A white shiitake mushroom strain, its fruiting body and application thereof

Abstract

The application discloses a white jade mushroom strain, a fruiting body thereof and application of the white jade mushroom strain, and the preservation number of the white jade mushroom strain (Hypsizygus marmoreus) is GDMCC No: 63404. The star river white jade mushroom No. 1 strain provided by the application has a fruiting body cluster type, does not have a tumorous cap mushroom, has a semicircular cap, is white in color, and has uniform and distributed spots on the whole cap; the gill is yellowish white, radial, and has general density; the stipe is medium in growth, medium in thickness, white in color, and has no hair, and the mushroom type is better, the yield per unit is high, the mushroom cap is thick and is not easy to be damaged during harvesting, the yield of good products is high, the cultivation cycle is short, and the star river white jade mushroom No. 1 strain is suitable for factory cultivation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a strain of Hypsizygus marmoreus, its fruiting body, and its applications. Background Technology

[0002] White jade mushroom (Hypsizygus marmoreus), also known as seafood mushroom, white crab mushroom, white true pheasant mushroom, and spotted jade mushroom, belongs to the subphylum Basidiomycota, class Agaricomycetes, order Agaricales, family Tricholomataceae, tribe Gyrophyllae, and genus Hypsizygus. It is a rare edible fungus.

[0003] White jade mushrooms contain higher levels of protein than most vegetables, with a suitable ratio of essential amino acids, and also contain various trace elements and other essential substances for the human body. For optimal health benefits, they should be consumed regularly. White jade mushrooms have analgesic, sedative, antitussive, expectorant, laxative, detoxifying, and blood pressure-lowering effects. They are rich in nutrients, containing abundant polysaccharides and various vitamins. Regular consumption can improve metabolism and lower cholesterol levels. The active ingredients in white jade mushrooms can enhance T-lymphocyte function, thereby improving the body's immunity against various diseases. Brazilian research has extracted a substance from white jade mushrooms that has analgesic and sedative effects, with an analgesic effect comparable to morphine. Animal experiments using white jade mushroom extract have shown significant antitussive and expectorant effects. Fresh white jade mushrooms are valued at 30 to 40 yuan and are hailed as the "golden leaves" of edible fungi, possessing broad cultivation prospects and market potential.

[0004] With market development, consumers have increasingly higher demands for the quality of white jade mushrooms, highlighting the growing problem of insufficient reserve varieties for producers. Currently, the market offers relatively limited cultivation varieties of white jade mushrooms, with significant instances of synonymy. Therefore, understanding the cultivation methods of known varieties and breeding new varieties remains a crucial research topic in the white jade mushroom research and production field. Furthermore, strains used for factory-scale white jade mushroom production are prone to decline with long-term use and are susceptible to disease and tubercles. Therefore, a new, high-performance white jade mushroom variety is urgently needed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a white jade mushroom strain, its fruiting body, and its applications. Specifically:

[0006] The first aspect of this invention provides a strain of white jade mushroom (Hypsizygus marmoreus), whose preservation number is GDMCC No:63404.

[0007] In a preferred embodiment, the specific sequence of the white jade mushroom strain is shown in SEQ ID NO:12.

[0008] In a preferred embodiment, the *Pleurotus ostreatus* strain possesses its own unique specific sequence, which is determined by conventional specific sequence identification methods in the art, such as SCAR analysis, ITS analysis, SCAR SRAP analysis, and whole-genome sequencing analysis. The specific sequence of the *Pleurotus ostreatus* strain described in this invention is obtained after identification using the above methods, and this specific sequence is not possessed by other *Pleurotus ostreatus* strains.

[0009] The second aspect of the present invention provides a white jade mushroom fruiting body, which is obtained by cultivating the white jade mushroom strain described in the first aspect of the present invention.

[0010] In a preferred embodiment, the cap diameter of the fruiting body is 8-22 mm.

[0011] In a preferred embodiment, the stipe length of the fruiting body is 60-115 mm.

[0012] The third aspect of the present invention provides a method for cultivating the fruiting bodies of *Pleurotus ostreatus* as described in the second aspect of the present invention, comprising the following steps: culturing and cultivating the *Pleurotus ostreatus* strain on a cultivation medium.

