Development and application of SNP molecular markers related to dry matter accumulation ability at seedling stage of barley

Abstract

The application discloses a SNP molecular marker related to dry matter accumulation ability of barley seedling stage and application thereof, and belongs to the technical field of molecular marker assisted breeding. The application provides a SNP molecular marker related to dry matter accumulation ability of barley seedling stage, wherein a fragment as shown in SEQ ID No. 3 is the molecular marker, and a polymorphic C / T exists at 327 bp of the fragment, and C is a dominant trait. The application identifies a SNP site with a significant improvement on dry matter accumulation ability of barley seedling stage through whole genome correlation analysis on dry matter content of the barley seedling stage, discloses a SNP molecular marker significantly related to dry matter content of the barley seedling stage for the first time, and the molecular marker is accurate and efficient in detection, and is convenient and stable in amplification, and can be used for molecular marker assisted selection and improvement on identification efficiency of different barley varieties.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular marker assisted breeding, and particularly relates to a SNP molecular marker related to the dry matter accumulation ability of barley at the seedling stage and an application thereof. BACKGROUND

[0002] Barley is a high-quality forage crop, which can be used as silage feed or grain feed, and the price is generally lower than that of wheat and corn, thereby effectively reducing the breeding cost. The silage barley is rich in nutrients and has good palatability, and is an irreplaceable feed for livestock and poultry. The protein and amino acid content (protein 31.0%, lysine 1.20%) of barley green leaves is much higher than that of grains (protein 11.0%, lysine 0.32%), and the barley green leaves also contain rich chlorophyll, vitamins, various enzymes and minerals. Feeding the tender barley grass to cows can increase the milk yield by 20% to 30%, improve the milk quality, and prolong the milk production period (5 to 6 years). In addition, the barley has the production characteristics of cold tolerance, drought tolerance, poor soil tolerance, good grassiness, and wide adaptability, and is particularly suitable for production in winter or in poor production environment.

[0003] Biomass is an important indicator for evaluating the yield of forage crops, and rapid accumulation of dry matter can make plants have more biomass in limited time and space, thereby generating more benefits for farmers. Genome wide association study (GWAS) is a reliable method for detecting genetic variation of complex traits of different species and finding associated markers or genes, and the method has been widely used in gene mining and marker development of animals and plants. The SNP molecular marker related to the dry matter accumulation ability of barley at the seedling stage is developed by using the GWAS technology, thereby providing an effective molecular tool for precise breeding of barley. SUMMARY

[0004] The application aims to provide a SNP molecular marker related to the dry matter accumulation ability of barley at the seedling stage and an application thereof, develop a SNP molecular marker related to the dry matter accumulation ability of barley at the seedling stage, and apply the molecular marker to screening of barley germplasm materials with rapid accumulation of dry matter at the seedling stage, and simultaneously use the molecular marker in the field of barley genetic breeding to cultivate new barley varieties with strong dry matter accumulation at the seedling stage.

[0005] The application provides a molecular marker related to the dry matter accumulation ability of barley at the seedling stage, wherein the nucleotide sequence of the molecular marker is a fragment as shown in SEQ ID No. 3, and the C at 327bp of the fragment as shown in SEQ ID No. 3 is a dominant trait.

[0006] The application further provides an application of the above-mentioned SNP molecular marker in detecting the dry matter accumulation ability of barley at the seedling stage.

[0007] Preferably, the characterizing of the dry matter accumulation ability of the barley seedling stage includes the dry matter weight of the above-ground part of the barley seedling stage.

[0008] The application also provides a set of primer pairs for detecting the SNP molecular marker of the dry matter accumulation ability of the barley seedling stage, which amplifies the above-mentioned gene.

[0009] Preferably, the upstream primer includes the nucleotide sequence shown in SEQ ID No. 1, and the downstream primer includes the nucleotide sequence shown in SEQ ID No. 2.

[0010] The application also provides the application of the above-mentioned primer pairs for detecting the SNP molecular marker in molecular marker assisted breeding.

[0011] The application also provides the application of the above-mentioned primer pairs for detecting the SNP molecular marker in screening the barley germplasm with strong dry matter accumulation ability of the barley seedling stage.

[0012] The application also provides a method for screening the barley germplasm with strong dry matter accumulation ability of the barley seedling stage, which includes the following steps: taking the genomic DNA of the target barley plant as a template, mixing and preparing a PCR amplification system with the above-mentioned primer pairs for detecting the SNP molecular marker, performing a PCR amplification reaction, and sequencing the amplification product, and screening the germplasm with C at the 327bp fragment shown in SEQ ID No. 3 as the germplasm with strong dry matter accumulation ability of the seedling stage.

[0013] Preferably, the PCR amplification system includes, in 50ul, 25ul of 2x Phanta Max Master Mix, 2ul of 10umol / L upstream primer and downstream primer, 5ul of template, and the rest of sterile water.

