Use of prmt1 inhibitors in the treatment of acute liver injury
By using Prmt1 inhibitors such as Furamidine dihydrochloride or AMI-1 to inhibit Prmt1 activity and regulate the activities of Slc7a11 and FSP1, the problem of acute liver injury caused by ferroptosis was solved, significantly reducing hepatocellular damage, improving mouse survival rate and liver function, and providing a new treatment method.
Patent Information
- Application Number
- CN202410172213.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-07
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-02-07
AI Technical Summary
There is a lack of effective treatments to combat acute liver injury caused by ferroptosis, especially in cases of severe and complex liver damage, such as liver transplantation, ischemia-reperfusion, viral infection, and liver resection.
Using Prmt1 inhibitors, such as Furamidine dihydrochloride or AMI-1, can reduce the level of lipid peroxidation 4-HNE, increase the content of antioxidant GSH, and regulate the activity of Slc7a11 and FSP1 by inhibiting Prmt1 activity in vitro and in vivo, thereby alleviating hepatocellular damage caused by ferroptosis.
Prmt1 inhibitors can significantly reduce ferroptosis in hepatocytes, alleviate liver tissue damage, improve survival rate in mice, reduce liver function indicators ALT/AST, and reduce oxidative stress in liver tissue, providing a new treatment option for acute liver injury.
Smart Images

Figure CN118001405B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of chemical medicine technology, and specifically relates to the use of Prmt1 inhibitors in the treatment of acute liver injury. BACKGROUND
[0002] Protein arginine methyltransferase 1 (Prmt1) is an important post-translational modification enzyme that plays multiple biological functions in cells. Its main function is to catalyze the asymmetric dimethylation modification of the N-terminal arginine of the substrate, which can usually affect the function and stability of the modified protein. Prmt1 plays an important role in gene expression and transcriptional regulation, signaling pathways, and has a regulatory function on biological processes such as cell differentiation, proliferation, development, and stress response. In addition, Prmt1 is closely related to various diseases such as cancer, immune diseases, metabolic system and nervous system diseases, and its abnormal activity is related to the development of these diseases. Therefore, Prmt1 has become an object of attention in biomedical research, and researchers are actively exploring its biological functions and developing Prmt1 inhibitors to better understand its role in diseases and explore its application in potential drug therapy, which has important significance for promoting disease research and drug development.
[0003] Acute liver injury is a common clinical disease, usually caused by multiple factors, including alcohol abuse, infection (such as hepatitis B, hepatitis C), drug abuse, fatty liver, autoimmune diseases, metabolic disorders, etc. Acute liver injury can cause liver damage, affecting its normal function, and further causing a series of health problems. Acute liver injury has multiple characteristics, including oxidative stress, which is one of the important characteristics. During liver injury, a large amount of free radicals and oxidative stress substances such as hydrogen peroxide, lipid peroxide, superoxide, etc. are released, which can damage the membranes, proteins and nucleic acids of cells, leading to liver cell damage. Acute liver injury is usually accompanied by an inflammatory response, and the liver is an important organ of the immune system. When liver cells are damaged, the immune system releases inflammatory mediators to respond to the problem. Although inflammation is a self-protection mechanism, excessive inflammatory response can lead to further damage. In addition, liver damage is often accompanied by fat accumulation, liver fibrosis, immune cell infiltration, liver cell regeneration, etc. Acute liver injury is a complex process that usually requires a comprehensive treatment method, including reducing oxidative stress, inhibiting inflammation, promoting liver cell regeneration and preventing further damage, to maintain the health and function of the liver. Therefore, it is very important to research and develop new inhibitors and treatment methods to treat acute liver injury, and research in this field can provide more effective treatment options for liver health, reduce the suffering of patients, and improve the quality of life.
[0004] Iron death is a novel form of programmed cell death discovered in 2012, characterized by iron accumulation, cell membrane lipid peroxidation, inflammatory response, and antioxidant system disorder. Oxidative stress plays a crucial role in iron death, which is usually triggered by the accumulation of iron ions in cells, leading to the occurrence of oxidative stress. This reaction produces highly active oxygen free radicals, such as superoxide radicals and hydrogen peroxide, which can cause damage to biological molecules within the cell, including lipids, proteins, and nucleic acids. Overloaded oxidative stress triggers the accumulation of oxygen free radicals in cells, ultimately leading to cell death. Liver injury is often accompanied by the process of iron death, especially in some liver diseases and conditions, such as non-alcoholic fatty liver disease (NAFLD) or alcoholic liver disease. Iron accumulation and oxidative stress in iron death can cause direct damage to liver cells. In addition, the inflammatory response triggered by iron death can further exacerbate inflammation in the liver, leading to damage and necrosis of liver cells. Therefore, understanding the relationship between iron death and liver injury is of great significance for developing new strategies to treat liver diseases, which may include reducing liver damage caused by iron death through the regulation of iron metabolism and antioxidant defense.