[0013] In a preferred embodiment, the cultivation medium comprises the following preparation ingredients by weight fraction:

[0014] The ingredients are: 20%–30% corn cobs, 15%–25% hardwood sawdust, 15%–25% cottonseed hulls, 15%–25% wheat bran, 15%–20% rice bran, and 3%–8% corn flour.

[0015] In a preferred embodiment, the corn cob content is 20% or 25%.

[0016] In a preferred embodiment, the hardwood chips comprise 15%, 18%, 20%, or 25%.

[0017] In a preferred embodiment, the cottonseed hulls are 15%, 18%, 20%, or 25%.

[0018] In a preferred embodiment, the bran content is 15%, 18%, 20%, 23%, or 25%.

[0019] In a preferred embodiment, the rice bran comprises 15%, 18%, or 20%.

[0020] In a preferred embodiment, the corn flour is 3%, 5%, or 8%.

[0021] In a preferred embodiment, the culture temperature is 21°C to 26°C, for example, 23°C or 25°C.

[0022] In a preferred embodiment, the humidity during the cultivation process is 65% to 75%, for example 68%, 70%, or 73%.

[0023] In a preferred embodiment, the CO2 concentration during the cultivation process is 2000ppm to 3000ppm, for example, 1200ppm, 1500ppm, 1800ppm, 2000ppm, 2200ppm, 2500ppm or 2800ppm.

[0024] In a preferred embodiment, the cultivation temperature is 14°C to 18°C, for example, 15°C, 16°C or 17°C.

[0025] In a preferred embodiment, the humidity of the cultivation is 92% to 96%, for example 93%, 94% or 95%.

[0026] In a preferred embodiment, the CO2 concentration during the cultivation process is 2500ppm to 3000ppm, for example, 2500ppm or 2800ppm.

[0027] In a preferred embodiment, the light intensity during cultivation is 0 Lux to 800 Lux, for example, 0 Lux, 50 Lux, 100 Lux, 150 Lux, 200 Lux or 250 Lux.

[0028] In another aspect, the present invention also provides the application of the *Pleurotus ostreatus* strain as described in the first aspect of the present invention in the preparation of any one of *Pleurotus ostreatus* spores, *Pleurotus ostreatus* mycelia, and *Pleurotus ostreatus* fruiting bodies.

[0029] In another aspect, the present invention also provides the application of the fruiting bodies of *Pleurotus ostreatus* as described in the second aspect of the present invention in food processing.

[0030] In another aspect, the present invention also provides the use of the white jade mushroom strain as described in the first aspect of the present invention or the white jade mushroom fruiting body as described in the second aspect of the present invention in the preparation of any one of the following: immune-enhancing drugs, cholesterol-lowering drugs, anti-aging drugs, analgesics, sedatives, antitussive and expectorant drugs, laxative and detoxifying drugs, and antihypertensive drugs.

[0031] The core technical solution of the invention is that the invention is obtained by using hybridization breeding technology to select and breed white jade mushrooms through single-cross hybridization. It is a new variety of white jade mushroom with excellent performance, such as better mushroom shape, shorter cultivation cycle, higher yield, thicker mushroom cap, and higher rate of good quality. It is called Xinghe White Jade Mushroom No. 1.

[0032] This invention provides a strain of *Pleurotus ostreatus*, with accession number GDMCC No:63404, belonging to the genus *Pleurotus ostreatus*, and deposited on April 26, 2023; the deposit location is Guangdong Provincial Microbial Culture Collection Center (GDMCC).

[0033] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0034] The reagents and raw materials used in this invention are all commercially available.

[0035] The positive and progressive effects of this invention are as follows: The Xinghe White Jade Mushroom No. 1 strain provided by this invention has a clustered fruiting body type, does not develop tubercles, the cap is semi-circular, white in color, and the markings are evenly distributed on the entire cap; the gills are yellowish-white, radial, and of moderate density; the stipe is centrally located, medium-thick, white, and hairless, with a good mushroom shape, high yield per unit area, thick cap that is not easily damaged during harvesting, high rate of good quality, and short cultivation cycle, making it suitable for industrialized cultivation.

