Application of biological materials for regulating protein expression and method for regulating plant disease resistance

Abstract

The present invention discloses the application of biological materials for regulating protein expression and a method for regulating plant disease resistance, and belongs to the field of biological breeding technology. The technical problem to be solved by the present invention is: how to improve the resistance of plants to stem base rot. To this end, the present invention provides the application of biological materials for regulating the expression of TaHCT5B protein encoding genes in regulating plant resistance to stem base rot. The present invention also provides a method for regulating plant disease resistance, which regulates the disease resistance of plants by regulating the expression of the encoding gene of the TaHCT5B protein. The present invention proves through experiments that TaHCT5B protein and its encoding gene can regulate plant disease resistance. The present invention has excavated a new gene that can regulate plant disease resistance under the infection conditions of Pseudomonas graminearum, which has important significance and application value for cultivating new disease-resistant varieties of plants and improving plant disease resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of biological breeding, and specifically relates to the application of biological materials for regulating protein expression and a method for regulating plant disease resistance. Background Art

[0002] During the growth and development of wheat, it is always facing various biological and environmental stresses, such as diseases and insect pests. These environmental stresses have a serious impact on the growth and development of plants. Among them, wheat stem rot is a widely spread soil-borne disease. Wheat stem rot can cause changes in plant physiological traits and metabolism. During the invasion of Pseudomonas graminearum (the pathogen of wheat stem rot), a series of responses will occur in the plant body, accompanied by many physiological, biochemical and developmental changes. Clarifying the response mechanism of wheat resistance genes will provide a scientific basis for the research and application of wheat stem rot resistance genetic engineering.

[0003] Under the conditions of biological stress, plants can make corresponding adjustments at the molecular, cellular and overall levels to minimize the damage caused by the stress and survive. In the long-term evolutionary process, from the invasion of pathogens, signal perception, intercellular transduction and transmission, plant cells respond to the invasion of pathogens by adjusting gene expression. Many genes are highly expressed in the case of pathogen invasion. The products of these genes can not only directly participate in the plant's immune response, but also regulate the expression of other related genes or participate in signal transduction pathways, so that plants can avoid or reduce damage and enhance resistance to pathogen invasion. In addition to traditional breeding, plant disease resistance research has gradually deepened to the cellular and molecular levels. Therefore, exploring disease resistance-related genes and applying them to crop genetic breeding will become an effective means to improve a certain disease resistance trait of crops. It has important theoretical guidance and practical application value for breeding new disease-resistant varieties and improving the disease resistance of crops.

[0004] Wheat (Triticum aestivum L.) is one of China's main food crops. With global climate change, wheat is affected by various diseases and pests during its growth. With the continued application of farming methods such as returning straw to the field and corn-wheat rotation, the large-scale planting of susceptible varieties is conducive to the continuous accumulation of soil bacteria in the diseased fields. In the long run, wheat is under increasing pressure from pathogens, the frequency and severity of the disease continue to increase, and prevention and treatment become more difficult. The outbreak of wheat stem rot will lead to serious production losses. Therefore, discovering wheat stem rot resistance genes and analyzing their disease resistance mechanisms have become one of the important tasks in wheat genetic research and wheat variety improvement. Summary of the invention

[0005] The technical problem to be solved by the present invention is: how to improve the resistance of plants to stem base rot.

[0006] In order to solve the technical problem, in the first aspect, the present invention provides an application of a biomaterial, wherein the biomaterial is a substance for regulating the expression of a gene encoding a TaHCT5B protein, and the application is any of the following:

[0007] A1), use of the biological material in regulating plant resistance to stem base rot;

[0008] A2), use of the biological material in preparing a product for regulating plant resistance to stem base rot;

[0009] A3) Use of the biological material in regulating plant resistance to Fusarium pseudograminearum;

[0010] A4) Use of the biological material in preparing a product for regulating plant resistance to Fusarium graminearum;

[0011] A5) using the biological material in plant breeding or in assisting plant breeding;

[0012] The TaHCT5B protein is any of the following proteins:

[0013] a1), the amino acid sequence is the protein shown in SEQ ID No.1;

[0014] a2), a protein related to plant stress resistance, which has more than 80% identity with the amino acid sequence shown in a1) and is obtained by replacing and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1);

[0015] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0016] Furthermore, in the above application, the regulation may be upward regulation or increase. The regulation may also be downward regulation or decrease.