[0005] Prmt1 inhibitors have broad potential in the research and treatment of various diseases. They are of great interest in the field of malignant tumors such as leukemia, breast cancer, and prostate cancer, where Prmt1 inhibitors are expected to interfere with the growth and spread of abnormal cells. In addition, they are also of interest in the field of cardiovascular diseases, which may help to regulate the normal function of the cardiovascular system and alleviate symptoms of cardiovascular diseases such as hypertension and heart disease. Although there have been many studies on Prmt1 inhibitors as drugs for the treatment of tumors and cardiovascular diseases, so far there have been no reports on their regulation of iron death in the treatment of acute liver injury caused by ischemia-reperfusion, liver transplantation, viral infection, and liver resection surgery. SUMMARY
[0006] The purpose of the present application is to provide a new use of Prmt1 inhibitors. The Prmt1 inhibitors provided by the present application are used in the treatment of acute liver injury. Specifically, the Prmt1 inhibitors described in the present application can effectively resist iron death in vivo and in vitro; at the same time, the Prmt1 inhibitors can also better alleviate acute liver injury in mice. Therefore, the Prmt1 inhibitors described in the present application have good application prospects in the treatment of acute liver injury caused by various factors such as drug-induced, viral infection, liver resection, liver transplantation, and ischemia-reperfusion.
[0007] The first purpose of the present application is to provide the use of a Prmt1 knockout vector or a Prmt1 inhibitor in the preparation of an agent for resisting cell iron death in vivo and / or in vitro.
[0008] A second object of the present application is to provide the use of the knockout vector of Prmt1 or the inhibitor of Prmt1 in the preparation of a drug for treating diseases mediated by ferroptosis.
[0009] Further, the disease mediated by ferroptosis is acute liver injury.
[0010] Further, the disease mediated by ferroptosis is melanoma.
[0011] In a particular embodiment, the inhibitor of Prmt1 of the present application is Furamidine dihydrochloride or AMI-1,
[0012] The structural formula of Furamidine dihydrochloride is
[0013] The AMI-1
[0014] The present application has the following beneficial effects:
[0015] 1. The present application finds that the Prmt1 inhibitor can better resist ferroptosis in vivo and in vitro; the Prmt1 inhibitor can increase the content of antioxidant GSH, reduce the level of peroxidized lipid 4-HNE, alleviate the ferroptosis of liver cells, and ultimately alleviate the damage degree of liver tissue; the anti-ferroptosis slows down acute liver injury, which may be closely related to the activity of Slc7a11 and FSP1.
[0016] 2. The Prmt1 inhibitor of the present application can treat acute liver injury, which opens up a new use of the Prmt1 inhibitor and provides a new choice for treating diseases related to acute liver injury. Specifically, the Prmt1 inhibitor is applied in the treatment of ischemia-reperfusion drugs, in the treatment of viral infection drugs, and in the treatment of liver resection and liver transplantation drugs. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 A cell viability graph under the treatment of ferroptosis inducer Erastin, wherein, Figure 1 A is a cell viability graph of B16 cells after knocking out Prmt1 under the treatment of Erastin, Figure 1 B is a WB graph of B16 cells after knocking out Prmt1, Figure 1 C is a cell viability graph of Hepa1-6 cells after knocking out Prmt1 under the treatment of Erastin, Figure 1 D is a WB graph of Hepa1-6 cells after knocking out Prmt1;
[0018] Figure 2Cell viability plot under the treatment of ferroptosis inducer Erastin, wherein, Figure 2 A is the cell viability plot under the treatment of Erastin after B16 cells knock out Prmt1 and then complement Prmt1, Figure 2 B is the WB plot of B16 cells knock out Prmt1 and then complement Prmt1, Figure 2 C is the cell viability plot under the treatment of Erastin after Hepa1-6 cells knock out Prmt1 and then complement Prmt1, Figure 2 D is the WB plot of Hepa1-6 cells knock out Prmt1 and then complement Prmt1;