[0036] Information on the preservation of biological materials

[0037] The Hypsizygus marmoreus strain of this invention was deposited on April 26, 2023, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, Experimental Building, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, 510070, China. The accession number is GDMCC No:63404, the culture name is Xinghe Hypsizygus marmoreus 1 SGXH-37-1, and the classification name is Hypsizygus marmoreus. Attached Figure Description

[0038] Figure 1 The image shows the antagonistic experiment results of Xinghe White Jade Mushroom No. 1 strain with existing White Jade Mushroom strains and parent strains. The left half of each culture medium shows Xinghe White Jade Mushroom No. 1 strain, and the right half of each culture medium shows ACCC51583 and KB-W5 (first row), WB-88-2 and WB-90 (second row), and XCXH-2 and WB-19 (third row), respectively.

[0039] Figure 2 The appearance characteristics of the Xinghe White Jade Mushroom No. 1 strain.

[0040] Figure 3 The images show the electrophoresis results for each sample. M: marker 2000 (from top to bottom: 2000, 1500, 1000, 750, 500, 250, 100bp); 1 to 4 are strains of *Pleurotus ostreatus* No. 1, *Pleurotus ostreatus* No. 2, *Xinghe* No. 2, and WB-19, respectively.

[0041] Figure 4 The image shows an agarose gel electrophoresis result, with M values ​​from top to bottom representing 5000, 3000, 2000, 1000, 750, 500, 250, and 100bp.

[0042] Figure 5 This is the result of a phylogenetic tree. Detailed Implementation

[0043] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0044] Example 1: Screening of new varieties of white jade mushroom

[0045] (1) Parental selection: WB-19 and XCXH-2 were selected as parents. WB-19 is a strain of white jade mushroom obtained by tissue isolation method of fruiting body tissue of Shaoguan Xinghe Biotechnology Co., Ltd. XCXH-2 is disclosed in Chinese Patent 202010345235.X. This strain was deposited at China Center for Type Culture Collection on April 17, 2020, with accession number CCTCC NO:M2020068.

[0046] The PDA culture medium is prepared as follows: 200g potato, 20g glucose, 20g agar powder, add water to make up to 1L.

[0047] Original culture medium: 65% sawdust, 20% rice bran, 15% wheat bran, with a moisture content of 62%–64%.

[0048] Culture medium for cultivation: 21% corn cob, 20% hardwood sawdust, 19% cottonseed hulls, 19% wheat bran, 16% rice bran, 5% corn flour, with a moisture content of 64%–66%.

[0049] (2) Single spore collection: The caps of WB-19 and XCXH-2 that have opened their caps were removed and hung in sterile, dry Erlenmeyer flasks. They were placed in a dark incubation room for 3-4 days to allow the caps to eject spores to the bottom of the Erlenmeyer flasks. Then, 10 mL of distilled water was added. Under sterile conditions, the collected spores were diluted until 2-3 spores were observed under a 40x microscope. They were then spread on PDA medium for culture. When a single colony appeared, the hyphae of the single colony were picked and cultured on a plate of PDA medium at 23°C. The presence of clamp connections was used as the criterion for judgment by microscopic examination. Spores without clamp connections were identified as single spores.

[0050] (3) Single-spore hybridization: 10 single spores of WB-19 and XCXH-2 with fast growth and vigorous aerial hyphae were selected. Under aseptic conditions, the single-kine strain of WB-19 was paired with the single-kine strain of XCXH-2 for a total of 100 combinations. The single-kine strains were picked and inoculated onto PDA plates with a distance of 3 cm between the two blocks. The plates were incubated at 23℃.

[0051] (4) Hybrid strains: When two hyphae cross-link together, pick the cross-linked hyphae onto a glass slide, cover with a coverslip, and examine under a microscope to determine whether clamping connections exist. Among them, 45 combinations have clamping connections. Observe the strains with clamping connections, pick the cross-linked hyphae and transfer them to a plate PDA medium. Incubate at 23℃ for 12-13 days. Under aseptic conditions, pick the colony hyphae onto a test tube slant PDA medium for culture to obtain the hybrid strain. After inoculating the white jade mushroom hybrid strain, place the test tube in a 25℃ incubator for culture until the hyphae cover the slant. This can be used as the mother culture.

