A trypsin gene associated with cotton boll number and application
Genome-wide association analysis revealed the trypsin gene GhHNT associated with boll number in cotton. Specific primers were designed to detect the SNP site, enabling precise regulation of the boll number trait in cotton. This solved the problem of difficulty in analyzing the boll number trait in cotton breeding, and improved breeding efficiency and yield.
Patent Information
- Application Number
- CN202410310885.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-19
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2044-03-19
AI Technical Summary
Existing technologies are insufficient to effectively analyze the molecular genetic mechanisms of cotton boll number traits, and there is a lack of methods for discovering key genes, which affects the cotton breeding process.
Genome-wide association analysis (GWAS) revealed the trypsin gene GhHNT, which is closely related to cotton boll number. Specific primers were designed to detect its SNP site A06:110979436. Genetic engineering was used to regulate the boll number trait to cultivate new high-yield cotton varieties.
It enables precise control of cotton boll number traits, provides efficient breeding methods, can significantly increase cotton yield, and simplifies the identification and breeding process of high-yield varieties.
Smart Images

Figure CN118064463B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology applications and relates to a trypsin gene associated with the boll number trait of cotton yield. Background Technology
[0002] Cotton is an important economic crop in my country, serving not only as a crucial raw material for the textile industry but also for defense, pharmaceuticals, and other industries, with a wide range of applications. Developing high-yielding and high-quality cotton varieties has become a key objective in cotton breeding. Therefore, elucidating the molecular genetic mechanisms of cotton fiber yield and quality traits and identifying key genes is crucial for cotton breeding. Genome-wide association analysis (GWAS) is an important tool for identifying candidate genes and can significantly accelerate the breeding process.
[0003] Genome-wide association analysis (GWAS) is an analytical method that detects genotype information of molecular markers at the whole genome level and analyzes their correlation with target traits using certain statistical methods, ultimately screening out the most likely effective loci of variation that influence the target trait. In recent years, with the reduction in the cost of high-throughput sequencing technology, GWAS has become an effective analytical tool for elucidating the genetic basis of crop phenotypic diversity due to its advantages of high efficiency and time saving. In addition, GWAS can detect multiple alleles at the same locus, providing a more comprehensive detection range; this technology can not only study qualitative traits controlled by single genes but also be used to uncover complex traits controlled by multiple genes with minor effects. Currently, GWAS methods are widely used in breeding rice, rapeseed, cotton, and other crops. Yu et al. (2023) conducted a genome-wide association analysis on 268 local rice varieties and identified 10 candidate genes associated with salt tolerance traits. Among them, two novel salt tolerance genes that had not been reported before were OsWRKY53 and OsMKK10.2 (Yu, J., Zhu, C., Xuan, W. et al. Genome-wide association studies identify OsWRKY53 as a key regulator of salt tolerance in rice. Nat Commun 14, 3550 (2023)). Yang et al. (2022) resequencing 250 soybean accessions and using GWAS to perform association analysis on 50 agronomic traits, obtaining 201 QTLs. They ultimately screened five new key candidate genes for soybean molecular design breeding: isoflavone content-related genes GSTT1, GL3, and GSTL3; yield-related gene CKX3; and plant architecture and yield-related gene CPY85A2. These findings are of great significance for soybean molecular design breeding (Yang C, Yan J, Jiang S, Li X, Min H, Wang X, Hao D. Resequencing 250 Soybean Accessions: New Insights into Genes Associated with Agronomic Traits and Genetic Networks. Genomics Proteomics Bioinformatics. 2022 Feb; 20(1):29-41. doi:10.1016 / j.gpb.2021.02.009.Epub). 2021Jul24.PMID:34314874; PMCID:PMC9510855).In cotton, Hua Jinping's team, in collaboration with Kong Jie's team and Jona than F. Wendel's team, resequencing 336 Sea Island cotton materials and conducting genome-wide association analysis on 15 traits of Sea Island cotton, including plant type, maturity, yield, and fiber quality. They screened out 5 genes associated with lint percentage, fiber length, strength, and disease resistance, laying a theoretical foundation for analyzing high-quality cotton genetic resources (Zhao N, et al., 2022). The above studies show that GWAS plays an important role in the study of complex crop traits and provides good technical support for improving crop traits (Zhao N, Wang W, Grover CE, Jiang K, Pan Z, Guo B, Zhu J, Su Y, Wang M, Nie H, Xiao L, Guo A, Yang J, Cheng C, Ning X, Li B, Xu H, Adjibolosoo D, Aierxi A, Li P, Geng J, Wendel JF, Kong J, Hua J. Genomic and GWAS analyses demonstrate phylogenomicrelations of Gossypium barbadense in China and selection for fibrelength, lint percentage and Fusarium wilt resistance. Plant Biotechnol J. 2022 Apr; 20(4):691-710).