[0019] Figure 3 Cell viability plot under the treatment of ferroptosis inducer Erastin, wherein, Figure 3 A is the cell viability plot under the treatment of Erastin after B16 cells treated with Prmt1 inhibitor Furamidine, Figure 3 B is the cell viability plot under the treatment of Erastin after Hepa1-6 cells treated with Prmt1 inhibitor Furamidine, Figure 3 C is the cell viability plot under the treatment of Erastin after B16 cells treated with Prmt1 inhibitor AMI-1, Figure 3 D is the cell viability plot under the treatment of Erastin after Hepa1-6 cells treated with Prmt1 inhibitor AMI-1;
[0020] Figure 4 mRNA relative expression level plot, wherein, Figure 4 A is the Slc7a11 mRNA expression level plot after B16 cells knock out Prmt1, Figure 4 B is the Slc7a11 mRNA expression level plot after Hepa1-6 cells knock out Prmt1;
[0021] Figure 5 Total GSH relative expression level plot, wherein, Figure 5 A is the total GSH expression level plot after B16 cells knock out Prmt1,
[0022] Figure 5 B is the total GSH expression level plot after Hepa1-6 cells knock out Prmt1;
[0023] Figure 6 WB plot of HEK293T myristoylation modification;
[0024] Figure 7 Total CoQ10 relative expression level plot, wherein, Figure 7 A is the total CoQ10 expression level plot after B16 cells knock out Prmt1, Figure 7B shows the total CoQ10 expression level in Hepa1-6 cells after Prmt1 knockout;
[0025] Figure 8 This is a survival curve for mice, where... Figure 8 A shows the survival curves of mice after Prmt1 knockout and ConA injection. Figure 8 B shows the mRNA expression level of Prmt1 knocked out by AAV virus injected via the tail vein in mice. Figure 8 C represents the survival curves of mice injected with ConA after treatment with the Prmt1 inhibitor Furamidine or the ferroptosis inhibitor Liproxstatin-1. Figure 8 D is the survival curve of mice after administration of the Prmt1 inhibitor AMI-1 followed by ConA injection;
[0026] Figure 9 This is a graph showing biochemical indicators of liver function in mice, where... Figure 9 A shows the ALT expression levels in mice after Prmt1 knockout and ConA injection. Figure 9 B shows the AST expression level in mice after Prmt1 knockout and ConA injection. Figure 9 C shows the ALT expression levels in mice after injection of ConA following administration of the Prmt1 inhibitor Furamidine or the ferroptosis inhibitor Liproxstatin-1. Figure 9 D is a graph showing the AST expression level of ConA in mice after they were injected with either the Prmt1 inhibitor Furamidine or the ferroptosis inhibitor Liproxstatin-1.
[0027] Figure 10 This is a graph showing the relative expression levels of total GSH in mouse liver tissue, where... Figure 10 A shows the total GSH expression level after Prmt1 knockout and ConA injection in mice. Figure 10 B shows the total GSH expression level of ConA in mice after treatment with the Prmt1 inhibitor Furamidine or the ferroptosis inhibitor Liproxstatin-1.
[0028] Figure 11 This is an immunohistochemical staining image of mouse liver tissue with 4-HNE, where... Figure 11 Image A shows the 4-HNE immunohistochemical staining of mice after Prmt1 knockout and ConA injection. Figure 11 B is a statistical graph showing the positive results of 4-HNE immunohistochemical staining in mice after Prmt1 knockout and ConA injection. Figure 11 C shows the 4-HNE immunohistochemical staining image of mice injected with ConA after treatment with the Prmt1 inhibitor Furamidine or the ferroptosis inhibitor Liproxstatin-1. Figure 11D is a statistical chart of 4-HNE immunohistochemical staining positive after injecting ConA in mice using Prmt1 inhibitor Furamidine or ferroptosis inhibitor Liproxstatin-1. DETAILED DESCRIPTION
[0029] The application will be further explained in connection with the following examples, which do not limit the application in any form.
[0030] 8. Experimental conclusion
[0031] This experiment verifies that Prmt1 inhibitors can better resist ferroptosis in vivo and in vitro, and can significantly reduce oxidative stress and alleviate acute liver injury in mice; this therapeutic effect may be achieved by increasing the activity of anti-ferroptosis proteins Slc7a11 and FSP1.