[0017] Furthermore, in the above application, the plant breeding indicator may be the plant's resistance to Fusarium pseudograminearum and / or stem base rot.

[0018] Furthermore, in the above application, the purpose of plant breeding includes cultivating plants resistant to Fusarium pseudograminearum and / or plants resistant to stem base rot.

[0019] In the present invention, SEQ ID No. 1 consists of 434 amino acid residues.

[0020] The TaHCT5B protein can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0021] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0022] In the above application, the substance that regulates the expression of the gene encoding the TaHCT5B protein may be a substance that upregulates or increases the gene encoding the TaHCT5B protein and / or a substance that upregulates or increases the expression of the gene encoding the TaHCT5B protein. The regulation of plant disease resistance / stem base rot resistance / resistance to Fusarium pseudograminearum may be to increase plant disease resistance / stem base rot resistance / resistance to Fusarium pseudograminearum.

[0023] In the above application, the substance that regulates the expression of the gene encoding the TaHCT5B protein may be a substance that downregulates, reduces or knocks out the gene encoding the TaHCT5B protein and / or a substance that downregulates or reduces the expression of the gene encoding the TaHCT5B protein. The regulation of plant disease resistance / stem base rot resistance / resistance to Fusariumpseudograminearum may be reducing plant disease resistance / stem base rot resistance / resistance to Fusariumpseudograminearum.

[0024] In the above application, the substance that regulates gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0025] In the above application, the regulating gene expression may be to inhibit or reduce the gene expression, and the inhibiting or reducing the gene expression may be achieved by gene knockout or gene silencing.

[0026] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0027] The gene silencing refers to the phenomenon that the gene is not expressed or is underexpressed without damaging the original DNA. Gene silencing is based on the premise that the DNA sequence is not changed, so that the gene is not expressed or is underexpressed. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression, RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0028] Furthermore, the TaHCT5B protein in the application is derived from wheat (Triticum aestivum L.).

[0029] Furthermore, the substance in the application is any one of the following:

[0030] B1), a nucleic acid molecule encoding the TaHCT5B protein;

[0031] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0032] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0033] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0034] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0035] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0036] B7), a transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3);

[0037] B8), a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the TaHCT5B protein or inhibits or reduces the activity or content of the TaHCT5B protein;

[0038] B9), an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in B8).

[0039] Furthermore, in the application, the nucleic acid molecule described in B1) is the DNA molecule described in g1) or g2) below:

[0040] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0041] g2), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant disease resistance;

[0042] Furthermore, in the application, B8) the nucleic acid molecule is an RNA targeting the gene encoding the above-mentioned protein or a DNA molecule that transcribes the RNA.

[0043] Furthermore, in the application, the nucleotide sequence of the target sequence of the RNA in B8) is SEQ ID No. 3.

[0044] B1) The nucleic acid molecule may also include a nucleic acid molecule obtained by modifying the codon preference based on the nucleotide sequence shown in SEQ ID No. 2.

[0045] The nucleic acid molecule also includes a nucleic acid molecule having a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 and originating from the same species.

[0046] A person skilled in the art can easily mutate the nucleotide sequence of the gene encoding the TaHCT5B protein of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the gene encoding the TaHCT5B protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the TaHCT5B protein and have the function of the TaHCT5B protein.

[0047] The coding gene of the TaHCT5B protein of the present invention (TaHCT5B gene) can be any nucleotide sequence capable of encoding the TaHCT5B protein. Considering the degeneracy of codons and the preference of codons of different species, those skilled in the art can use codons suitable for expression of a specific species as needed.

