Use of DNA polymerase theta inhibitors in the preparation of gene editing products

Abstract

The present invention relates to the field of biotechnology, and in particular to the use of DNA polymerase theta inhibitors in the preparation of gene editing products. In the present invention, the expression or partial expression of DNA polymerase theta is inhibited, which can improve the precise connection efficiency of the connection adapter after genomic DNA editing, improve the precise connection ratio of the connection adapter after genomic DNA editing, and reverse the sequence that is prone to fragment deletion when the base at the upstream 4 position of PAM is C or G in the repair result of gene editing mediated by the CRISPR / Cas9 system, thereby converting it into a single base insertion effect, thereby achieving precise editing of the repair of DNA double-strand breaks. The present invention can achieve precise genomic DNA editing, and can better study the precise function of specific DNA sites.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to use of DNA polymerase theta inhibitors in the preparation of gene editing products. Background Art

[0002] In recent years, with the development of biotechnology, more and more scientists have focused on gene editing technology. Gene targeting technology, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9 technology together form a powerful class of tools that redefine the boundaries of biological research. However, due to the complexity of ZFNs and TALEN operations and high off-target rates, CRISPR / Cas9 technology has appeared more in everyone's field of vision with its high efficiency and accuracy, and has been widely used in the research of systemic biomedicine. [1,2] .

[0003] CRISPR is also known as Clustered regularly interspaced short palindromic repeats (CRISPR), and Cas9 protein is a member of the Cas family. CRISPR / Cas9 is an acquired immune defense system of bacteria, used to protect bacteria or archaea from invasion by foreign plasmids or bacteriophages. When foreign genes invade, the CRISPR sequence of the defense system will express RNA that recognizes the invading genome sequence, and then the CRISPR-associated enzyme (Cas) cuts the foreign genome DNA at the sequence recognition site, thereby achieving the purpose of defense. [3-8] In 1987, it was first discovered in the genome of Escherichia coli [9] In 2012, Doudna, Charpentier and others used CRISPR / Cas as a gene editing system for the first time in vitro to achieve double-stranded DNA cleavage. [3] In 2013, Zhang Feng and others successfully used the CRISPR system to achieve gene editing in human cells and mouse cells. [10,11] In previous work, we used the CRISPR / Cas9 system to achieve genetic editing of DNA fragments (deletion, inversion, and duplication) in human cell lines and mice. [12,13], and for the first time determined that the insertion of a single base, which is generally highly predicted in DNA repair, is always inserted at the -4 position upstream of the PAM site, and conforms to the rule of single base duplication. The highly predictable base insertion comes from the previously undiscovered cleavage activity of Cas9. The RuvC domain of Cas9 has different cutting activities from the HNH domain. The RuvC domain can not only cut at the -3 position upstream of the PAM site, but also at the -4 position upstream of the PAM site. The resulting 5′ protruding end produces a repair result of a base duplication at the -4 position upstream of the PAM after being filled. [14,15] In 2019, we further found that in the repair results of gene editing mediated by the CRISPR / Cas9 system, the insertion of two bases can also be predicted, and they are the bases at positions -5 and -4 upstream of PAM. The RuvC domain of Cas9 is different from the HNH domain, and it does have the activity of cutting at a farther position.

[16] Our previous work also used genetic manipulation of DNA fragment editing to study the gene expression regulation and three-dimensional genome structure of protocadherin and globin [17,18] .

[0004] DNA polymerase theta (Polθ) is a DNA repair enzyme widely found in animals and plants. It belongs to the A family of DNA polymerases and consists of a helicase-like domain, a polymerase structure, and a disordered central domain. [19-22] It plays a key role in the alternative end-joining (Alt-EJ) pathway, also known as the microhomology-mediated end joining (MMEJ) pathway, and is often involved in the repair of DNA double-strand breaks (DSBs) as a major member. [23-26] Under normal physiological conditions, Polθ mainly regulates genome stability. However, when malignant tumors occur, Polθ shows abnormally high expression levels and participates in regulating the malignant transformation of tumor cells. [27-29] For example, Pol θ is overexpressed in several human cancers (e.g., breast, ovarian, lung, gastric, and colorectal cancers), whereas in most normal cells it is either expressed at low levels or completely absent.

[30] .

[0005] Previous studies have found that the base 4bp upstream of PAM will affect the results of the gene base, but methods for in-depth research on the precise functions of specific DNA segments and effective methods for precise DNA editing, including deletion, duplication, translocation and insertion, have yet to be discovered.

[0006] The above references are as follows:

[0007] [1] GAJ T, GERSBACH C A, BARBAS C F, 3RD. ZFN, TALEN, and CRISPR / Cas-based methods for genome engineering[J]. Trends Biotechnol, 2013, 31(7): 397-405.

[0008] [2] WEI C, LIU J, YU Z, et al. TALEN or Cas9 - rapid, efficient and specific choices for genome modifications[J]. J Genet Genomics, 2013, 40(6): 281-9.

[0009] [3] JINEK M, CHYLINSKI K, FONFARA I, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity[J]. Science, 2012, 337(6096): 816-21.

[0010] [4] LINO C A, HARPER J C, CARNEY J P, et al. Delivering CRISPR: a review of the challenges and approaches[J]. Drug Deliv, 2018, 25(1): 1234-57.

[0011] [5] MORANGE M. What history tells us XXXVII. CRISPR-Cas: The discovery of an immune system in prokaryotes[J]. J Biosci, 2015, 40(2): 221-3.

[0012] [6] REDMAN M, KING A, WATSON C, et al. What is CRISPR / Cas9?[J]. Arch Dis Child Educ Pract Ed, 2016, 101(4): 213-5.

[0013] [7]CONG L,RAN F A,COX D,et al.Mμltiplex genome engineering usingCRISPR / Cas systems[J].Science,2013,339(6121):819-23.

[0014] [8]MALIP,YANG L,ESVELT K M,et al.RNA-guided human genome engineeringvia Cas9[J].Science,2013,339(6121):823-6.

[0015] [9]ISHINO Y,KRUPOVIC M,FORTERRE P.History of CRISPR-Cas fromEncounter with a Mysterious Repeated Sequence to Genome Editing Technology[J].J Bacteriol,2018,200(7):

[0016]

[10] JOUNG J,KONERMANN S,GOOTENBERG J S,et al.Genome-scale CRISPR-Cas9knockout and transcriptional activation screening[J].Nature Protocols,2017,12(4):828-63.

[0017]

[11] MA Y,ZHANG L,HUANG X.Genome modification by CRISPR / Cas9[J].Febsj,2014,281(23):5186-93.

[0018]

[12] LI J,SHOU J,GUO Y,et al.Efficient inversions and duplications ofmammalian regμlatory DNA elements and gene clusters by CRISPR / Cas9[J].J MolCell Biol,2015,7(4):284-98.

[0019]

[13] LI J H,SHOU J,WU Q.DNA fragment editing of genomes by CRISPR / Cas9[J].Yi Chuan,2015,37(10):992-1002.

[0020]

[14] SHOU J,LI J,LIU Y,et al.Precise and Predictable CRISPRChromosomal Rearrangements Reveal Principles of Cas9-Mediated NucleotideInsertion[J].Mol Cell,2018,71(4):498-509.e4.

[0021]

[15] WU Q,SHOU J.Toward precise CRISPR DNAfragment editing andpredictable 3D genome engineering[J].J Mol Cell Biol,2021,12(11):828-56.

[0022]

[16] SHI X,SHOU J,MEHRYAR M M,et al.Cas9 has no exonuclease activityresμlting in staggered cleavage with overhangs and predictable di-and tri-nucleotide CRISPR insertions without template donor[J].Cell Discov,2019,5(53.

[0023]

[17] GUO Y,XU Q,CANZIO D,et al.CRISPR Inversion of CTCF Sites AltersGenome Topology and Enhancer / Promoter Function[J].Cell,2015,162(4):900-10.

[0024]

[18] HUANG H,WU Q.CRISPR Double Cutting through the LabyrinthineArchitecture of 3D Genomes[J].J Genet Genomics,2016,43(5):273-88.

[0025]

[19] BEAGAN K,MCVEY M.Linking DNA polymerase theta structure andfunction in health and disease[J].Cell Mol Life Sci,2016,73(3):603-15.

[0026]

[20] BEAGAN K,ARMSTRONG R L,WITSELL A,et al.Drosophila DNA polymerasetheta utilizes both helicase-like and polymerase domains duringmicrohomology-mediated end joining and interstrand crosslink repair[J].PLoSGenet,2017,13(5):e1006813.