[0032] Example 1 Knocking out Prmt1 or using Prmt1 inhibitors can enhance the resistance of cells to ferroptosis inducers
[0033] Experimental steps:
[0034] (1) Constructing Prmt1 knockout cell lines of B16 and Hepa1-6 in vitro
[0035] First, construct a Prmt1 knockout plasmid, based on the Prmt1 gene sequence with accession number 15469 recorded in genbank, four sequence knockout sequences are designed, among which sequences 2 and 4 have better knockout effect, so two independent sgRNAs are selected, the sgRNA sequences are respectively SEQ ID NO. 1: TGAGCATGGACTCGTAGAAG (the sgRNA treatment group corresponds to sgmPrmt1-2); SEQ ID NO. 2: TGCCCACTTTGGCATCCACG (the sgRNA treatment group corresponds to sgmPrmt1-4); the Prmt1 knockout vector is constructed by Esp3I enzyme cutting site based on lentiCRISPR v2 plasmid. Then use 293T to package Prmt1 knockout virus.
[0036] Select B16 (mouse melanoma cells) and Hepa1-6 (mouse hepatoma cells) as experimental objects, infect B16 and Hepa1-6 cells by virus, and then use puromycin for screening. Take part of the screened cells, detect the knockout effect of Prmt1 by qPCR and Western Blot Figure 1 B, 1D).
[0037] (2) Constructing Prmt1 knockout cell lines to back-supplement Prmt1 cell lines
[0038] The step of re-supplementing Prmt1 in the knockout cell line is as follows: first, the cDNA of Prmt1 is cloned into pBOB-GFP using Xba1 and BamH1 enzyme cutting sites to obtain a viral vector that can overexpress Prmt1, then 10 ug of OE-Prmt1 is co-transfected into HEK293T cells together with 2.5 ug of pMD2.G and 7.5 ug of psPAX2, two viral packaging plasmids, to obtain a virus that can overexpress Prmt1 by collecting the supernatant. The virus is used to infect the Prmt1 stably knocked out B16 or Hepa1-6 cell line, and then Prmt1 protein is re-supplemented. The amount of re-supplemented Prmt1 is detected by WB Figure 2 B、 Figure 2 D)。
[0039] (3) Pre-treatment of cells using two different Prmt1 inhibitors
[0040] Two Prmt1 selective inhibitors were dissolved in DMSO to prepare 10 mM Furamidine or 100 mM AMI-1 stock solutions. B16 or Hepa1-6 cells were pre-treated with Prmt1 inhibitors for 24 h to inhibit Prmt1 activity, and the treatment concentrations were 5, 10 uM Furamidine or 50, 100 uM AMI-1, respectively; then 0, 0.5, 1, 2.5, 5, 10 uM of ferroptosis inducer Erastin was added for 24 h, and cell viability was detected by MTT experiment.
[0041] (4) Cell viability experiment (MTT)
[0042] Cell viability is one of the recognized indicators for evaluating the degree of ferroptosis.
[0043] sgmCTRL (control), sgmPrmt1-2 (knockout Prmt1 of sequence 2), sgmPrmt1-4 (knockout Prmt1 of sequence 4); (2) Prmt1 complementation experiment: sgmPrmt1 (control), sgmPrmt1 (knockout Prmt1), sgmPrmt1 + OE-Prmt1 (knockout and complementation Prmt1); (3) Prmt1 inhibitor experiment: DMSO (control), 5uM Furamidine, 10uM Furamidine; DMSO (control), 50uM AMI-1, 100uM AMI-1 cells, 2.5X10^3 cells were seeded into 96-well plates (3 replicates per group) 48H before the experiment; 24H before the experiment, cells were treated with a dose gradient of ferroptosis inducer Erastin (0-20uM); 4H before the experiment, 10ul of 5mg / ml MTT reagent was added to each well; cells were lysed with 100ul DMSO, and the absorbance of the solution was detected by a microplate reader.
[0044] The results of MTT showed that: compared with the control group of cells, the two cells of knockout Prmt1 showed higher cell viability Figure 1 A, 1C). In addition, the Prmt1 complementation group in the knockout cell line showed that the cell viability would decrease to the same level as the control group after the ferroptosis inducer Erastin treatment Figure 2 A, 2C). Finally, the cells were pretreated with two different Prmt1 inhibitors, and the inhibitor group also better tolerated the ferroptosis induced by Erastin Figure 3 ). These results showed that: knockout or use of Prmt1 inhibitor can make cells better resist ferroptosis.