[0048] The nucleic acid molecule described herein can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0049] In the above-mentioned related biological materials, the expression cassette described in B2) refers to a DNA capable of expressing TaHCT5B protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the gene encoding the TaHCT5B protein, but also a terminator for terminating transcription of the gene encoding the TaHCT5B protein.

[0050] Furthermore, the expression cassette B2) may further include an enhancer sequence.

[0051] In the above-mentioned related biological materials, the recombinant vector B3) may contain the DNA molecule encoding TaHCT5B protein shown in SEQ ID No.2.

[0052] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid or viral vector, and specifically may be Peasyblunt vector, vector pCAMBIA2300.

[0053] The existing plant expression vectors can be used to construct a recombinant expression vector containing the TaHCT5B gene, including but not limited to binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment.

[0054] When using the TaHCT5B gene to construct a recombinant plant expression vector, any enhanced promoter or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to cauliflower mosaic virus (CAMV) 35S promoter, corn ubiquitin promoter (ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0055] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as adding genes including but not limited to those encoding enzymes or luminescent compounds that can be expressed in plants and can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical agent resistance marker genes (such as herbicide resistance genes), etc. Considering the safety of transgenic plants, no selective marker gene may be added, and transformed plants may be screened by inoculating with Pseudomonas graminearum.

[0056] By using any vector that can guide the expression of foreign genes in plants, the TaHCT5B gene or gene fragment provided by the present invention is introduced into plant cells or recipient plants, and transgenic cell lines and transgenic plants with improved disease resistance can be obtained. The expression vector carrying the TaHCT5B gene can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues can be cultivated into plants.

[0057] Among the above-mentioned related biological materials, the recombinant microorganism described in B4) can specifically be yeast, bacteria, algae and fungi. Among them, the bacteria can be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc. In an embodiment of the present invention, the recombinant microorganism can specifically be Escherichia coli competent cell TOP10 and / or Agrobacterium tumefaciens GV3101.

[0058] Among the above-mentioned related biological materials, the plant tissue described in B6) can be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and anthers.

[0059] Among the above-mentioned related biological materials, the transgenic plant organs described in B7) can be roots, stems, leaves, flowers, fruits and seeds of transgenic plants.

[0060] Among the above-mentioned related biological materials, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation materials.

[0061] Furthermore, in the application, the plant is selected from monocotyledonous plants and / or dicotyledonous plants.

[0062] Furthermore, in the application, the monocotyledonous plant is a plant of the Poaceae family, and the dicotyledonous plant is a plant of the Cruciferae family.

[0063] Furthermore, in the application, the grass plant is a plant of the genus Triticum, and the cruciferous plant is a plant of the genus Arabidopsis.

[0064] Furthermore, in the application, the Triticum plant is wheat (Triticum aestivum L.), and the Arabidopsis plant can be Arabidopsis thaliana (L.) Heynh.

[0065] In the above application, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0066] In the above applications, the above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0067] In a second aspect, the present invention provides a method for regulating plant disease resistance, the method comprising regulating the plant disease resistance by regulating the expression of the gene encoding the TaHCT5B protein.

[0068] Furthermore, the method includes introducing a gene encoding the TaHCT5B protein into a recipient plant to increase the activity or content of the TaHCT5B protein in the recipient plant and improve the disease resistance of the recipient plant.

[0069] Furthermore, in the method, improving the disease resistance of the plant may be improving the disease resistance of the plant to stem base rot.

[0070] Furthermore, in the method described above, the stem base rot may be a fungal disease caused by Fusarium graminearum.

[0071] Furthermore, in the method described above, the gene encoding the TaHCT5B protein can be introduced into the recipient plant in the form of a recombinant vector.