[0014] Preferably, the program of the PCR amplification reaction includes: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 15s, 35 cycles; 72℃ extension for 5min, and 12℃ preservation.

[0015] Beneficial effects: the application provides a gene related to the dry matter accumulation ability of the barley seedling stage, which includes the fragment shown in SEQ ID No. 3, and there is a polymorphism C / T at the 327bp of the fragment, and it is confirmed that the base at the SNP site is of the C type, and the barley variety to be tested is the material with strong dry matter accumulation ability of the seedling stage, if the base at the SNP site is of the T type, then the barley variety to be tested is the material with weak dry matter accumulation ability of the seedling stage.

[0016] The application identifies SNP sites with significant improvement on dry matter content at the seedling stage of barley through whole genome association analysis on dry matter content at the seedling stage of barley, discloses a SNP molecular marker significantly associated with dry matter content at the seedling stage of barley for the first time, and the molecular marker is accurate and efficient in detection, convenient and stable in amplification, and can be used for molecular marker assisted selection to improve the identification efficiency of different barley varieties. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 A box plot of haplotype analysis of 282 barley materials at the seedling stage in example 1. DETAILED DESCRIPTION

[0018] The application provides a SNP molecular marker related to dry matter accumulation capacity at the seedling stage of barley, wherein the nucleotide sequence of the molecular marker is a fragment as shown in SEQ ID No. 3, and the C type at 327bp of the fragment as shown in SEQ ID No. 3 is a dominant trait.

[0019] In the embodiment of the application, the dry matter weight of the seedling stage of 282 barley germplasm resources is measured, the whole genome SNP information of the population is obtained, and the EMMAX software is used for GWAS analysis, and the results show that a SNP marker located on the third chromosome is significantly associated with the dry matter weight of the seedling stage of barley, the SNP is located at the 579796555th base of the third chromosome of barley, the base difference is C / T, the value of -LOG10(P) is 6.15, and the dry matter weight of the seedling stage of the C type genotype barley is significantly higher than that of the T type genotype.

[0020] The specific sequence of the SNP molecular marker is shown in SEQ ID No. 3: TGATCACATGTGCGGTTGGTCCAACTGGTTGGGCCTTTTTTTCATCCACTTTTCTGTATTTTGTGCCGGCGGGTGGCTGCCTGATGGGCCGGCCCAGTGTGGCCTCCAGCACTGCTTTTGTCTACTTTTCTATCTCTGATTTTTTTATGGACTATCTCTACTTTGTTTTTATCTTTTGACTTTGTTTAGATATAGTCTGAATATTTTTTAAAATACTCTTAATATATTAATTAAAAAATCCTCTATATGCAAACTATGAAACATAAATAATCATGCATTAAAGAAATGCCAAACTTGAATAAAAAAATCTATTATATAAGAGAGTAYAGTATATATGATAAAATAATATAACTTTCGTTTATTTTTTGAAAAATGTGGATCATGCAATTATTTTATTTTAATGTGCATATAAAATGTTTTTGATCTATAATAAAAATGTATACCAAAATATACAATGTGTATGGAACAAAGTAGACATAACAAATATAAGTTTTCTAAAATGTTAATTATGTATTTGGAGAATGTCAAACGTGTATATAAAAAATGTTTCTGATATATACAAAAAATGTAAAATGTGTATAAAAAATTAGATATCAAAACTATATATGTTTTAAAAAATGTTAACCATGAAATTGGAAAATATTAAACGTGTATATAGAAAAAATTTCTGATGTATAAAAAATGTACAATGTTGCTGATGCAAGCTTTTCGTAGACCAATGGC, wherein Y at 327bp is C / T, and C is the dominant trait.

[0021] The application further provides the use of the above SNP molecular marker in detecting the dry matter accumulation ability of barley at seedling stage.

[0022] The characterization of the dry matter accumulation ability of barley at seedling stage preferably comprises the dry matter weight of the aboveground part of barley at seedling stage. In the determination in the examples, the aboveground part is retained by cutting at the stem base, and then is killed at 105℃ for 30 minutes, dried at 75℃ for 3 days. The weight of the sample at room temperature after drying is regarded as the dry matter weight. The room temperature referred in the application is preferably 20-25℃.

[0023] The application further provides a primer pair of a SNP molecular marker for detecting dry matter accumulation ability of barley at the seedling stage, which amplifies the fragment where the molecular marker is located.

[0024] The primer pair preferably comprises an upstream primer with a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer with a nucleotide sequence as shown in SEQ ID No. 2.

[0025] The upstream primer F (SEQ ID NO. 1) is 5'-TGATCACATGTGCGGTTGGT-3';

[0026] The downstream primer R (SEQ ID NO. 2) is 5'-GCCATTGGTCTACGAAAAGCT-3'.