[0027]

[21] MATEOS-GOMEZ P A,KENT T,DENG S K,et al.The helicase domain of Polθ counteracts RPA to promote alt-NHEJ[J].Nat Struct Mol Biol,2017,24(12):1116-23.

[0028]

[22] NEWMAN J A,COOPER C D O,AITKENHEAD H,et al.Structure of theHelicase Domain of DNA Polymerase Theta Reveals a Possible Role in theMicrohomology-Mediated End-Joining Pathway[J].Structure,2015,23(12):2319-30.

[0029]

[23] WYATT D W,FENG W,CONLIN M P,et al.Essential Roles for Polymeraseθ-Mediated End Joining in the Repair of Chromosome Breaks[J].Mol Cell,2016,63(4):662-73.

[0030]

[24] SFEIR A,SYMINGTON L S.Microhomology-Mediated End Joining:A Back-up Survival Mechanism or Dedicated Pathway?[J].Trends Biochem Sci,2015,40(11):701-14.

[0031]

[25] KENT T,CHANDRAMOΜLY G,MCDEVITT S M,et al.Mechanism ofmicrohomology-mediated end-joining promoted by human DNA polymeraseθ[J].NatStruct Mol Biol,2015,22(3):230-7.

[0032]

[26] WANG M,WU W,WU W,et al.PARP-1 and Ku compete for repair of DNAdouble strand breaks by distinct NHEJ pathways[J].Nucleic Acids Res,2006,34(21):6170-82.

[0033]

[27] KRUCHININ A A,MAKAROVA A V.Mμltifaceted Nature of DNA Polymeraseθ[J].Int J Mol Sci,2023,24(4):

[0034]

[28] WOOD R D,DOUBLIéS.DNA polymeraseθ(POLQ),double-strand breakrepair,and cancer[J].DNA Repair(Amst),2016,44(22-32.

[0035]

[29] MAIORANO D,EL ETRI J,FRANCHET C,et al.Translesion Synthesis orRepair by Specialized DNAPolymerases Limits Excessive Genomic Instabilityupon Replication Stress[J].Int J Mol Sci, 2021,22(8):

[0036]

[30] BLACK SJ,OZDEMIR AY,KASHKINA E,et al.Molecμlar basis ofmicrohomology-mediated end-joining by purified fμll-length Polθ[J].NatCommun,2019,10(1):4423. Summary of the invention

[0037] In view of the shortcomings of the prior art described above, an object of the present invention is to provide a use of a DNA polymerase theta inhibitor in the preparation of a gene editing product, so as to solve the problems in the prior art.

[0038] To achieve the above objectives and other related objectives, the present invention provides the use of DNA polymerase theta inhibitors in the preparation of gene editing products.

[0039] Preferably, the DNA polymerase theta inhibitor comprises one or more of a nucleic acid molecule, a polypeptide, a protein, a small molecule substance or an engineered virus.

[0040] The present invention also provides a composition for gene editing, which comprises the aforementioned DNA polymerase theta inhibitor, Cas9 protein or a nucleic acid fragment encoding the same, and gRNA or a nucleic acid fragment encoding the same.

[0041] The present invention also provides a gene editing method for editing isolated cell genes, wherein the gene editing method comprises: introducing the aforementioned composition into isolated cells to achieve gene editing of the isolated cells.

[0042] As described above, the use of the DNA polymerase theta inhibitor of the present invention in the preparation of gene editing products has the following beneficial effects: the present invention has found through extensive and in-depth research that inhibiting the expression or partial expression of DNA polymerase theta can improve the precise connection efficiency of the connection adapter after genomic DNA editing, improve the precise connection ratio of the connection adapter after genomic DNA editing, and reverse the sequence that is prone to fragment deletion when the base at the -4 position upstream of PAM is C or G in the repair results of gene editing mediated by certain CRISPR / Cas9 systems, thereby converting it into a single base insertion effect, thereby achieving precise editing of the repair of DNA double-strand breaks. The present invention can achieve precise genomic DNA editing, can better study the precise function of specific DNA sites or fragments, and the method involved in the present invention is simpler, easier to operate, and more efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Shown are the results of analyzing the gene editing efficiency and editing position of the sgRNA of the DNA polymerase theta gene alone in the present invention.

[0044] Figure 2 Shown are schematic diagrams of knockout of the DNA polymerase theta gene, the helicase domain of the DNA polymerase theta gene, and the polymerase domain of the DNA polymerase theta gene in the DNA polymerase theta gene mutant cell lines screened and obtained in the present invention.

[0045] Figure 3 Shown is the knockout status of the DNA polymerase theta gene in the two monoclonal cell lines screened in the present invention.

[0046] Figure 4 Shown is the knockout of the helicase domain fragment in the DNA polymerase theta gene in the two monoclonal cell lines screened in the present invention.

[0047] Figure 5 Shown is the knockout status of the polymerase domain fragment in the DNA polymerase theta gene in the two monoclonal cell lines screened in the present invention.

[0048] Figure 6 Shown is the change in the indel frequency repaired after gene editing and cutting in 8 sites in the present invention, comparing normal HEK293T cells and cell lines with DNA polymerase theta gene knockout, and the difference is the subtraction of the deletion frequency and insertion frequency corresponding to normal HEK293T cells and cell lines with DNA polymerase theta gene knockout.

[0049] Figure 7It is shown that compared with normal HEK293T cells, the cell line in which DNA polymerase theta is knocked out in the present invention has a lower deletion frequency and an increased insertion frequency at each site after repair after gene editing cutting.

[0050] Figure 8 Shown is the analysis of the frequency of 1-10 bp insertions at various sites after repair following gene editing in a cell line knocked out for DNA polymerase theta compared to normal HEK293T cells.

[0051] Fig. 9 The frequency analysis of 1-10 bp insertions at various sites after gene editing and repair in cell lines with DNA polymerase theta knockout compared to normal HEK293T cells is shown in a bar graph.

[0052] Fig.10 Shown is the change in indel frequency after repair after gene editing and cutting in 8 sites in the present invention, comparing normal HEK293T cells and cell lines with DNA polymerase theta gene helicase domain fragment knockout. The difference is the subtraction of the deletion frequency and insertion frequency corresponding to normal HEK293T cells and cell lines with DNA polymerase theta gene knockout.

[0053] Fig.11 It is shown that compared with normal HEK293T cells, the cell line in which the helicase domain fragment of the DNA polymerase theta gene was knocked out in the present invention has a lower deletion frequency and an increased insertion frequency at each site after repair after gene editing cutting.

[0054] Fig.12 Shown is the analysis of the frequency of 1-10 bp insertions at various sites after gene editing and repair in the cell line in which the helicase domain fragment of the DNA polymerase theta gene of the present invention was knocked out compared with normal HEK293T cells.

[0055] Fig.13 Shown is the change in indel frequency after repair after gene editing and cutting in 8 sites in the present invention, comparing normal HEK293T cells and cell lines with knockout of the polymerase domain fragment of the DNA polymerase theta gene. The difference is the subtraction of the deletion frequency and insertion frequency corresponding to the normal HEK293T cells and the cell line with knockout of the polymerase domain fragment of the DNA polymerase theta gene.

[0056] Fig.14 It is shown that compared with normal HEK293T cells, the cell line in which the polymerase domain fragment of the DNA polymerase theta gene in the present invention is knocked out has a lower deletion frequency and an increased insertion frequency at each site after repair after gene editing cutting.

[0057] Fig.15 Shown is the analysis of the frequency of 1-10 bp insertions at various sites after gene editing and repair in the cell line in which the polymerase domain fragment of theta gene of the present invention is knocked out compared with normal HEK293T cells. DETAILED DESCRIPTION

[0058] The present invention provides use of a DNA polymerase theta inhibitor in preparing a gene editing product.

[0059] In some specific embodiments, the DNA polymerase theta inhibitor can be a substance that inhibits the activity of DNA polymerase theta, a substance that inhibits the activity of the helicase domain of DNA polymerase theta, or a substance that inhibits the activity of the polymerase domain of DNA polymerase theta.