[0052] (5) Cultivation and screening: The obtained hybrid strains were cultivated and screened according to conventional methods. A new variety of white jade mushroom with excellent performance, namely Xinghe White Jade Mushroom No. 1 SGXH-37-1 (hereinafter referred to as Xinghe White Jade Mushroom No. 1), was screened out. It has a short cultivation cycle, high yield, good mushroom shape, thick mushroom cap that is not easily damaged during harvesting, and high yield rate.

[0053] Example 2 Antagonism Test

[0054] Testing criteria: The inoculation, cultivation and observation of the samples to be tested were carried out in accordance with the People's Republic of China agricultural industry standard "NY / T1845-2010 Differential Identification and Antagonistic Reactions of Edible Fungi Strains".

[0055] The *Xinghe Baiyugu* strain No. 1 obtained in Example 1 was subjected to antagonism tests with existing *Xinghe Baiyugu* strains ACCC51583, KB-W5, WB-88-2, and WB-90, as well as parental strains XCXH-2 and WB-19. Among them, ACCC51583 was purchased from the China Agricultural Microbial Culture Collection Center ZY-3-6-2023-120, KB-W5 was purchased from Katsuragi Sangye Co., Ltd. in Japan KA20230405, WB-88-2 was obtained from *Xinghe Baiyugu* strain purchased from Fujian Wancheng Biotechnology Group Co., Ltd. through fruiting body tissue isolation method, and WB-90 was obtained from *Xinghe Baiyugu* strain purchased from Yiyang Mushroom Industry Co., Ltd. through fruiting body tissue isolation method.

[0056] The antagonistic test was conducted using PDA medium: 200g potato, 20g glucose, and 20g agar per 1L of medium.

[0057] The specific operation of the antagonistic experiment is as follows: Xinghe White Jade Mushroom No. 1 and the existing White Jade Mushroom strains ACCC51583, KB-W5, WB-88-2, and WB-90, as well as the parent strains XCXH-2 and WB-19, were respectively inoculated and cultured on PDA plates. The inoculation points were 3 cm apart, and the culture was carried out at a constant temperature of 23℃ for 18 days.

[0058] Figure 1 This image shows the antagonistic experiment results of *Xinghe White Jade Mushroom No. 1* with various strains. The left half of each culture medium represents *Xinghe White Jade Mushroom No. 1*, and the right half of each medium, in order, represents ACCC51583 and KB-W5 (first row), WB-88-2 and WB-90 (second row), and XCXH-2 and WB-19 (third row). Figure 1 It can be seen that at the boundary of the opposing culture colonies, the Xinghe White Jade Mushroom No. 1 strain has obvious antagonistic lines with the existing White Jade Mushroom strains ACCC51583, KB-W5, WB-88-2, and WB-90 on the market, as well as the parent strains XCXH-2 and WB-19. Furthermore, the mycelial growth and morphology at the spawn stage are completely different. This indicates that the Xinghe White Jade Mushroom No. 1 provided by this invention is a White Jade Mushroom strain that is different from the existing White Jade Mushroom strains and parent strains on the market.

[0059] Example 3: Cultivation and Planting Experiment

[0060] The *Pleurotus ostreatus* strain 1 of this invention and its parent strain *Pleurotus ostreatus* WB-19 (as a control) were used for four mycelial ages, from 75 days to 95 days, with each age increasing by 5 days, and 96 bottles per age. Cultivation and propagation experiments were conducted, with each cultivation bottle having a volume of 1170 cc.

[0061] Original culture medium: 65% sawdust, 20% rice bran, 15% wheat bran, with a moisture content of 62%–64%.

[0062] Culture medium for cultivation: 21% corn cob, 20% hardwood sawdust, 19% cottonseed hulls, 19% wheat bran, 16% rice bran, 5% corn flour, with a moisture content of 64%–66%.

[0063] The cultivation and breeding experiments specifically include the following steps:

[0064] (1) Cultivation: The original strain of the above-mentioned white jade mushroom strain was inoculated into the culture medium and cultured under the conditions of temperature 21-26℃, relative humidity 65-75% and carbon dioxide concentration 2000-3000ppm.