[0027] The application further provides application of the primer pair of the SNP molecular marker in molecular marker-assisted breeding.

[0028] The primer pair can be used for PCR amplification and sequencing analysis of different barley genotypes, so as to effectively screen barley germplasm resources with different dry matter accumulation abilities at the seedling stage, specifically, the material with strong dry matter accumulation ability at the seedling stage has a base type C at the SNP, and the material with weak dry matter accumulation ability at the seedling stage has a base type T at the SNP.

[0029] The application further provides application of the primer pair of the SNP molecular marker in screening barley germplasm with strong dry matter accumulation ability at the seedling stage.

[0030] The application preferably has the same as described above, and will not be described here.

[0031] The application further provides a method for screening barley germplasm with strong dry matter accumulation ability at the seedling stage, comprising the following steps: taking genomic DNA of a target barley plant as a template, mixing and preparing a PCR amplification system with the primer pair of the SNP molecular marker, performing a PCR amplification reaction, and performing sequencing on the amplification product, and screening the germplasm with C at 327bp of the fragment as shown in SEQ ID No. 3 as the germplasm with strong dry matter accumulation ability at the seedling stage.

[0032] The PCR amplification system is preferably 50 μL, and includes 2x Phanta Max Master Mix 25 μL, 10 μmol / L upstream primer and downstream primer 2 μL each, template 5 μL, and the rest is sterile water; the PCR amplification reaction program includes: 95℃ pre-denaturation 3 min; 95℃ denaturation 15 s, 58℃ annealing 15 s, 72℃ extension 15 s, 35 cycles; 72℃ extension 5 min, 12℃ storage. In the present application, if the base at the SNP site is C type, the tested barley variety is a material with strong dry matter accumulation ability at seedling stage, and if the base at the SNP site is T type, the tested barley variety is a material with weak dry matter accumulation ability at seedling stage.

[0033] In order to further illustrate the present application, the SNP molecular marker related to the dry matter accumulation ability of barley at seedling stage provided by the present application and the application thereof are described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the present application.

[0034] If not specifically indicated, the technical means used in the examples are conventional means familiar to those skilled in the art. The barley materials used in the present application can be obtained from Crop Science Institute of Zhejiang University. The biochemical reagents used in the present application are commercially available.

[0035] The 282 barley germplasms involved in the examples are shown in Table 1.

[0036] Table 1 282 barley germplasms used in the present application

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043] Example 1

[0044] (1) Test materials

[0045] 282 global barley germplasm resources shown in Table 1 are used as materials.

[0046] (2) Trait determination

[0047] Quantitative nutrient soil (Danish peat soil 0-10mm) was measured, mixed with quantitative tap water, and then evenly stirred. Quantitative (hole filled with soil) was loaded into 32-hole seedling trays for standby. Select barley seeds with good seed condition, sow 4 holes per material, and place in a growth chamber at 22°C, 60% relative air humidity, and 18h / 6h light / dark photoperiod. When the seedlings grow to 5cm, thin them out, and keep 4 single plants with consistent growth per material. When the whole material enters the three-leaf stage at 21 days in the indoor growth, cut the aboveground part at the stem base, blanch at 105°C for 30 minutes, dry at 75°C for 3 days, and then take the sample to room temperature and weigh.

[0048] (3) GWAS analysis and SNP molecular marker determination

[0049] Based on the above determination of the dry matter weight of the barley seedling stage aboveground part of the population, the whole genome SNP information was used to perform GWAS analysis by EMMAX software, and the results showed that a SNP marker located on chromosome 3 was significantly associated with the dry matter weight of the barley seedling stage aboveground part. The SNP was located at the 579796555th base of barley chromosome 3, with a base difference of C / T, and a -LOG10(P) value of 6.15.

[0050] (4) Haplotype analysis

[0051] Based on the SNP marker and the dry matter weight of the seedling stage aboveground part of 282 test materials, haplotype analysis was performed, and the results are shown in Figure 1 . Among them, the SNP typing is divided into two types, blue for C type and red for T type, and the dry matter weight of the barley seedling stage aboveground part of the C type genotype is significantly higher than that of the T type genotype.

[0052] Example 2

[0053] (1) Test materials

[0054] Ten global barley micro-core germplasm resources were used as materials to determine the dry matter content of the seedling stage and analyze the target region of S3H_579796555. As shown in Table 2, 5 high dry matter content materials and 5 low dry matter content materials were included.

[0055] (2) Obtaining of SNP marker

[0056] According to the SNP site information, combined with the whole genome sequence information of barley, a SNP marker primer is developed, the upstream primer F is 5'-TGATCACATGTGCGGTTGGT-3'; the downstream primer R is 5'-GCCATTGGTCTACGAAAAGCT-3', the amplification size is 723 bp, and the SNP is located at the 327th bp of the amplification fragment. The primer is used to detect the variation of the base at 579796555 of the third chromosome of barley.