[0060] In the present invention, the DNA polymerase theta inhibitor may also refer to a molecule that has an inhibitory effect on the DNA polymerase theta gene. The inhibitory effect on a gene includes, but is not limited to, inhibiting the expression or activity of the gene. Taking the DNA polymerase theta gene as an example, the DNA polymerase theta inhibitor refers to a molecule that has an inhibitory effect on the DNA polymerase theta gene, that is, the target gene of the DNA polymerase theta inhibitor is DNA polymerase theta. The inhibitory effect on DNA polymerase theta includes, but is not limited to, inhibiting the expression or activity of DNA polymerase theta.

[0061] Inhibiting gene activity means reducing gene activity and reducing the biological function of the gene. Preferably, the gene activity is reduced by at least 10% compared to before inhibition, such as at least 30%, 50%, 70% or 90%.

[0062] Inhibiting DNA polymerase theta activity means reducing DNA polymerase theta activity. Preferably, compared to before inhibition, DNA polymerase theta activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, more preferably by at least 70%, and most preferably by at least 90% or more.

[0063] Inhibiting gene expression may be inhibiting the transcription or translation of the gene. Specifically, it may mean: preventing the gene from being transcribed, or reducing the transcriptional activity of the gene, or preventing the gene from being translated, or reducing the translation level of the gene.

[0064] Those skilled in the art can use conventional methods to regulate gene expression, such as gene knockout, homologous recombination, interfering RNA, etc.

[0065] The inhibition of gene expression can be verified by detecting the expression level through PCR and Western Blot.

[0066] Preferably, compared to the wild type, gene expression is reduced by at least 10%, more preferably by at least 30%, even more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, and most preferably, the gene is not expressed at all.

[0067] The precise gene editing product must include a DNA polymerase theta inhibitor, and use the DNA polymerase theta inhibitor as the active ingredient for the aforementioned efficacy.

[0068] In the product, the active ingredient that exerts the aforementioned function may be only the gene inhibitor, or may contain other molecules that can exert the aforementioned function.

[0069] That is, the DNA polymerase theta inhibitor is the only active ingredient or one of the active ingredients of the product.

[0070] The product can be a single-component substance or a multi-component substance.

[0071] The product is mainly targeted at mammals. The mammals are preferably rodents, even-toed ungulates, perissodactyls, lagomorphs, primates, etc. The primates are preferably monkeys, apes or humans.

[0072] The DNA polymerase theta inhibitor can be one or more of a nucleic acid molecule, a polypeptide, a protein, a small molecule substance or an engineered virus.

[0073] In some specific embodiments, the DNA polymerase theta inhibitor can be a nucleic acid molecule that knocks out the DNA polymerase theta gene in the cell genome.

[0074] The nucleic acid molecule is selected from any one or more of an antisense oligonucleotide, an RNA aptamer, a ribozyme against a gene or its receptor polypeptide, a nucleic acid construct comprising a nucleic acid fragment encoding a guide RNA (gRNA) and a nucleic acid fragment encoding a Cas9 protein, a double-stranded RNA (dsRNA) or a short hairpin RNA (shRNA). Specifically, the nucleic acid construct comprises a nucleic acid fragment having a nucleotide sequence as shown in any one or more of SEQ ID No. 1-8.

[0075] In some specific embodiments, the DNA polymerase theta inhibitor may be a composition comprising a nucleic acid molecule and a protein. Specifically, the DNA polymerase theta inhibitor may be a composition consisting of a gRNA and a Cas9 protein. Specifically, the gRNA may be transcribed from the aforementioned nucleic acid fragment encoding the guide RNA or chemically synthesized from the aforementioned nucleic acid fragment encoding the guide RNA.

[0076] In some specific embodiments, the gene editing product is a product for precise gene editing at position -4 of the protospacer adjacent motif (PAM) or position 17 of the sgRNA sequence. Wherein, position -4 is represented by: from the 5' end to the 3' end of the nucleic acid fragment as the positive direction, the 5' end of the PAM moves 4 nucleotides in the negative direction to be the -4th position; position 17 is represented by: from the 5' end to the 3' end of the nucleic acid fragment as the positive direction, the 5' end of the sgRNA moves 17 nucleotides in the positive direction to be the 17th position.

[0077] Furthermore, the gene editing product is a nucleotide insertion product with C / G at the -4 position of PAM.

[0078] Furthermore, the nucleotide insertion product is a product in which 1-20 bp base pairs are inserted at the -4th position of PAM. Specifically, the nucleotide insertion product is a product in which 1 bp, 2 bp, 3 bp, 4 bp, 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp or 20 bp base pairs are inserted at the -4th position of PAM. Preferably, the nucleotide insertion product is a product in which 1 bp base pair is inserted at the -4th position of PAM.

[0079] In some embodiments, the PAM may include a nucleotide sequence such as NGG, NAG, NGA, GGT, BGC, RTG, wherein N may be any of A\T\C\G, B may be any of T\C\G, and R may be any of A\G. It may also be NGN, NAG, etc. that can be used by SpCas9 variants.

[0080] In the present invention, the DNA polymerase theta inhibitor can reverse the sequence that is prone to fragment deletion when the base at the -4 position upstream of PAM is C or G in the repair result of gene editing mediated by the CRISPR / Cas9 system, thereby converting it into a single nucleotide insertion effect, thereby achieving precise editing of the repair of DNA double-strand breaks.

[0081] The present invention also provides a composition for gene editing, which comprises the aforementioned DNA polymerase theta inhibitor, Cas9 protein or a nucleic acid fragment encoding the same, and gRNA or a nucleic acid fragment encoding the same.

[0082] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier or medium. The pharmaceutically acceptable carrier or medium may include, for example, sterile water or physiological saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.), adhesives, etc. In addition, it may also contain other low molecular weight polypeptides; proteins such as serum albumin, gelatin or immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; sugar alcohols such as mannitol or sorbitol. When preparing an aqueous solution for injection, such as physiological saline, isotonic solution containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, sodium chloride, appropriate solubilizers such as alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), non-ionic surfactants (Tween 80, HCO-50), etc. can be used in combination. In some embodiments, the composition comprises a buffer for stabilizing nucleic acids.

[0083] The present invention also provides a gene editing method for disease diagnosis or treatment purposes or non-disease diagnosis or treatment purposes, or editing isolated cell genes, wherein the gene editing method is: introducing the aforementioned composition into isolated cells to achieve gene editing of isolated cells. The gene editing method for in vitro or non-disease diagnosis or treatment purposes can be a gene editing method for industrial production purposes or a gene editing method for scientific research purposes.

[0084] In some specific embodiments, the gene editing method is a method for inserting a nucleotide when the -4 position of PAM is C / G. More specifically, the gene editing method is a method for inserting a 1 bp base pair when the -4 position of PAM is C / G.

[0085] In some specific embodiments, the in vitro cell is selected from a prokaryotic cell or a eukaryotic cell, and the eukaryotic cell does not contain a fertilized egg cell. Specifically, the prokaryotic cell can be selected from one or more of Escherichia coli, Salmonella typhimurium, Klebsiella pneumoniae, Bacteroides ovale, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Lactobacillus casei, Bacteroides fragilis, Acinetobacter lwoffii, Fusobacterium nucleatum, Bacteroides johnsii, Bacteroides thaliana, Lactobacillus rhamnosus, Bacteroides massiliense, Parabacteroides feces, Fusobacterium death, Bifidobacterium breve or Listeria; the eukaryotic cell can be selected from one or more of yeast cells, Streptomyces, insect cells of Drosophila S2 or Sf9, CHO cells, COS cells, 293 cells, Bowes melanoma cells, 293T cells, T lymphocytes, B lymphocytes, N2A cells, Hela cells, leukocytes or pluripotent stem cells.

[0086] In some specific embodiments, the introduction method can be selected from one or more of DEAE-dextran-mediated transfection, liposome-mediated transfection, virus or phage infection, lipofection, transfection, conjugation, protoplast fusion, polyethyleneimine-mediated transfection, electroporation, calcium phosphate precipitation, gene gun, calcium phosphate precipitation, microinjection, and nanoparticle-mediated nucleic acid delivery.

[0087] In the present invention, DNA polymerase theta (Polθ), whose 1-894 amino acids are its helicase-like domain, is ATPase-dependent and is conducive to the annealing of microhomology, thereby allowing the polymerase domain of DNA polymerase theta to function and extend the annealing overhang, and whose 1792-2590 amino acids are its polymerase domain, which has the polymerase activity in TMEJ, and can jointly and rapidly recognize and interact with FEN1 and ligase 3, and localize on the damaged DNA sequence to complete the damage repair process.