[0072] Furthermore, the method also includes down-regulating or reducing the expression of the TaHCT5B protein in the recipient plant or down-regulating or reducing the activity or content of the TaHCT5B protein to reduce the resistance of the recipient plant to stem base rot.

[0073] Furthermore, in the method described above, the down-regulation or reduction of the expression of the TaHCT5B protein in the recipient plant or the down-regulation or reduction of the activity or content of the TaHCT5B protein can be achieved by silencing the TaHCT5B gene in the recipient plant.

[0074] Furthermore, in the method described above, the TaHCT5B gene in the silencing receptor plant can be achieved through virus-induced gene silencing.

[0075] Furthermore, in the method described above, the virus-induced gene silencing comprises introducing a recombinant virus (eg, a recombinant barley streak mosaic virus) targeting the TaHCT5B gene into the recipient plant, and the target site of the recombinant virus may be SEQ ID No. 3.

[0076] In one embodiment of the present invention, the expression of TaHCT5B gene in wheat is downregulated or reduced by RNA interference, thereby reducing the wheat resistance to stem base rot. This embodiment demonstrates the role of TaHCT5B gene or its encoded protein in regulating wheat resistance to stem base rot.

[0077] Specifically, in an embodiment of the present invention, the wheat described in the above applications and methods may be Pubingzi 300.

[0078] Furthermore, in the method, the purpose of wheat breeding is to cultivate wheat resistant to stem base rot.

[0079] In the present invention, the wheat resistance to stem base rot may be a fungal disease caused by Fusarium graminearum. The disease resistance or wheat resistance to stem base rot in the present invention may be resistance to diseases caused by Fusarium graminearum.

[0080] In an embodiment of the present invention, the Pseudofusorium graminearum described in the wheat resistance experiment to stem rot can specifically be Pseudofusorium graminearum CS3096.

[0081] Furthermore, in the method, the plant is selected from monocotyledonous plants and / or dicotyledonous plants.

[0082] Furthermore, in the method described above, the monocotyledonous plant is a Poaceae plant, and the dicotyledonous plant is a Cruciferae plant.

[0083] Furthermore, in the method described above, the grass plant is a plant of the genus Triticum, and the cruciferous plant is a plant of the genus Arabidopsis.

[0084] Furthermore, in the method described above, the Triticum plant is wheat (Triticum aestivum L.), and the Arabidopsis plant can be Arabidopsis thaliana (L.) Heynh.

[0085] In a third aspect, the present invention provides a method for cultivating disease-resistant plants, the method comprising increasing the content and / or activity of the TaHCT5B protein in a target plant to obtain a disease-resistant plant having higher disease resistance than the target plant.

[0086] Furthermore, in the method described above, increasing the content and / or activity of the TaHCT5B protein in the target plant is achieved by introducing a gene encoding the TaHCT5B protein into the target plant.

[0087] Furthermore, in the method, increasing the content and / or activity of the TaHCT5B protein in the target plant is achieved by increasing the expression level of the gene encoding the TaHCT5B protein in the target plant.

[0088] Furthermore, in the method, increasing the expression level of the gene encoding the TaHCT5B protein in the target plant is achieved by introducing the gene encoding the TaHCT5B protein into the target plant.

[0089] Furthermore, in the method described above, the gene encoding the TaHCT5B protein is any one of the following:

[0090] g1), the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 2;

[0091] g2), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and regulates plant disease resistance.

[0092] Furthermore, in the method, the plant is selected from monocots and / or dicots. Furthermore, in the method, the monocot is a grass plant, and the dicot is a crucifer.

[0093] Furthermore, in the method described above, the grass plant is a plant of the genus Triticum, and the cruciferous plant is a plant of the genus Arabidopsis.

[0094] Furthermore, in the method described above, the Triticum plant is wheat (Triticum aestivum L.), and the Arabidopsis plant can be Arabidopsis thaliana (L.) Heynh.

[0095] In the present invention, the disease resistance is improved in:

[0096] (1) Reduce the disease index of plants;

[0097] (2) Reduce the biomass of Fusarium graminearum in plants.