[0065] (1) Growth: The temperature in the cultivation room was set at 14–18℃, humidity at 92–96%, and carbon dioxide concentration at 2500–3000 ppm. The light intensity was set at 0–100 Lux for the first 1–7 days, and then at 200–300 Lux. The shelf lights were turned on intermittently each day. The fruiting bodies of the white jade mushroom strain were harvested when the caps were nearly mature. The results of the culture and cultivation experiments of each strain are shown in Table 1, and the results of the fruiting experiment are shown in Table 2.

[0066] Table 1 Comparison of cultivation experiment results and biological efficiency of *Pleurotus ostreatus* strains

[0067]

[0068] Table 2 Fruiting experiment results of the white jade mushroom strain

[0069]

[0070] Table 1 shows that WB-19 has a maximum yield of 329g, an optimal mycelial age of 85 days, and a corresponding cultivation cycle of 23 days. In contrast, Xinghe White Jade Mushroom No. 1 has a maximum yield of 372g, an optimal mycelial age of 80 days, and a cultivation cycle of 23 days. The comparison shows that, under the same cultivation cycle, Xinghe White Jade Mushroom No. 1 provided by this invention has a shorter growth cycle (2-4 days shorter than its parent strain WB-19) and a yield increase rate of 10.6-22.3%. This indicates that Xinghe White Jade Mushroom No. 1 provided by this invention has a significant advantage in yield and a shorter cultivation cycle, with an optimal cultivation cycle of 80 days. Table 2 shows that the fruiting effect of Xinghe White Jade Mushroom No. 1 is significantly better than that of WB-19.

[0071] Example 4: Morphological characteristics and biological properties

[0072] Morphological characteristics: The mycelium is white and dense, with well-developed aerial mycelium; the cap is semi-circular, white in color, with evenly distributed markings on the entire cap; the gills are yellowish-white, radial, and of moderate density; the stipe is centrally located, medium-thick, white, and hairless.

[0073] The appearance characteristics of Xinghe White Jade Mushroom No. 1 strain are as follows: Figure 2 As shown in Table 3, the varietal characteristics of the parents and heterozygotes are compared:

[0074] Table 3 Comparison of Variety Characteristics

[0075]

[0076] Example 5 Variety Identification and Testing Experiment 1

[0077] 1. Molecular marker amplification methods

[0078] 1.1 Test strains:

[0079] Table 4 Tested bacterial strains

[0080]

[0081]

[0082] Among them, the preservation number of Xinghe White Jade Mushroom No. 1 is GDMCC No: 63404; the preservation number of Xinghe White Jade Mushroom No. 2 is GDMCC No: 63753, and the preservation number of Xinghe No. 2 strain is GDMCC No: 61908.

[0083] 1.2 Methods

[0084] 1.2.1 DNA extraction of the strain was performed in accordance with the instructions of Magen HiPure Fungal DNA Kit (100mg) Fungal DNA Extraction Kit (Guangzhou Meiji Biotechnology Co., Ltd., No. D3171-02).

[0085] 1.2.2 The primers used refer to the specific primers described in the published authorized patents “ZL201310030594.6 Molecular markers and their acquisition methods and applications of pure white Pleurotus eryngii Finc-W-62; ZL 201310030533 Molecular markers and their acquisition methods and applications of pure white Pleurotus eryngii Finc-W-90; ZL201310030553 Molecular markers and their acquisition methods and applications of pure white Pleurotus eryngii Finc-W-247”.

[0086] Table 5 Primer sequences used in the test

[0087]

[0088] 1.2.3 PCR amplification reaction system

[0089] Table 6 PCR Reaction System

[0090]

[0091] 1.2.4 PCR Amplification Reaction Procedure

[0092] The amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; and finally 72℃ to finish for 5 min, with a stop temperature of 22℃.

[0093] 1.2.5 Detection of amplification products

[0094] After PCR amplification, 5 μL of the amplification product was spotted onto a 1.2% agar gel. A DL2000 marker was used as the indicator band, and the electrophoresis buffer was 1×TAE. The electrophoresis apparatus was set to 110V and 100A, and electrophoresis was performed for 30 min. Images were taken using a gel imaging system and saved. The experiment was performed three times to ensure the consistency of the results.