[0045] Example 2 Knockout Prmt1 can increase the content of antioxidant substances GSH and CoQ10
[0046] Experimental steps:
[0047] (1) mRNA level of anti-ferroptosis gene Slc7a11
[0048] Prepare three groups of sgmCTRL, sgmPrmt1-2, sgmPrmt1-4 cells of B16 or Hepa1-6, add 1 ml RNAiso plus kit (#9109, TaKaRa) to lyse the cells. After mixing evenly by blowing, add 0.2 ml chloroform, shake vigorously for 15 seconds, and centrifuge at 12000 x g for 15 minutes at 4°C. Take the supernatant, add an equal volume of isopropanol, and place it at -20°C for more than 1 hour. Take out the sample, centrifuge at 12000 x g for 15 minutes at 4°C. Discard the supernatant, wash the RNA precipitate with 75% ethanol twice, and centrifuge at 12000 x g for 2 minutes at 4°C. Remove the supernatant, dry the RNA precipitate for 5-10 minutes, and add an appropriate amount of DEPC water to detect the RNA concentration. Use the RNA reverse transcription kit to reverse transcribe the RNA into cDNA, and record the CT values of Prmt1 and Slc7a11 in different cell lines by QuantStudio 3 Real-Time PCR Instrument (A28132, ThermoFisher Scientific).
[0049] (2) Glutathione (GSH) content detection
[0050] Glutathione (GSH) is one of the recognized indicators for evaluating the degree of ferroptosis.
[0051] sgmCTRL (control), sgmPrmt1-2 (Prmt1 knockout sequence 2), and sgmPrmt1-4 (Prmt1 knockout sequence 4) were set for B16 and Hepa1-6 cells, respectively. The Prmt1-knockout B16 and Hepa1-6 cells were treated using the GSH kit of Beyotime Company, and the specific operation process was according to the company's instruction manual. Specifically, glutathione reductase can reduce GSSG to GSH, and GSH can react with the chromogenic substrate DTNB to produce yellow TNB and GSSG. The amount of total glutathione determines the amount of yellow TNB formed, so the amount of total glutathione can be calculated by measuring the absorbance at 412 nm wavelength.
[0052] (3) FSP1 myristoylation modification detection
[0053] Hepa1-6 cells stably expressing Prmt1-Flag protein and FSP1-V5 protein in three forms, namely wild-type FSP1-V5, mutant FSP1-G2A-V5, FSP1-R316K-V5 protein, and HEK293T cells were cultured in 100 mm culture dishes respectively one day before the experiment. 24 hours before the experiment, 40 μM alkyne myristic acid analogues (tetradecyl alkyne myristic acid, YnMyr) were added to the HEK293T cells. The HEK293T cells were dissolved in 1X PBS containing 1% Triton-X and 0.1% SDS and a protease inhibitor cocktail. Subsequently, 100 μg of protein was connected to the azido-TAMRA-biotin capture reagent (AzTB) by copper (I) catalyzed alkyne-azide cycloaddition reaction (CuAAC) or click chemistry method. The myristoylated modified proteins were enriched by Streptavidin C1 magnetic beads, and the effect of Prmt1 on FSP1 myristoylation modification was detected by fluorescence autofluorescence and Western blotting.
[0054] (4) Ubiquinone (CoQ10) content detection
[0055] Ubiquinone (CoQ10) content is one of the recognized indicators for evaluating the degree of ferroptosis.
[0056] The Prmt1 knockout Hepa1-6 cells were plated in 6 cm culture dishes 24 hours before the experiment, and the cell homogenate samples were obtained by lysing the cells. Then, the coated microwells pre-coated with mouse reduced coenzyme Q10 (CoQ10H2) capture antibody were added with samples, standards, and HRP-labeled detection antibodies in turn, incubated and washed thoroughly. The substrate TMB was used for color development, which was converted to blue under the catalysis of peroxidase and to the final yellow under the action of acid. The color depth was positively correlated with the mouse reduced coenzyme Q10 (CoQ10H2) in the sample. The absorbance (OD value) was measured at 450 nm wavelength by a microplate reader, and the sample concentration was calculated.
[0057] The results show that:
[0058] In B16 and Hepa1-6 cells, the knockout of Prmt1 leads to the increase of mRNA level of anti-ferroptosis gene Slc7a11 Figure 4 ).
[0059] GSH is an important antioxidant in the body, and Slc7a11 is a glutamate and cystine antiporter in cells. The increase of Slc7a11 expression is usually accompanied by the increase of GSH content, and the GSH determination results show that the GSH content in B16 and Hepa1-6 cells with Prmt1 knockout is significantly increased Figure 5 ).