[0004] Trypsin (EC3.4.21.4) is essentially a serine proteolytic enzyme composed of two subunits, α and β. It functions by specifically cleaving the positively charged lysine and arginine carboxyl terms. Early studies suggested that trypsin existed only in animals. However, in 2014, a marine molecular ecology and genomics team led by Lin Senjie discovered that this enzyme exists in diatoms and exhibits high expression levels during red tide research (Zhang Y, Lin X, Shi X, Lin L, Luo H, Li L, Lin S. Metatranscriptomic Signatures Associated With Phytoplankton Regime Shift From Diatom Dominance to a Dinoflagellate Bloom. Front Microbiol. 2019 Mar 22; 10:590). In 2022, the team conducted functional verification on the trypsin gene ptTryp2 and found that the gene can adapt to changes in nutrient concentration by regulating its own expression level, proving that the gene plays a key role in the response of phytoplankton to changes in nutrient conditions (You Y, Sun X, Ma M, He J, Li L, Porto FW, Lin S. Trypsin is a coordinate regulator of N and P nutrients in marine phytoplankton. Nat Commun. 2022 Jul 12;13(1):4022). In addition, Ye et al. (2019) elucidated the function of trypsin HvHNT1 in barley and found that the gene was expressed in microtubule tissue, adventitious root primordia and axillary buds, and showed negative regulation of tiller development (Lingzhen Ye, Yin Wang, Lizhi Long, HaoLuo, Qiufang Shen, Sue Broughton, Dianxing Wu, Xiaoli Shu, Fei Dai, Chengdao Li, Guoping Zhang, A Trypsin Family Protein Gene Controls Tillering and Leaf Shapein Barley, Plant Physiology, Volume 181, Issue 2, October 2019, Pages 701–713). Summary of the Invention
[0005] The purpose of this invention is to provide a trypsin gene associated with cotton boll number. Genome-wide association analysis shows that expression of this gene can cause phenotypic variation in boll number, one of the yield traits in cotton. Another purpose of this invention is to provide applications of this gene.
[0006] The objective of this invention can be achieved through the following technical solutions:
[0007] A trypsin gene GhHNT associated with cotton boll number has a cDNA sequence as shown in SEQ ID NO:2; the protein it encodes has an amino acid sequence as shown in SEQ ID NO:1. The cotton boll number-associated trypsin gene GhHNT described in this invention is related to cotton boll number trait components and negatively regulates the boll number trait.
[0008] The expression of the trypsin gene GhHNT, which is associated with cotton boll number, is linked to a downstream genetic locus (SNP: A06:110979436). In the population, materials with an A / A base at this SNP locus show higher GhHNT expression, resulting in fewer bolls; materials with a T / A base show moderate GhHNT expression, resulting in moderate boll numbers; and materials with a T / T base show lower GhHNT expression, resulting in more boll numbers. The SNP locus controlling the trypsin gene GhHNT can be used to identify high-yielding upland cotton varieties. Specifically, this involves detecting the base type of the SNP locus A06:110979436 controlling the trypsin gene GhHNT in the cotton genome; cotton with a thymine base is identified as a high-boll-number cotton variety.
[0009] Furthermore, the primer pair for detecting the SNP site is: upstream primer: SEQ ID NO.3, downstream primer: SEQ ID NO.4.
[0010] SEQ ID NO.3:
[0011] Left primer sequence F1 (5'-3')
[0012] ATGACAGTCCCCGACACGTACT
[0013] SEQ ID NO.4:
[0014] Right primer sequence R1(5'-3')
[0015] TCCTTGTAACTCATTGTACGAT
[0016] Furthermore, the primer pair is used in screening high-yield cotton varieties. The genotype of the downstream genetic locus of the trypsin gene GhHNT, which is associated with boll number in cotton, is detected. If the genotype of the downstream genetic locus is T / T, it is identified as a high-yield upland cotton variety.