[0098] In the present invention, the disease-resistant plants are understood to include not only the first generation transgenic plants obtained by transforming the TaHCT5B gene into the target plant, but also its progeny. The gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The disease-resistant plants include seeds, callus tissues, complete plants and cells.

[0099] The beneficial technical effects achieved by the present invention are as follows:

[0100] The present invention introduces the TaHCT5B gene for regulating plant disease resistance from wheat (Triticum aestivum L.) into wild-type Arabidopsis to obtain a homozygous Arabidopsis strain for the TaHCT5B gene. Compared with a non-transgenic receptor control, under the infection condition of Fusarium graminearum, the disease index of the transgenic Arabidopsis overexpressing the TaHCT5B gene is significantly lower than that of the receptor control. The experimental results of wheat gene silencing show that silencing the TaHCT5B gene weakens the ability of wheat to resist stem base rot. It shows that the TaHCT5B protein of the present invention and its encoding gene can regulate the disease resistance of plants, and the disease resistance of the target plant can be significantly improved by increasing the content and / or activity of the TaHCT5B protein in the target plant.

[0101] The present invention has discovered new genes that can regulate plant disease resistance under the infection conditions of Pseudomonas graminearum, which has important significance and application value for breeding new disease-resistant varieties of plants and improving the disease resistance of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 The fungal infection of TaHCT5B Arabidopsis and WT infected with Fp CS3096. Figure 1 A in the middle shows the mycelial growth from day 0 to day 4 under the infection of wild-type Arabidopsis thaliana Fp CS3096; Figure 1 Middle B is the statistics of the disease severity of transgenic Arabidopsis and WT under FpCS3096 infection on the 5th day (1-5 represent different levels of infection, with increasing severity); Figure 1 Center C shows the disease progression of transgenic Arabidopsis and WT on the 5th day after infection with Fp CS3096.

[0103] Figure 2 The wheat phenotype and silencing efficiency of TaHCT5B silencing; Figure 2 A in the middle shows the transcription level of TaHCT5B in BSMV:TaHCT5B and BSMSV:γ in wheat; Figure 2 Middle B shows the wheat leaf mottle after virus transfection and the expression of the viral CP gene.

[0104] Figure 3 Silencing TaHCT5B reduced wheat resistance to Fp CS3096. Figure 3 A in the middle shows the lesion morphology of wheat plants infected with BSMV:TaHCT5B and BSMV:γ; Figure 3 Middle B is the disease index statistics of BSMV:TaHCT5B compared with BSMV:γ (t-test: **P<0.01); Figure 3 Middle C shows WGA staining of the stem epidermis of BSMV:TaHCT5B and BSMV:γ. DETAILED DESCRIPTION

[0105] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0106] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0107] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0108] The wheat variety Pubingzi 300 in the following examples was bred by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (https: / / baike.baidu.com / item / %E6%99%AE%E5%86%B0%E8%B5%84300 / 62934276) and donated by researcher Li Lihui. The public can apply for the above biological materials from the applicant. The obtained biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0109] Agrobacterium tumefaciens GV3101 in the following examples was purchased from Beijing Bomed Gene Technology Co., Ltd., with the item number BC304-01. Competent Escherichia coli strain Top10 was purchased from Beijing Bomed Gene Technology Co., Ltd., with the item number BC101-01.