[0088] In the present invention, the terms "nucleic acid fragment" and "polynucleotide" are used interchangeably, and they refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function known or unknown. Examples of polynucleotides include, but are not limited to, the following: genes or gene fragments (including probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Polynucleotides also include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If there is a modification on the polynucleotide, the modification can be given before or after assembling the polynucleotide. The nucleotide sequence can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by coupling to be labeled with a labeling component. The term refers to both double-stranded and single-stranded polynucleotide molecules. Unless otherwise specified or required, any embodiment of a polynucleotide disclosed herein includes a double-stranded form thereof and any of two complementary single-stranded forms known or predicted to be capable of forming a double-stranded form.

[0089] In the present invention, the terms "peptide", "polypeptide" and "protein" are used interchangeably in the present invention and refer to a polymeric form of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0090] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0091] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0092] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0093] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques are well described in the literature, see Sambrook et al., MOLECΜLAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; these series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATINSTRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECΜLAR BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.

[0094] Example 1 Transfection of sgRNAs targeting the DNA polymerase theta gene can improve the efficiency of precise editing after DNA repair

[0095] 1. Construction of sgRNA plasmids for DNA polymerase theta gene

[0096] sgRNAs targeting different domains of the DNA polymerase theta gene were purchased from Shanghai Novizan Biotechnology Co., Ltd., with forward and reverse deoxy oligonucleotides with 5' overhang ends "ACCG" and "AAAC" that can complement each other.

[0097] (1) Forward and reverse deoxyoligonucleotides:

[0098] POL theta hel sgRNA1F: accgATGAATCTTCTGCGTCGGAG (SEQ ID NO.1)

[0099] POL theta hel sgRNA1R: aaacCTCCGACGCAGAAGATTCAT(SEQ ID NO.2)

[0100] POL theta hel sgRNA2F: accgATTGGCAGTAGGTTTAAGCA (SEQ ID NO.3)

[0101] POL theta hel sgRNA2R:aaacTGCTTAAACCTACTGCCAAT(SEQ ID NO.4)

[0102] POL theta pol sgRNA1F: accgTACTCCCTGGACTTAAATCG (SEQ ID NO.5)

[0103] POL theta pol sgRNA1R: aaacCGATTTAAGTCCAGGGAGTA (SEQ ID NO.6)

[0104] POL theta pol sgRNA2F: accgAGTGAAAATAGGCGCCAGCT (SEQ ID NO.7)

[0105] POL theta pol sgRNA2R: aaacAGCTGGCGCCTATTTTCACT (SEQ ID NO.8)

[0106] (2) Obtaining complementary double-stranded DNA with hanging ends

[0107] 1) Use ddH 2 Dissolve deoxyoligonucleotide to 100 μM and dilute to 20 μM;

[0108] 2) Add forward and reverse deoxy oligonucleotides to the following reaction system:

[0109]

[0110] Reaction conditions: 95℃ water bath for 5min, then open the lid of the water bath to lower the temperature to about 60℃, cover with lid and cool to room temperature.

[0111] (3) Enzyme digestion of pGL3-U6-sgRNA-PGK-Puro vector

[0112] 1) The vector plasmid was digested with BsaI restriction endonuclease, and the reaction system was as follows:

[0113]

[0114] Reaction conditions: 37°C, 1.5 hours;

[0115] 2) Gel recovery and purification of DNA fragments according to the instructions of the gel recovery kit (Axygen).

[0116] (4) Ligation of the digested vector and the double-stranded DNA with hanging ends

[0117] The connection system is as follows:

[0118]

[0119] Reaction conditions: room temperature for 1.5 hours.

[0120] (5) Transformation of ligation products

[0121] The ligation product was transformed with Stbl3 competent cell and cultured overnight at 37°C on LB plates containing ampicillin (Amp, 100 mg / L).

[0122] (6) Picking single clones for sequencing

[0123] 1) Pick a single colony from the ampicillin antibiotic LB plate and culture it in LB (Amp, 100 mg / L) liquid overnight.

[0124] 2) Plasmid extraction: Extract according to the instructions of the plasmid extraction kit (Axygen).

[0125] 3) The extracted plasmid was sent to Shanghai Qingke Biotechnology Co., Ltd. for sequencing.

[0126] (7) Sequencing successful plasmids for intermediate extraction

[0127] 1) The successfully sequenced plasmid was re-transformed with Stbl3 competent medium and cultured overnight on LB plates containing Amp (100 mg / L).

[0128] 2) In the morning, pick a single colony and culture it in 2 ml LB (Amp, 100 mg / L) liquid culture medium for 8 hours, then transfer it to 200 ml LB (Amp, 100 mg / L) liquid culture medium and culture it overnight.

[0129] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).

[0130] 2. Preparation of humanized Cas9 plasmid

[0131] 1) The humanized Cas9 plasmid was purchased from Addgene official website, number #61425.

[0132] 2) Transformation: Delete the sgRNA and puromycin resistance fragments on the plasmid and insert the blasticidin resistance fragment

[0133] 3) Re-transform with Stbl3 competent cells and culture overnight on LB plates (Amp, 100 mg / L).

[0134] 4) In the morning, pick a single colony and culture it in 2 ml LB (Amp, 100 mg / L) liquid medium for 8 hours, then transfer it to 200 ml LB (Amp, 100 mg / L) liquid medium and culture it overnight for plasmid extraction.

[0135] 3. Use lentiviral transduction to construct a stable Cas9-HEK293T cell line

[0136] (1) Virus production and packaging

[0137] 1) Resuscitate a healthy and viable 293T cell line and replace the culture medium with growth medium before transfection.

[0138] 2) Prepare growth medium:

[0139] 50ml complete DMEM (45ml DMEM, 5ml FBS, 50μl PS)

[0140] 500 μl 1000× GlutaMAX solution

[0141] 1 ml 1M HEPES solution

[0142] 3) Use the lentiviral 3 plasmid system to transfect cells (cells can be transfected when they grow to more than 80%)

[0143] The prepared PxpAx2 plasmid: PMD2g plasmid: humanized Cas9 plasmid was transfected with cells by Lipofectamine 3000 at a ratio of 2:3:4, and added to the cell culture medium. The medium was changed the next day, and each sample was repeated twice. 40 hours after transfection, the first virus was collected into a 50ml centrifuge tube, and 30% of the culture medium was replaced to continue culturing. 12 hours later, the second virus was collected into the same 50ml centrifuge tube, and 30% of the culture medium was replaced to continue culturing. 12 hours later, the third virus was collected into the same 50ml centrifuge tube, and the 10dm dish was discarded and sterilized. All the collected virus liquids were combined and centrifuged at 1000g for 10 minutes, and filtered into a new 50ml centrifuge tube with a 0.45nm filter membrane.

[0144] 4) Virus Concentration

[0145] Concentrate the collected virus solution: centrifuge at 25,000 g for 2 h at 4°C, remove the supernatant after centrifugation, and dissolve it in 150 μl of dPBS overnight. The next day, aliquot and freeze directly in liquid nitrogen and store in a -80°C refrigerator.

[0146] (2) Virus infection and monoclonal screening

[0147] 1) Resuscitate a healthy and viable 293T cell, and infect it after the cells grow to 90%. Convert to MOI based on the calculated titer. The calculation formula is as follows: MOI = (PFU / ml value) × (volume of virus solution in milliliters) / number of transfected cells. Use MOI = 5 for cell infection, and centrifuge at 1000g for 90 minutes at 33°C after infection. After 24 hours, switch to fresh normal culture medium and continue culturing. On the third day, use blasticidin with a final concentration of 1.5μg / ml for resistance screening culture, and continue to sterilize for 7-10 days until all the control wild-type cells float up and die, then switch to fresh biological culture medium without blasticidin and culture for 2-4 days for monoclonal 96-well plate plating.

[0148] 2) PCR assay: Use the primers at the N-terminus of SpCas9 to perform PCR and screen the successfully infected monoclonal cells

[0149] 3) Western Blot: The dozens of selected SpyCas9 infected monoclonal cells were expanded and the proteins were extracted. After the cells were expanded and cultured on a six-well plate, when the cells on the six-well plate grew to more than 95%, the cells were rinsed twice with PBS, the cell suspension was collected, and the supernatant was taken by centrifugation. 1mM RIPA strong lysis buffer was added to the precipitate and blown. After being placed on ice for 15 minutes, it was centrifuged at 12000g at 4°C for 10 minutes, and the upper viscous liquid was taken for BCA determination.