[0017] This invention relates to the application of the trypsin gene GhHNT in the breeding of high-yielding cotton varieties through genetic engineering. The expression level of the trypsin gene GhHNT shows a significant negative correlation with the number of bolls in upland cotton. Low expression of the GhHNT gene indicates high-boll-count varieties, while high expression indicates low-boll-count varieties.
[0018] The beneficial effects of this invention are:
[0019] 1. This invention identifies a trypsin gene, GhHNT, associated with cotton boll number through genome-wide association analysis. The GhHNT trypsin gene of this invention is closely related to cotton boll number in the genome-wide association analysis. The GhHNT cDNA sequence provided by this invention was obtained using PCR technology, which has the advantages of requiring a small amount of starting template, having simple and easy experimental procedures, and high sensitivity.
[0020] 2. The expression level of GhHNT in different cotton varieties 20 days after flowering was analyzed by transcriptome sequencing. The expression of this gene was significantly correlated with the number of bolls, indicating that this gene is related to the constituent factors of yield traits.
[0021] 3. Based on different SNP genotypes of GhHNT, the varietal population can be divided into three major categories. Statistical analysis revealed significant differences in the boll number trait among these three groups. Figure 4 This further demonstrates the correlation between this gene and cotton yield traits. Attached Figure Description
[0022] Figure 1 This is a graph showing the results of a genome-wide association analysis of cotton boll number traits; in the graph:
[0023] The horizontal axis represents the location on the chromosome (Mb), and the positive vertical axis represents the significance of the association between the SNP locus and the agronomic trait, expressed as -log. 10 (P value) represents this.
[0024] Figure 2 This is a statistical graph showing the gene expression levels of GhHNT in different tissues and developmental stages of cotton; in the graph:
[0025] The horizontal axis represents different tissues: R represents root, S represents stem, L represents leaf, Ovule represents ovule, and Fiber represents fiber. Ovule tissue includes 3 days before flowering, 1 day before flowering, the day of flowering, and 1 to 25 days after flowering. Fiber tissue includes 5 days after flowering, 10 days after flowering, 20 days after flowering, and 25 days after flowering. The vertical axis represents FPKM, a standard for measuring relative gene expression levels.
[0026] Figure 3 This is a graph showing the regression analysis results of the relative expression level of GhHNT and the bell number trait level; in the graph:
[0027] The scatter plots represent the variety population, the horizontal axis represents the standardized gene expression level, and the vertical axis represents the number of bolls for the yield trait.
[0028] Figure 4 The figure shows the results of the analysis of differences in expression levels and bell number among different haplotypes of GhHNT in the population; in the figure:
[0029] The left panel represents the difference in gene expression levels among different genotypes in the population, and the right panel represents the difference in boll number among different genotypes in the population. The box plots represent the distribution of the boll number trait in the varietal population. There are 14, 34, and 117 varieties containing the AA, TA, and TT haplotypes, respectively. The horizontal lines within the boxes represent the median of the trait distribution. Detailed Implementation
[0030] Example 1: Mining of the cotton boll number-associated trypsin gene GhHNT:
[0031] From 2007 to 2009, detailed surveys of cotton yield traits (boll number, seed index, etc.) were conducted on 258 modern cotton varieties or lines in Anyang, Henan Province; Nanjing, Jiangsu Province; and Kuqa, Xinjiang Province. Simultaneously, whole-genome sequencing was performed on these 258 cotton varieties. The sequencing data were compared with the reference genome of the upland cotton standard line TM-1. Then, SNP identification was performed at the whole-genome level using the samtools software. Genome-wide association analysis was conducted on the identified genetic variation sites and cotton phenotypic data. The results are as follows: Figure 1As shown, a SNP signaling site (A06:110979436) on chromosome A06 is associated with the cotton boll number trait. This SNP is also associated with the trypsin family gene GhHNT (GH_A06G1651) within the GWAS signal region, suggesting that this gene may be involved in cotton boll number formation. The cDNA sequence of the trypsin gene GhHNT (GH_A06G1651) is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1. The three main components of cotton yield are boll number per plant, boll weight, and lint percentage. Therefore, studying the function of this gene in regulating the cotton boll number trait can provide a genetic basis for improving high-yielding cotton varieties, thereby promoting the progress of precision cotton breeding.