[0057] (3) DNA extraction

[0058] Fresh leaves at the seedling stage are used as materials, and CTAB method is used to extract DNA, and the detailed steps are as follows:

[0059] a) Take about 5g of barley tender leaves and put them in a 2ml centrifuge tube, put two steel balls washed with 75% alcohol into the full-automatic sample grinder, and grind the sample at 55HZ for 1min;

[0060] b) Add 400ul of CTAB extraction buffer, and place it in a 65℃ water bath for 1h, shake it every 10min, and cool it at room temperature after water bath;

[0061] c) Add an equal volume of chloroform:isopropyl alcohol (24:1) solution, and shake it thoroughly, centrifuge at 12000rpm for 10min, and transfer the supernatant to a new 1.5ml centrifuge tube;

[0062] d) Add 2 / 3 of the volume of pre-cooled isopropanol to the supernatant, shake it slowly up and down for 30s to mix the isopropanol and water layers thoroughly, and precipitate the DNA at-20℃ for 20min;

[0063] e) Centrifuge at 12000rpm for 10min, discard the supernatant, and add 500ul of 70% alcohol to wash the DNA;

[0064] f) Centrifuge at 12000rpm for 3min to remove the alcohol, and wash twice, then place it in a clean bench to dry;

[0065] g) Add 50ul of ddH2O to dissolve the DNA, and store it at-20℃ for later use.

[0066] (4) PCR

[0067] The PCR amplification reaction system is: 2xPhanta Max Master Mix (Vazyme) 25ul, 10umol / L Primer F / R 2ul each, 100ng / ul template DNA 5ul and sterile water 16ul, the total amount of reaction system is 50ul.

[0068] PCR reaction was performed on PCR instrument, and the procedure was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 15 s, 35 cycles; extension at 72℃ for 5 min, and preservation at 12℃.

[0069] (5) After the reaction, the reaction product was sequenced for genotyping identification, and the SNP site variation was shown in Table 2.

[0070] Table 2: 10 barley germplasm materials with different dry matter contents at seedling stage

[0071] Barley germplasm SNP detection results Dry matter content Index type C BCS-185 0.7059 High C BCS-178 0.6985 High C BCS-200 0.6907 High C BCS-112 0.6874 High C BCS-114 0.6778 High T BCS-232 0.4556 Low T BCS-170 0.4229 Low T BCS-20 0.3875 Low T BCS-25 0.3822 Low T BCS-100 0.3593 Low

[0072] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Use of a reagent for detecting SNP molecular markers associated with the weight of dry matter in the aboveground part of barley seedlings in detecting the weight of dry matter in the aboveground part of barley seedlings, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No.

3. The 327th position of the sequence is a SNP site with a polymorphism of C / T. When the SNP site is C, the germplasm has a larger aboveground dry matter weight at the barley seedling stage.

2. Use of a detection primer pair for detecting a SNP molecular marker associated with the weight of aboveground dry matter in barley seedlings in molecular marker-assisted selection of barley with a larger weight of aboveground dry matter in the seedling stage, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No.

3. The 327th position of the sequence is a SNP site with a polymorphism of C / T. When the SNP site is C, the germplasm has a larger aboveground dry matter weight at the barley seedling stage.

3. Use of a detection primer pair for detecting a SNP molecular marker associated with the weight of aboveground dry matter in barley seedlings in screening barley germplasm with a larger weight of aboveground dry matter in barley seedlings, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No.

3. The 327th position of the sequence is a SNP site with a polymorphism of C / T. When the SNP site is C, the germplasm has a larger aboveground dry matter weight at the barley seedling stage.

4. A method for screening barley germplasm with a larger aboveground dry matter weight at the barley seedling stage, characterized in that: The following steps are involved: A PCR amplification system was prepared using genomic DNA of target barley plants as a template and a detection primer pair for detecting SNP molecular markers related to the aboveground dry matter weight of barley seedlings. A PCR amplification reaction was carried out, and the amplified products were sequenced. The germplasm with C at the 327 bp position of the fragment shown in SEQ ID No. 3 was screened as the germplasm with a larger aboveground dry matter weight at the seedling stage.

5. The method according to claim 4, characterized in that: The PCR amplification system, based on 50 μL, includes: 25 μL of 2×PhantaMax Master Mix, 2 μL each of 10 μmol / L upstream primer and downstream primer, 5 μL of template, and the balance of sterile water.

6. The method according to claim 4 or 5, characterized in that The PCR amplification reaction procedure includes: pre-denaturation at 95° C. for 3 min; denaturation at 95° C. for 15 s, annealing at 58° C. for 15 s, and extension at 72° C. for 15 s, for 35 cycles; extension at 72° C. for 5 min, and storage at 12° C.

Images