gene, and the luciferase encoding gene of claim 1 in any one of the following B1-B3: B1) Preparation of products for studying human influenza virus infection; B2) Preparation and evaluation of human influenza virus vaccine products; B3) Develop or screen drugs to prevent and / or treat human influenza viruses.

13. Use of the linearized DNA fragment according to claim 6 in any of the following B1-B3: B1) Preparation of products for studying human influenza virus infection; B2) Preparation and evaluation of human influenza virus vaccine products; B3) Develop or screen drugs to prevent and / or treat human influenza viruses.

14. Use of the recombinant vector according to claim 7 in any one of the following B1-B3: B1) Preparation of products for studying human influenza virus infection; B2) Preparation and evaluation of human influenza virus vaccine products; B3) Develop or screen drugs to prevent and / or treat human influenza viruses.

15. Use of a mouse model for human influenza virus infection constructed by the method of any one of claims 1-2, 4, and 5 in any one of the following B1-B3: B1) Preparation of products for studying human influenza virus infection; B2) Preparation and evaluation of human influenza virus vaccine products; B3) Develop or screen drugs to prevent and / or treat human influenza viruses.

16. Use of the human influenza virus infection mouse model constructed by the method according to any one of claims 3 to 5 in any one of the following B1 to B3: B1) Preparation of products for studying human influenza virus infection; B2) Preparation and evaluation of human influenza virus vaccine products; B3) Develop or screen drugs to prevent and / or treat human influenza viruses.

Images