[0060] FSP1 to target to the cell membrane, and the myristoylation modification of FSP1 is essential for FSP1 to target to the cell membrane. We found that the membrane localization of FSP1 would be reduced when Prmt1 and FSP1-WT were co-expressed in 293T; while over-expressing R316K mutant of FSP1, the membrane localization of FSP1 mutant would be significantly increased relative to FSP1-WT. Figure 6
[0061] Finally, by detecting the content of intracellular antioxidant CoQ10, we found that knocking out Prmt1 could significantly increase the content of CoQ10. Figure 7 These results show that knocking out Prmt1 can increase the content of antioxidants GSH and CoQ10, and this anti-ferroptosis effect may be closely related to the activity of Slc7a11 and FSP1.
[0062] Example 3 Prmt1 inhibitor can effectively alleviate acute liver injury in mice
[0063] Steps of acute liver injury experiment in mice:
[0064] (1) Establish ConA-induced acute liver injury model
[0065] Concanavalin A (ConA) was injected into the tail vein of 8-10 week old C57BL / 6 male mice to induce acute liver injury (ALI) for in vivo study of Prmt1 inhibitor.
[0066] (2) Survival experiment ConA (24mg / kg)
[0067] Lentivirus (AAV): The experiment was divided into two groups, shCTRL+ConA group and shPrmt1+ConA group, 10 mice in each group; 100ul adenovirus knockout vector control (AAV adenovirus control empty load) shControl or adenovirus knockout Prmt1 vector shPrmt1 was injected into the tail vein respectively, about 2.5x10^11 GC of virus was injected through the tail vein, and Kaplan-Meier curve was used for statistical analysis.
[0068] Inhibitor (Furamidine):
[0069] Experiment A: DMSO control group, ferroptosis inhibitor Liproxstatin-1 treatment group, Prmt1 inhibitor Furamidine treatment group were set up;
[0070] 10 mice per group; intraperitoneal injection of the same concentration of solvent DMSO, Prmt1 inhibitor Furamidine dihydrochloride (1 mg / kg) or ferroptosis inhibitor Liproxstatin-1 (10 mg / kg), statistical analysis using Kaplan-Meier curve.
[0071] Experiment B: DMSO control group, Prmt1 inhibitor AMI-1 treatment group.
[0072] 8 mice per group; intraperitoneal injection of the same concentration of solvent DMSO or AMI-1 (25 mg / kg), statistical analysis using Kaplan-Meier curve.
[0073] (3) Acute liver injury ConA (12 mg / kg)
[0074] 1) 24 h after ConA injection, orbital blood was taken; biochemical indicators of liver tissue damage were measured: AST / ALT;
[0075] 2) 24 h after ConA injection, mice were killed to remove the liver and fix the tissue; 4-HNE immunohistochemical staining was used to detect the degree of oxidative damage in liver tissue;
[0076] 3) 24 h after ConA injection, mice were killed to remove liver tissue; the content of antioxidant substance GSH was measured.
[0077] (4) Statistical analysis
[0078] Statistical analysis was performed using GraphPad Prism 8.0, and t-test was used for comparison between two groups.
[0079] The results showed that compared with the control group, mice receiving tail vein injection of Prmt1 knockdown AAV virus or intraperitoneal injection of Prmt1 inhibitor showed higher survival rate and stronger resistance to death caused by severe acute liver injury Figure 8 ).
[0080] In addition, mice with Prmt1 knockdown or using Prmt1 inhibitor had lower ALT / AST values as indicators of liver function damage during acute liver injury Figure 9 ).
[0081] Finally, mice using Prmt1 inhibitor could significantly reduce the content of lipid peroxidation product 4-HNE in liver tissue and significantly increase the content of antioxidant GSH during acute liver injury Figures 10-11 ).
[0082] These results show that Prmt1 inhibitors can significantly reduce oxidative stress and alleviate acute liver injury in mice, providing a new choice for treating diseases associated with acute liver injury.
[0083] The above merely describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
Claims
1. Use of an inhibitor of Prmtl, which is Furamidine dihydrochloride or AMI-1, for the manufacture of a medicament for the treatment of acute liver injury, The Furamidine dihydrochloride structural formula is The AMI-1
Citation Information
Patent Citations
Methods and compositions to increase human somatic cell nuclear transfer (SCNT) efficiency by removing histone h3-lysine trimethylation, and derivation of human NT-esc
CN109641015A
Application of ferroptosis inhibitor in preparation of medicine for repairing damaged liver
CN116036087A