[0032] Example 2: Obtaining the cotton boll number-associated trypsin gene GhHNT:
[0033] The cDNA sequence of GhHNT (GH_A06G1651) was obtained from the genome sequence of upland cotton (SEQ ID NO.2). Full-length primers were designed based on both ends of the cDNA for PCR amplification. The primer sequences were F2 (SEQ ID NO.5: ATGACCATTAGAGCATTTCATAGTA) and R2 (SEQ ID NO.6: TCACTTCGATTCTTTCACGATACAC). The PCR reaction program was as follows: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 sec; 55℃ annealing for 5 sec; 68℃ extension for 10 sec, 35 cycles; and a final extension at 68℃ for 5 min. The PCR amplification product was sequenced, and the sequence was compared with the cDNA sequence for consistency. The gene GhHNT was finally obtained.
[0034] Example 3: Analysis of the expression level of the cotton boll number-associated trypsin gene GhHNT in different tissues and developmental stages of cotton:
[0035] RNA samples from different tissues and developmental stages of the upland cotton TM-1 variety were used for transcriptome sequencing. Sample materials included roots, stems, leaves, ovules, and fibers. Ovule tissue samples included those from 3 and 1 days before flowering, on the day of flowering, and 1 to 35 days after flowering. Fiber tissue samples included those from 5 to 25 days after flowering. The results showed that the GhHNT gene was predominantly expressed in ovule tissue 1 day after flowering. Figure 2 This indicates that the gene is associated with the boll number trait component of cotton.
[0036] Example 4: Regression analysis of the relative expression level of the cotton boll number-associated trypsin gene GhHNT with the boll number trait.
[0037] Regression analysis was performed on the relative expression level of GhHNT and the boll number trait in the varietal population. The ordinate represents the boll number level, and the abscissa represents the FPKM value of GhHNT (normally centered), indicating the relative expression level of GhHNT. The results of the regression analysis show that the GhHNT gene negatively regulates the boll number trait (…). Figure 3 ).
[0038] Example 5: Comparative analysis of the boll number trait of the cotton boll number-associated trypsin gene GhHNT among different genotypes in a population.
[0039] Based on the location of the SNP locus on chromosome A06 (A06:110979436), amplification primers were designed at both ends. The upstream primer is shown in SEQ ID NO.3, and the downstream primer is shown in SEQ ID NO.4. PCR amplification and sequencing were performed on the 165 varietal populations shown in Table 1. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 58℃ annealing for 30 s, 72℃ extension for 20 s, 30 cycles; and a final extension at 72℃ for 5 min. The genotypes of each varietal population at this SNP locus were analyzed based on the sequencing results. According to the different genotypes of the SNP locus regulating GhHNT, the varietal populations were divided into three categories: TT indicates that SNP locus A06:110979436 is a homozygous locus, TA indicates a heterozygous mutation, and AA indicates a homozygous mutation. (See Table 1 and...) Figure 4 As shown, the number of varieties with the three genotypes were 117, 34, and 14, respectively. Statistical analysis revealed significant differences between homozygous loci and homozygous mutant populations, both between population genotypes and gene expression levels, and between population genotypes and boll number trait levels, demonstrating the correlation between this gene and SNP loci and cotton boll number trait.
[0040] The results above demonstrate that the trypsin gene GhHNT has significant research value in improving boll number and breeding new high-boll-number cotton varieties. On one hand, molecular markers can be designed based on the two haplotypes of the SNP site controlling the trypsin gene GhHNT, effectively identifying the boll number trait in cotton and demonstrating significant application value in the breeding of high-boll-number cotton varieties. On the other hand, through genetic engineering, site-directed mutagenesis can be performed on the SNP site in the low-boll-number haplotype (AA) to create a high-boll-number haplotype, thereby breeding new high-boll-number cotton varieties.
[0041] Table 1. Identification of high-boll-number and low-boll-number haplotypes in population varietal materials.
[0042]
[0043]
[0044] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A method for detecting and controlling trypsin genes GhHNT The application of reagents for identifying SNP sites in the identification of high-boll-count cotton varieties is characterized by, trypsin gene GhHNT It has a cDNA sequence as shown in SEQ ID NO:2; the specific application is: using the detection of the trypsin gene. GhHNT Reagent detection of SNP sites in the cotton genome to control trypsin genes GhHNT The base type of the SNP site A06:110979436, where the base is thymine, indicates that cotton varieties with a high boll count are cotton varieties.
2. The application according to claim 1, characterized in that, Detection of trypsin-controlling genes in the cotton genome GhHNT The primer pairs for the SNP site A06:110979436 include the upstream primer as shown in SEQ ID NO.3 and the downstream primer as shown in SEQ ID NO.4.