[0150] After measuring the protein concentration using the Bio-Tech BCA kit, the proteins were separated by SDS-PAGE and the separated protein molecules were transferred to a nitrocellulose membrane. The transferred membrane was blocked with 5% skim milk. After blocking, both sides were rinsed with PBST and then incubated with mouse Cas9 antibodies. After overnight incubation, it was washed twice and incubated with secondary antibodies for one hour before scanning with the Odyssey system (LI-COR Bioscience) to detect the protein content.

[0151] 4. Construction of a Cas9-HEK293T cell line with stable DNA polymerase theta knockout

[0152] Transfect two pairs of sgRNA plasmids of DNA polymerase theta into HEK293T-Cas9 expressing cell line

[0153] 1) Cell transfection

[0154] HEK293T cells were inoculated in a six-well plate. When the cells grew to 80%, a pair of pGL3-U6-sgRNA vector plasmids targeting different sites of the genome were transfected into the cells using lipo3000 transfection reagent. The medium was changed 24 hours after transfection, and the cells were passaged. After 48 hours, puromycin with a final concentration of 2μg / ml was used for resistance screening and culture. The drug was killed continuously for 2-4 days until all the control wild-type cells floated up and died. Then, fresh biological culture medium without puromycin was used for 2-4 days for monoclonal 96-well plate plating.

[0155] 2) Monoclonal cell homozygous screening

[0156] After growing for 7 days in a 96-well plate, the cells can be observed under a microscope. Each well is observed one by one, and the wells with single cell clusters are marked. After 14 days of growth, 100 μl of cell suspension is taken from each well for PCR determination. Three pairs of detection primers are designed for each cell line. Primers are designed from the upstream and downstream of the donor plasmid and the sequence that should be deleted inside the donor. The target band has a band and the band is correct. The upstream and downstream primers of the donor internal sequence have no bands. Three-segment verification is performed to select homozygotes for subsequent experiments.

[0157] 5. Construction of sgRNA library virus library

[0158] 1) Construction of oligonucleotide library

[0159] We designed and synthesized a 168nt sgRNA library, totaling 37,688 sgRNAs, and sent the designed library sequence to Custom Array for chip synthesis using electrochemical methods. We used PCR and MA133-Endura-Competent-Cells for electrotransformation and collected the generated sgRNA library plasmids, and ensured that the coverage was at least 25×.

[0160] The sgRNA library sequence structure is as follows:

[0161] tcttgtggaaaggacgaaacacc GNNNNNNNNNNNNNNNNNNN GTTTA GAGACG NNNNNNNNNNNNNNNNNNNN CGTCTC TTTTG NNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTC NNNNNNNNNNNNN aattcgctagctaggtcttgaaag

[0162] 2) Determine the amplification cycle number of the oligonucleotide library using qPCR

[0163]

[0164] Reaction conditions: 67°C ligation, 1 minute extension time. The number of cycles is half of the number of cycles required to reach the signal amplification plateau in QPCR in step 1, and 1 cycle is reduced to scale the DNA input amount. Finally, 20 cycles are selected for the experiment.

[0165] 3) Oligonucleotide library amplification

[0166]

[0167]

[0168] Annealing temperature was 64°C, and the number of cycles was 20.

[0169]

[0170] 4) Purify using Roche PCR purification kit

[0171] 5) Enzyme digestion using the #52961cas9 plasmid vector purchased from Addgene official website

[0172]

[0173] Reaction conditions: 55°C, 2.5 hours.

[0174] 6) Homologous recombination of the oligonucleotide library with the enzyme-cut plasmid vector

[0175]

[0176] Reaction conditions: 50°C, 2.5 hours.

[0177] 7) Use PCR magnetic beads to purify the homologous recombination products.

[0178] 8) Use Endura TM Electroporate competent cells to perform large-scale electroporate of the collected sgRNA oligonucleotide library.

[0179] Prepare two clean electroporation cups, irradiate them under UV light for 30 minutes, then cover them with lids and place them on ice.

[0180] 1. Take out a purchased electroporation competent cell insert from the -80℃ refrigerator and place it on ice, 100μl per insert.

[0181] 2. Place the purified recombinant product into competent cells, open the electroporator in advance, click bacteria, and select the library program that has been set up.

[0182] 3. Transfer all the culture medium in the electroporation cup to a new shaking tube and shake at 37°C for 1 hour.

[0183] 4. Spread the bacterial solution on a large LB plate containing Amp (100 mg / L) and culture overnight at 32°C for 13 hours.

[0184] 5. Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).

[0185] 6. Large plasmid library extracted by enzyme digestion

[0186]

[0187] Reaction conditions: 37°C, 9 hours.

[0188] 7. Dephosphorylation of the 5' and 3' ends of the plasmid library after catalytic digestion

[0189]

[0190] Reaction conditions: 37°C, 30 minutes, recovered with 0.7% gel excision gel.

[0191] 8. sgRNA scaffold amplification

[0192]

[0193]

[0194] Use 2.5% glue cutting glue recovery.

[0195] 9. Enzyme digestion of scaffold amplified PCR products

[0196]

[0197] Reaction conditions: 55°C, 2 hours and 20 minutes. Purification was performed using Qiagen PCR purification kit.

[0198] 10. Linearization by restriction enzyme digestion.

[0199]

[0200] Reaction conditions: 16°C, 15 hours.

[0201] 11. Use EnduraTM electroporation competent cells to perform large-scale electroporation of the collected sgRNA oligonucleotide library. The specific steps are the same as above.

[0202] 12. Packaging of sgRNA oligonucleotide library - production and concentration of lentivirus

[0203] 1) Resuscitate a healthy and viable 293T cell line and replace the culture medium with growth medium before transfection.

[0204] 2) Prepare growth medium:

[0205] 50ml complete DMEM (45ml DMEM, 5ml FBS, 50μl PS)

[0206] 500 μl 1000× GlutaMAX solution

[0207] 1 ml 1M HEPES solution

[0208] 3) Use the lentiviral 3 plasmid system to transfect cells (cells can be transfected when they grow to more than 80%)

[0209] The prepared PxpAx2 plasmid: PMD2g plasmid: sgRNA oligonucleotide library plasmid was transfected into cells by PEI transfection method at a ratio of 2:3:4, and added to the cell culture medium. The medium was changed the next day, and each sample was repeated twice. 40h after transfection, the first virus was collected into a 50ml centrifuge tube, and 30% of the culture medium was replaced to continue culturing. After 12h, the second virus was collected into the same 50ml centrifuge tube, and 30% of the culture medium was replaced to continue culturing. After 12h, the third virus was collected into the same 50ml centrifuge tube, and the 10dm dish was discarded and sterilized. All the collected virus liquids were combined and centrifuged at 1000g for 10 minutes, and filtered into a new 50ml centrifuge tube with a 0.45nm filter membrane.

[0210] 4) Virus Concentration

[0211] Concentrate the collected virus solution: centrifuge at 25,000 g for 2 h at 4°C, remove the supernatant after centrifugation, and dissolve it in 150 μl of dPBS overnight. The next day, aliquot and freeze directly in liquid nitrogen and store in a -80°C refrigerator.

[0212] 5) Testing the viral packaging titer of the sgRNA oligonucleotide viral library

[0213] Since each cell line has different acceptance of the virus library, each cell line must be tested for virus titer. The tested cells are cultured in a 6-well plate. Each virus needs to be repeated 2 times, and two wells are required for counting before infection. The experiment is performed when the cells grow to more than 80%. Titer calculation (IFU / ml) = (number of live cells * starting cell number) / (number of control cells * ml virus volume).

[0214] 6) Viral infection

[0215] Use the previously screened WT-cas9 HEK293T cells and the DNA polymerase theta knockout HEK293T cells to recover, spread the cells evenly on 5 six-well plates, and infect after the cells grow to 90%. Convert to MOI based on the calculated titer. The calculation formula is as follows: MOI = (PFU / ml value) × (volume of milliliters of virus liquid) / number of transfected cells. The sgRNA library used in the study is large in number and high in complexity. To facilitate downstream analysis, it is necessary to ensure that at most one virus particle enters a cell. Therefore, a low MOI (mμltiplicity of infection) value is used to infect the cell line stably expressing Cas9. Use MOI = 0.8 for cell infection, and after infection, centrifuge at 33°C and 1000g for 90 minutes. After 24 hours, replace with fresh normal culture medium and continue culturing. On the third day, cells were passaged. On the fourth day, puromycin with a final concentration of 2 μg / ml was used for resistance screening and culture. Drug killing was continued for 2 days. The first cell collection was carried out on the seventh day. Subsequently, puromycin with a final concentration of 2 μg / ml was used for resistance screening and culture. Cells were collected on the 11th, 18th, and 25th days, respectively. To ensure that the coverage of the sgRNA library was above 1000×, 1.3×10 6 Each batch was repeated 3 times, centrifuged at 12000g for 20 seconds, and then frozen in a -20℃ refrigerator.