[0095] 2. Molecular marker amplification results

[0096] 2.1 Results Electrophoresis Image

[0097] In this experiment, three primer pairs (62F / R, 90F / R, and 247F / R) were used to perform PCR amplification, electrophoresis, and photography on samples *Pleurotus ostreatus* No. 1, No. 2, *Xinghe* No. 2, and WB-19, respectively. The results are as follows: Figure 3 As shown.

[0098] The results showed that when strains *Pleurotus ostreatus* 1, 2, and *Xinghe* 2 were amplified with primer 90, only strain WB-19 produced a band, while *Pleurotus ostreatus* 1, 2, and 2 did not. However, when primers 62 and 247 were used to amplify the four strains separately, all four strains produced bands; primers 62, 90, and 247 could all amplify bands in strain WB-19.

[0099] Example 6 Variety Identification and Testing Experiment 2

[0100] Genomic DNA extraction:

[0101] 1. Take a 2ml centrifuge tube, add 200μL of pretreatment solution and a few glass beads, then add an appropriate amount of the sample of Mushroom No. 1 strain, and grind it in a grinder until fully ground.

[0102] 2. Add 20 μL Proteinase K and 200 μL lysis buffer, mix thoroughly by inverting, and incubate at 70°C for 10 min.

[0103] 3. Add 200 μL of anhydrous ethanol, mix thoroughly by inverting, and centrifuge briefly to remove droplets from the inner wall of the tube cap.

[0104] 4. Pass through an adsorption column, wash once with washing solution, and wash twice with rinsing solution.

[0105] 5. Let the adsorption column stand at room temperature for 3 to 5 minutes to thoroughly dry any residual rinsing solution in the adsorption material.

[0106] 6. Transfer the adsorption to a new centrifuge tube, add 50–100 μL of ddH2O dropwise to the center of the adsorption membrane, incubate at room temperature for 3–5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution in the centrifuge tube. Then perform 16S / 18S amplification. The relevant primers used are shown in Table 7 below, and the PCR amplification reaction system and conditions are shown in Table 8.

[0107] Table 7 Primer Information

[0108]

[0109] Table 8. PCR amplification reaction system and conditions

[0110]

[0111] Agarose gel electrophoresis image as shown Figure 4 Among them, M is the marker band, and bands 1 and 2 are amplified by primers ITS1 and ITS4, respectively, and their sequences are shown in SEQ ID NO:11; the remaining three bands are amplified by primer pairs 27F and 1492R. The sequence shown in SEQ ID NO:11 is as follows:

[0112] .

[0113] A phylogenetic tree was constructed based on the above results, and the results are shown in [the table below]. Figure 5 .

[0114] Example 7 Variety Identification and Testing Experiment 3

[0115] The inventors further extracted differentially expressed sequences based on whole-genome sequencing, and the specific methods and steps are described below:

[0116] 1. First, the cleandata data after quality control filtering of the original data is compared with the reference genome (using software BWA), and then the variant sites are detected (using software SAMTOOLS) to obtain two types of mutation results: snp and indel.

[0117] 2. Using the SNP and Indel mutations obtained from the above detection, the *Pleurotus ostreatus* strain 1 and the reference sample (the whole genome information of the reference sample is:

[0118] The differential loci were screened using https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCA / 013 / 433 / 165 / GCA_013433165.1_ASM1343316v1 / GCA_013433165.1_ASM1343316v1_genomic.fna.gz. Identical loci were filtered out between the two samples, leaving only the loci that differed between them.

[0119] 3. Based on the SNP and INDEL merged files selected for the above differential sites, windowing statistics were performed, with 500 bp as a window. The window with the most differential sites was identified, and the chromosome and location interval of that window were obtained. The window interval with the most differential sites among samples was the 1212001-1212500 interval on chromosome CM024093.1. Using this location interval, base sequence extraction was performed on the reference genome, and then the mutation information of the three samples was used to replace the bases at the mutation positions (using the software bcftools) to obtain the actual base sequence of the Xinghe White Jade Mushroom strain 1 sample in this interval; this sequence serves as the specific sequence of Xinghe White Jade Mushroom mycelium 1, as shown in SEQ ID NO:12:

[0120] CGGTGTCGAGCGAGGGGGAAGAGGGCGCGACGACGCGCGCACCAAAGGCAGCGCGTTGACACAAGTCACACCATGTCACCCGCGGACCGAATGTCCGCGCCGACGATCAGAGCTGCTGATCGTC GTTCGGAACGTCGACGGAGTGTTCCACTCCATCCATGGGTGCATGCGCAAGGGCGAACGGCGCATCCCAACCTGATATGGAGTCGATAGCCTGAACGAACACTACCACCGGACTGGGACGAGTCT TCTGAAGACTCGTACCAATCTTCGAAGCAAACTGTCGAGTTTGCTATTCCGACGGACGTTCCTGATCATGGGAACGTCGAACACCTGGCGTGTTTACGCCTTCACCTTCACCACCCGCCGGATGA CTGGTCAGATGCATCATCAGATGCATCCATGGACGATCGGGAGCAGGGAGAGTGGACGTGTGACACGTACACAATCCCGTGCTCGGAACCGGAGGACTGCGCCTCCATCGTCGATGAACACTGGC.

[0121] Example 8: Preservation Test

[0122] Twenty-four mushrooms of the Xinghe White Jade Mushroom No. 1 strain were harvested on the 23rd day of their growth. In the packaging workshop, the mushrooms were cut at the root, packed into boxes, and weighed using an electronic scale. The boxed weight was controlled to be between 150g and 160g. The boxes were then packaged using a plastic wrapping machine. The packaging workshop temperature was maintained at 14-16℃, and the packaging time was 1 hour. The packaged mushrooms were then placed in foam boxes, sealed with transparent tape, and placed on a cold storage sample rack. The storage temperature was set at 2-4℃. Every week, the bags were opened and the color, freshness, odor, and quality of the mushroom caps and stems were recorded. The results are shown in Table 9.

[0123] Table 9. Preservation status of Xinghe White Jade Mushroom No. 1 at different preservation days.

[0124]

[0125]

[0126] Example 9 Sensory Test

[0127] 200g each of Xinghe White Jade Mushroom No. 1 and WB-19 were harvested, boiled to remove the raw mushroom taste, drained, and stir-fried with chopped green onions and vegetable oil, seasoned with salt, to obtain stir-fried mushrooms. Forty people were asked to conduct a blind taste test (eating without being informed of their intended recipients) to evaluate the color, aroma, umami, bitterness, and crispness of the stir-fried mushrooms. The results are shown in Table 10.

[0128] Table 10 Sensory tests of different strains

[0129]

[0130] As shown in Table 10, compared with the parent strain WB-19, the Xinghe White Jade Mushroom No. 1 strain has a better taste after stir-frying, is delicious and crisp, and has no bitterness.

Claims

1. A type of white jade mushroom ( Hypsizygus marmoreus The strain, with accession number GDMCC No:63404, has a specific sequence as shown in SEQ ID NO:

12.

2. A fruiting body of *Pleurotus ostreatus*, characterized in that, The fruiting body of the white jade mushroom is obtained by cultivating the white jade mushroom strain described in claim 1.

3. The method for cultivating the fruiting bodies of *Pleurotus ostreatus* as described in claim 2, characterized in that, Includes the following steps: The *Pleurotus ostreatus* strain was cultured and cultivated on a culture medium; wherein... The cultivation medium comprises the following raw materials in weight percentages: 20%–30% corn cobs, 15%–25% hardwood sawdust, 15%–25% cottonseed hulls, 15%–25% wheat bran, 15%–20% rice bran, and 3%–8% corn flour; The cultivation temperature is 21℃~26℃; the humidity during cultivation is 65%~75%; the CO2 concentration during cultivation is 2000ppm~3000ppm; the planting temperature is 14℃~18℃; and / or, the planting humidity is 92%~96%; the CO2 concentration during cultivation is 2500ppm~3000ppm; and the light intensity during cultivation is 50 Lux~800 Lux.

4. The application of the *Pleurotus ostreatus* strain as described in claim 1 in the preparation of any one of *Pleurotus ostreatus* spores, *Pleurotus ostreatus* mycelium, and *Pleurotus ostreatus* fruiting bodies.

5. The application of the fruiting body of *Pleurotus ostreatus* as described in claim 2 in food processing.

Images