[0216] 8. Cell genomic DNA extraction, PCR amplification, and high-throughput sequencing

[0217] Wizard genomic DNA purification kit (Promega) was used to extract and purify genomic DNA, and two-step PCR amplification was performed using genomic DNA as a template. The amplified fragments were recovered by gel electrophoresis and gel recovery, and the concentration was determined using Qbit. Different samples were mixed in equal molar numbers to make a PCR product library and then sent to the company for high-throughput sequencing.

[0218] The first forward primer (SEQ ID NO.14-SEQ ID NO.32) was designed about 150 bp upstream of the sgRNA of the sgRNA oligonucleotide library plasmid, and the first rear primer (SEQ ID NO.9-SEQ ID NO.13) was designed about 15 bp downstream of the target sequence of the sgRNA oligonucleotide library plasmid for PCR amplification. Then, the 5' end of the primer was added with an Illumina sequencing adapter with a barcode to design the second primer, and the downstream second primer was also added with an Illumina sequencing adapter. After the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., PCR amplification was performed, and then the Qiagen gel recovery kit was used for gel excision and recovery. The DNA product was dissolved in 10mM Tris-HCL buffer (PH=8.5), and the library was formed after equal mixing, and PE150 second-generation high-throughput sequencing was performed.

[0219] High-throughput primers targeting the above sgRNA library sites:

[0220] Illumina-hou-F1 (SEQ ID NO.9)

[0221] AATGATACGGCGACCACCGAGATCTACACACGGCAGTCACACTCTTTCCCTACACGAGCTCTTC

[0222] Illumina-hou-F2 (SEQ ID NO.10)

[0223] AATGATACGGCGACCACCGAGATCTACACAGTCGACTACACTCTTTCCCTACACGAGCTCTTC

[0224] Illumina-hou-F3 (SEQ ID NO.11)

[0225] AATGATACGGCGACCACCGAGATCTACACATGACTGCACACTCTTTCCCTACACGAGCTCTTC

[0226] Illumina-hou-R1 (SEQ ID NO.12)

[0227] CAAGCAGAAGACGGCATACGAGATACCTACGTGTGACTGGAGTTCAGACGTGT

[0228] Illumina-hou-R2 (SEQ ID NO.13)

[0229] CAAGCAGAAGACGGCATACGAGATAATCGACTGTGACTGGAGTTCAGACGTGT

[0230] Illumina-b9-xian-F(SEQ ID NO.14)

[0231] TTTCCCTACACGACGCTCTTCCGATCTTAAGTAGAGTCTTGTGGAAAGGACGAAACACC

[0232] Illumina-b10-xian-F(SEQ ID NO.15)

[0233] TTTCCCTACACGACGCTCTTCCGATCTATCATGCTTATCTTGTGGAAAGGACGAAACACC

[0234] Illumina-b11-xian-F(SEQ ID NO.16)

[0235] TTTCCCTACACGACGCTCTTCCGATCTGATGCACATCTTCTTGTGGAAAGGACGAAACACC

[0236] Illumina-b12-xian-F(SEQ ID NO.17)

[0237] TTTCCCTACACGACGCTCTTCCGATCTCGATTGCTCGACTCTTGTGGAAAGGACGAAACACC

[0238] Illumina-b13-xian-F(SEQ ID NO.18)

[0239] TTTCCCTACACGACGCTCTTCCGATCTTCGATAGCAATTCTCTTGTGGAAAGGACGAAACACC

[0240] Illumina-b14-xian-F(SEQ ID NO.19)

[0241] TTTCCCTACACGACGCTCTTCCGATCTATCGATAGTTGCTTTCTTGTGGAAAGGACGAAACACC

[0242] Illumina-b15-xian-F(SEQ ID NO.20)

[0243] TTTCCCTACACGACGCTCTTCCGATCTGATCGATCCAGTTAGTCTTGTGGAAAGGACGAAACACC

[0244] Illumina-b16-xian-F(SEQ ID NO.21)

[0245] TTTCCCTACACGACGCTCTTCCGATCTCGATCGATTTGAGCCTTCTTGTGGAAAGGACGAAACACC

[0246] Illumina-b17-xian-F(SEQ ID NO.22)

[0247] TTTCCCTACACGACGCTCTTCCGATCTACGATCGATACACGATCTCTTGTGGAAAGGACGAAACACC

[0248] Illumina-b18-xian-F(SEQ ID NO.23)

[0249] TTTCCCTACACGACGCTCTTCCGATCTTACGATCGATGGTCCAGATCTTGTGGAAAGGACGAAACACC

[0250] Illumina-b9-xian-R(SEQ ID NO.24)

[0251] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCGAACGTGCTTTCAAGACCTAGCTAGCGAATT

[0252] Illumina-b10-xian-R(SEQ ID NO.25)

[0253] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAACGTCACCTTTCAAGACCTAGCTAGCGAATT

[0254] Illumina-b11-xian-R(SEQ ID NO.26)

[0255] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGTGTCACCTACTTTCAAGACCTAGCTAGCGAATT

[0256] Illumina-b12-xian-R(SEQ ID NO.27)

[0257] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGTACGCTTGACCTTTCAAGACCTAGCTAGCGAATT

[0258] Illumina-b13-xian-R(SEQ ID NO.28)

[0259] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGTCTATGCTAGCTTTCAAGACCTAGCTAGCGAATT

[0260] Illumina-b14-xian-R(SEQ ID NO.29)

[0261] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTAGTAGCGTACGTCTTTCAAGACCTAGCTAGCGAATT

[0262] Illumina-b15-xian-R(SEQ ID NO.30)

[0263] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCTAGTAACGTCTGACTTTCAAGACCTAGCTAGCGAATT

[0264] Illumina-b16-xian-R(SEQ ID NO.31)

[0265] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCTAGTTCATGTGACCTTTCAAGACCTAGCTAGCGAATT

[0266] Illumina-b17-xian-R(SEQ ID NO.32)

[0267] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGCTAGTGCCAGACTACTTTCAAGACCTAGCTAGCGAATT

[0268] Illumina-b18-xian-R(SEQ ID NO.33)

[0269] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTAGCTAGTCTAGAGGTTCTTTCAAGACCTAGCTAGCGAATT

[0270] 8) High-throughput sequencing data processing

[0271] After high-throughput sequencing is completed, the sequencing results of the samples are separated from the library by barcode using a Linux program, saved in their respective folders, and then aligned using Bowtie2. The aligned sequences are analyzed using the analysis code within the research group to analyze the results of gene editing.

[0272] The above results, such as Figure 6-Figure 9 As shown in the figure, compared with the control group, sgRNAs for knocking out the DNA polymerase theta gene, sgRNAs for 8 sites, and humanized SpCas9 plasmids were co-transfected into human embryonic kidney HEK293T cells, which interfered with the expression of the DNA polymerase theta gene. The deletion events of gene editing at each site were greatly reduced, and the insertion events of gene editing were greatly increased. The insertion frequencies at each site were increased by 47.35%, 76.92%, and 65.2% respectively compared with the original insertion frequencies. 4%, 30.82%, 99.86%, 41.94%, 29.91% and 67.38%, the deletion frequency at each site was reduced by 66.07%, 77.92%, 67.23%, 38.99%, 72.13%, 45.11%, 58.5% and 67.44% respectively compared with the original deletion frequency, and the precise connection frequency was greatly improved, especially for the sequences that are prone to base deletion due to the influence of the bases 4bp upstream of PAM, the repair results were changed to produce precise insertion.

[0273] Depend on Figure 8-Figure 9It can be seen that compared with the control group, most of the extremely low or non-insertion sites of sgRNAs that knocked out the DNA polymerase theta gene underwent extremely high frequency insertion, and most of them were 1bp base pair insertions. The insertion rate of 1bp base pairs at each site increased by 76.95%, 67.08%, 65.20%, 30.08%, 42.05%, 47.54%, 30.95%, and 99.86%, respectively, which makes it possible to achieve precise insertion of 1bp in the treatment of certain diseases.

[0274] In summary, DNA polymerase theta is an important repair protein for repairing DNA break ends in the MMEJ (microhomology-mediated end joining) system. Cells transfected with sgRNAs targeting the DNA polymerase theta gene interfere with the expression of the DNA polymerase theta gene, thereby inhibiting the function of this protein, which has an important impact on the repair of DNA breaks.

[0275] Example 2 Transfection of sgRNAs targeting the helicase domain of the DNA polymerase theta gene can improve the efficiency of precise editing after DNA repair

[0276] 1. Construction of sgRNA plasmids for the helicase domain of the DNA polymerase theta gene

[0277] sgRNAs targeting different domains of the DNA polymerase theta gene were purchased from Shanghai Novizan Biotechnology Co., Ltd., with forward and reverse deoxy oligonucleotides with 5' overhang ends "ACCG" and "AAAC" that can complement each other.

[0278] (1) Forward and reverse deoxyoligonucleotides:

[0279] POL theta hel sgRNA1F: accgATGAATCTTCTGCGTCGGAG (SEQ ID NO.1)

[0280] POL theta hel sgRNA1R: aaacCTCCGACGCAGAAGATTCAT(SEQ ID NO.2)

[0281] POL theta hel sgRNA2F: accgATTGGCAGTAGGTTTAAGCA (SEQ ID NO.3)

[0282] POL theta hel sgRNA2R: aaacTGCTTAAACCTACTGCCAAT(SEQ ID NO.4)

[0283] 2. Construction of donor plasmid of DNA polymerase theta gene helicase domain

[0284] Primers targeting 1000 bp upstream and downstream of the helicase domain of the DNA polymerase theta gene were purchased from Shanghai Novizan Biotechnology Co., Ltd., and HEK293T cells were lysed and used as templates for PCR.

[0285] (1) Forward and reverse deoxyoligonucleotides:

[0286] POL theta hel 1-F:AAAACGACGGCCAGTGAATTCGATTACAGGCGTGAGCCACCA

[0287] POL theta hel 1-R:GTAACAGGGCACATGGCATGGCAAACTCTTCTCGGCC

[0288] POL theta hel 2-F: GAAGAGTTTGCCATGCCATGTGCCCTGTTACATTCTAGTACA

[0289] POL theta hel 2-R: GACCATGATTACGCCAAGCTTCATGCTGGCCTTCTGATTTGCT

[0290] (2) Obtaining the template sequence PCR fragment of the upstream and downstream connection of the helicase domain of the DNA polymerase theta gene

[0291] (3) Enzyme digestion of pUC19 plasmid vector

[0292] 1) Use EcoRI and HindIII restriction endonucleases to digest the vector plasmid. The reaction system is as follows:

[0293]

[0294] Reaction conditions: 37°C, 3 hours;

[0295] The DNA fragments were purified by gel extraction according to the instructions of the gel extraction kit (Qiagen).

[0296] (4) Homologous recombination enzyme digestion of the vector and the double-stranded DNA with hanging ends

[0297] The connection system is as follows:

[0298]

[0299]

[0300] Reaction conditions: 37°C, 30 minutes.

[0301] (5) Transformation of ligation products

[0302] The ligation product was transformed with Stbl3 competent cell and cultured overnight at 37°C on LB plates containing ampicillin (Amp, 100 mg / L).

[0303] (6) Picking single clones for sequencing

[0304] 1) Pick a single colony from the ampicillin antibiotic LB plate and culture it in LB (Amp, 100 mg / L) liquid overnight.

[0305] 2) Plasmid extraction: Extract according to the instructions of the plasmid extraction kit (Axygen).

[0306] 3) The extracted plasmid was sent to Shanghai Qingke Biotechnology Co., Ltd. for sequencing.

[0307] (7) Sequencing successful plasmids for intermediate extraction

[0308] 1) The successfully sequenced plasmid was re-transformed with Stbl3 competent medium and cultured overnight on LB plates containing Amp (100 mg / L).

[0309] 2) In the morning, pick a single colony and culture it in 2 ml LB (Amp, 100 mg / L) liquid culture medium for 8 hours, then transfer it to 200 ml LB (Amp, 100 mg / L) liquid culture medium and culture it overnight.

[0310] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).

[0311] 4. Construction of a Cas9-HEK293T cell line with a stable knockout of theta helicase domain of DNA polymerase

[0312] Transfect the corresponding donor plasmid and sgRNA plasmid into HEK293T-Cas9 expression cell line

[0313] 1) Cell transfection

[0314] HEK293T cells were inoculated in a six-well plate. When the cells grew to 80%, a pair of pGL3-U6-sgRNA vector plasmids targeting different sites of the genome were transfected into the cells using lipo3000 transfection reagent. The medium was changed 24 hours after transfection, and the cells were passaged. After 48 hours, puromycin with a final concentration of 2μg / ml was used for resistance screening and culture. The drug was killed continuously for 2-4 days until all the control wild-type cells floated up and died. Then, fresh biological culture medium without puromycin was used for 2-4 days for monoclonal 96-well plate plating.

[0315] 2) Monoclonal cell homozygous screening

[0316] After growing for 7 days in a 96-well plate, the cells can be observed under a microscope. Each well is observed one by one, and the wells with single cell clusters are marked. After 14 days of growth, 100 μl of cell suspension is taken from each well for PCR determination. Three pairs of detection primers are designed for each cell line. Primers are designed from the upstream and downstream of the donor plasmid and the sequence that should be deleted inside the donor. The target band has a band and the band is correct. The upstream and downstream primers of the donor internal sequence have no bands. Three-segment verification is performed to select homozygotes for subsequent experiments.

[0317] 5. Construction of sgRNA library virus library

[0318] The method is the same as in Example 1.

[0319] 6. Packaging of sgRNA oligonucleotide library - production and concentration of lentivirus

[0320] The method is the same as in Example 1.

[0321] 7. sgRNA library virus library infection DNA polymerase theta helicase domain fragment knockout Cas9-HEK293T cell line

[0322] The method is the same as in Example 1.

[0323] 8. Cell genomic DNA extraction, PCR amplification, and high-throughput sequencing

[0324] The method is the same as in Example 1.

[0325] Studies have shown that if Figure 10-11As shown in the figure, compared with the control group, sgRNAs that knocked out the helicase domain of the DNA polymerase theta gene were co-transfected with human embryonic kidney HEK293T cells together with sgRNAs targeting 8 sites and humanized SpCas9 plasmids, which interfered with the partial expression of the DNA polymerase theta gene, especially making its helicase domain unable to play its corresponding role. The deletion events of gene editing at each site were reduced, and the insertion events of gene editing were increased. The insertion frequency at each site increased by 40%, 90%, and 100%, respectively, compared with the original insertion frequency. 1.01%, 75%, 66.67%, 66.67%, 55.56%, 42.86%, 85.71%, the deletion frequency at each site was reduced by 50.39%, 99.71%, 65.49%, 53.89%, 99.93%, 99.78%, 15.41%, 42.93% respectively compared with the original deletion frequency, and the precise connection frequency was greatly improved, especially for the sequences that are prone to base deletion due to the influence of the 4bp upstream of PAM, especially G and C, the repair results were changed to produce precise insertion. Fig.12 As shown, compared with the control group, most of the extremely low or non-insertion sites of sgRNAs for knocking out the DNA polymerase theta gene underwent extremely high frequency insertion, and most of them were 1bp base pair insertions. Except for the RPP38 site and CLDN25 site, where the insertions of 2bp bases increased by 82.35% and 33.33% respectively, the rest were 1bp base pair insertions, which increased by 99%, 99.19%, 99.86%, 39.91%, 39.70% and 30.36% respectively.

[0326] In summary, DNA polymerase theta is an important repair protein for repairing DNA break ends in the MMEJ (microhomology-mediated end joining) system. Cells transfected with sgRNAs targeting the DNA polymerase theta gene interfere with the expression of the DNA polymerase theta gene. Its helicase domain has ATP-dependent single-strand annealing activity, which may promote the annealing of microhomology. After the end resection initiated by the MRE nuclease, it can leave a single-stranded protruding end, displace replication protein A (RPA) from the DNA end and promote microhomology annealing. The inhibition of this part affects the function of DNA polymerase theta protein for unwinding, thereby affecting the repair of DNA after breakage.

[0327] Example 3 Transfection of sgRNAs targeting the polymerase domain of the DNA polymerase theta gene can improve the efficiency of precise editing after DNA repair

[0328] 3. Construction of sgRNA plasmids for the polymerase domain of the DNA polymerase theta gene

[0329] sgRNAs targeting different domains of the DNA polymerase theta gene were purchased from Shanghai Novizan Biotechnology Co., Ltd., with forward and reverse deoxy oligonucleotides with 5' overhang ends "ACCG" and "AAAC" that can complement each other.

[0330] (1) Forward and reverse deoxyoligonucleotides:

[0331] POL theta pol sgRNA1F: accgTACTCCCTGGACTTAAATCG (SEQ ID NO.5)

[0332] POL theta pol sgRNA1R: aaacCGATTTAAGTCCAGGGAGTA (SEQ ID NO.6)

[0333] POL theta pol sgRNA2F: accgAGTGAAAATAGGCGCCAGCT (SEQ ID NO.7)

[0334] POL theta pol sgRNA2R: aaacAGCTGGCGCCTATTTTCACT (SEQ ID NO.8)

[0335] 4. Construction of donor plasmid of DNA polymerase theta gene polymerase domain

[0336] Primers targeting 1000 bp upstream and downstream of the polymerase domain of theta gene of DNA polymerase were purchased from Shanghai Novizan Biotechnology Co., Ltd., and HEK293T cells were lysed and used as templates for PCR.

[0337] (2) Forward and reverse deoxyoligonucleotides:

[0338] POL theta pol1-F:AAAACGACGGCCAGTGAATTCCAAAGCAGTGATTCACATGGGGT

[0339] POL theta pol1-R: TCATCAACAGCACAGATTTCTACTCCCTGGACTTAAATCGTGG

[0340] POL theta pol2-F:GTCCAGGGGAGTAGAAATCTGTGCTGTTGATGAAGTCCTCC

[0341] POL theta pol2-R: GACCATGATTACGCCAAGCTTGCAAAAAGATTAGCTCCATCCCTCTG

[0342] (2) Obtaining the template sequence PCR fragment connecting the upstream and downstream of the DNA polymerase theta gene polymerase domain

[0343] (3) Enzyme digestion of pUC19 plasmid vector

[0344] 1) Use EcoRI and HindIII restriction endonucleases to digest the vector plasmid. The reaction system is as follows:

[0345]

[0346] Reaction conditions: 37°C, 3 hours;

[0347] The DNA fragments were purified by gel extraction according to the instructions of the gel extraction kit (Qiagen).

[0348] (4) Homologous recombination enzyme digestion of the vector and the double-stranded DNA with hanging ends

[0349] The connection system is as follows:

[0350]

[0351] Reaction conditions: 37°C, 30 minutes.

[0352] (5) Transformation of ligation products

[0353] The ligation product was transformed with Stbl3 competent cell and cultured overnight at 37°C on LB plates containing ampicillin (Amp, 100 mg / L).

[0354] (6) Picking single clones for sequencing

[0355] 1) Pick a single colony from the ampicillin antibiotic LB plate and culture it in LB (Amp, 100 mg / L) liquid overnight.

[0356] 2) Plasmid extraction: Extract according to the instructions of the plasmid extraction kit (Axygen).

[0357] 3) The extracted plasmid was sent to Shanghai Qingke Biotechnology Co., Ltd. for sequencing.

[0358] (7) Sequencing successful plasmids for intermediate extraction

[0359] 1) The successfully sequenced plasmid was re-transformed with Stbl3 competent medium and cultured overnight on LB plates containing Amp (100 mg / L).

[0360] 2) In the morning, pick a single colony and culture it in 2 ml LB (Amp, 100 mg / L) liquid culture medium for 8 hours, then transfer it to 200 ml LB (Amp, 100 mg / L) liquid culture medium and culture it overnight.

[0361] 3) Collect bacteria and extract plasmids according to the instructions of the plasmid extraction kit (Qiagen).

[0362] 4. Construction of a Cas9-HEK293T cell line with a stable knockout of theta polymerase domain

[0363] Transfect the corresponding donor plasmid and sgRNA plasmid into HEK293T-Cas9 expression cell line

[0364] 1) Cell transfection

[0365] HEK293T cells were inoculated in a six-well plate. When the cells grew to 80%, a pair of pGL3-U6-sgRNA vector plasmids targeting different sites of the genome were transfected into the cells using lipo3000 transfection reagent. The medium was changed 24 hours after transfection, and the cells were passaged. After 48 hours, puromycin with a final concentration of 2μg / ml was used for resistance screening and culture. The drug was killed continuously for 2-4 days until all the control wild-type cells floated up and died. Then, fresh biological culture medium without puromycin was used for 2-4 days for monoclonal 96-well plate plating.

[0366] 2) Monoclonal cell homozygous screening

[0367] The method is the same as in Example 2.

[0368] 5. Construction of sgRNA library virus library

[0369] The method is the same as in Example 1.

[0370] 6. Packaging of sgRNA oligonucleotide library - production and concentration of lentivirus

[0371] The method is the same as in Example 1.

[0372] 7. sgRNA library virus library infection DNA polymerase theta polymerase domain fragment knockout Cas9-HEK293T cell line

[0373] The method is the same as in Example 1.

[0374] 9. Cell genomic DNA extraction, PCR amplification, and high-throughput sequencing

[0375] The method is the same as in Example 1.

[0376] Studies have shown that if Figure 13-14 As shown in the figure, compared with the control group, sgRNAs that knocked out the polymerase domain of the DNA polymerase theta gene were co-transfected with sgRNAs targeting 8 sites and humanized SpCas9 plasmid into human embryonic kidney HEK293T cells, which interfered with the partial expression of the DNA polymerase theta gene, especially making its polymerase domain unable to play its corresponding role. The deletion events of gene editing at each site were reduced, and the insertion events of gene editing were increased. The insertion frequency at each site was increased by 40%, 90%, and 100%, respectively, compared with the original insertion frequency. 1.01%, 75%, 66.67%, 66.67%, 55.56%, 42.81%, 85.71%, the deletion frequency at each site was reduced by 50.40%, 99.71%, 65.49%, 53.89%, 99.92%, 99.78%, 15.41%, 43.93% respectively compared with the original deletion frequency, and the precise connection frequency was greatly improved, especially for the sequences that are prone to base deletion due to the influence of the 4bp bases upstream of PAM, especially G and C, the repair results were changed to produce precise insertion. Fig.15 As shown, compared with the control group, the sgRNAs that knocked out the DNA polymerase theta gene originally mainly produced base deletions, and most of the sites with extremely low or no insertions underwent extremely high insertion frequencies, and most of them were 1bp base pair insertions, which increased by 40%, 91.01%, 75%, 66.67%, 66.67%, 55.56%, 42.81%, and 44.31%, respectively.

[0377] In summary, DNA polymerase theta is an important repair protein for repairing DNA break ends in the MMEJ (microhomology-mediated end joining) system. Cells transfected with sgRNAs targeting the DNA polymerase theta gene interfere with the expression of the DNA polymerase theta gene. The function of its polymerase domain is to perform base excision repair on DNA damage through its 5′-deoxyribose phosphate lyase function. DNA polymerase theta also uses its polymerase activity for filling synthesis, which helps to stabilize the paired ends. The inhibition of this part affects the DNA polymerase theta protein and prevents it from performing a good repair function, thus affecting the repair after DNA breakage.

[0378] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. The use of DNA polymerase theta inhibitors in the preparation of gene editing products; The DNA polymerase theta inhibitor is a composition consisting of gRNA and Cas9 protein; The gene editing product is a nucleotide insertion product for a C / G nucleotide at the -4 position of PAM, and the nucleotide insertion product is a product for inserting 1-2 bp base pairs at the -4 position of PAM; The gene is MROH9; The DNA chain encoding the gRNA contains the nucleic acid fragment shown in SEQ ID No.

34.

2. A composition for gene editing, characterized in that: The composition comprises the DNA polymerase theta inhibitor for use according to claim 1, the Cas9 protein or a nucleic acid fragment encoding the same, and the gRNA or a nucleic acid fragment encoding the same.

3. A gene editing method for editing isolated cell genes, characterized in that: The gene editing method comprises: introducing the composition of claim 2 into separated cells to achieve gene editing of the separated cells.

4. The gene editing method according to claim 3, characterized in that The gene editing method is a method for inserting nucleotides when the -4 position of PAM is C / G.

Images