[0110] The BSMV-VIGS gene silencing vectors in the following embodiments are pCaBS-α, pCaBS-β, and pCaBS-γ donated by Zhang Zengyan's research group of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and are disclosed in the document "Yi-Xuan Wang, Tai-Fei Yu, et al. Heat shock protein TaHSP17.4, a TaHOP interactor in wheat, improves plantstress tolerance. International Journal of Biological Macromolecules (IF 8.2) Pub Date: 2023-07-05, DOI: 10.1016 / j.ijbiomac.2023.125694". The public can obtain the above-mentioned biological materials from the applicant. The obtained above-mentioned biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0111] The Arabidopsis thaliana variety Columbia type (recorded as col-0 in the embodiment) in the following example is preserved by the applicant and recorded in "Yi-Xuan Wang, Tai-Fei Yu, et al. Heat shock protein TaHSP17.4, a TaHOPinteractor in wheat, improves plant stress tolerance. International Journal of Biological Macromolecules (IF 8.2) Pub Date: 2023-07-05, DOI: 10.1016 / j.ijbiomac.2023.125694". The public can obtain the above-mentioned biological material from the applicant. The obtained above-mentioned biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0112] The Arabidopsis transformation vector pCAMBIA2300 in the following examples was donated by the Cotton Institute of the Chinese Academy of Agricultural Sciences and was disclosed in the document “Zheng L, Wu H, Qanmber G, Ali F, Wang L, Liu Z, Yu D, Wang Q, Xu A, Yang Z. Genome-Wide Study of the GATL Gene Family in Gossypium hirsutum L. Reveals that GhGATL Genes Act on Pectin Synthesis to Regulate Plant Growth and Fiber Elongation. Genes (Basel). 2020 Jan 6”. The public can obtain the above-mentioned biological materials from the applicant. The obtained biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0113] The pseudograminearum (scientific name: Fusarium pseudograminearum, referred to as Fp strain) CS3096 in the following embodiment was kindly donated by Mr. Jiang Yunfeng of the Wheat Research Institute of Sichuan Agricultural University, and was disclosed in the document "Jiang Y, Habib A, et al. Development of tightly linked markers and identification of candidate genes for Fusarium crown rot resistance in barley by exploiting a near-isogenic line-derived population. Theor Appl Genet. 2019 Jan; 132 (1): 217-225. doi: 10.1007 / s00122-018-3209-0. Epub 2018 Oct 16. PMID: 30327844." The public can obtain the above-mentioned biological material from the applicant, and the obtained biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0114] The component MES in the infection medium in the following examples is a product of Beijing Solebow Technology Co., Ltd., with the product number M8010-25g.

[0115] The CMC culture medium in the following examples is a product of Beijing Solebow Technology Co., Ltd., with a product number of C8621-25g.

[0116] The WGA in the following examples is a product of Thermo Fisher Scientific (China) Co., Ltd., with a product number of W11261.

[0117] The following examples used GraphPad Prism statistical software to process the data, and the experimental results were expressed as mean ± standard deviation. Two-way ANOVA test was used, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0118] Example 1. Obtaining TaHCT5 protein and its encoding gene

[0119] Chinese spring wheat seedlings grown for about 2 weeks under normal conditions were quickly frozen with liquid nitrogen and stored at -80°C for later use. The total RNA from the leaves was extracted by the Trizol method, and the first-strand cDNA was synthesized by reverse transcriptase XL (AMV). The ds-cDNA was synthesized by the SMART method, and the PCR products were detected by 1.0% agarose gel electrophoresis. The DNA molecule containing the coding sequence was obtained by the 5'RACE and 3'RACE methods. The coding sequence of the TaHCT5B protein was a DNA molecule whose nucleotide sequence was SEQ ID No.2, and the TaHCT5B protein whose amino acid residue sequence was SEQ ID No.1 was encoded.

[0120] The plant disease resistance-related protein gene isolated and cloned from Chinese Spring was named TaHCT5B gene. The coding sequence (CDS) of TaHCT5B gene is a DNA molecule with a nucleotide sequence of SEQ ID No. 2, and the encoded amino acid sequence is a protein with a SEQ ID No. 1, named TaHCT5B protein.

[0121] Table 1 Sequences of TaHCT5 protein and its encoding gene

[0122]

[0123]

[0124] Example 2: Identification of disease resistance of transgenic Arabidopsis thaliana with TaHCT5B gene

[0125] 1. Construction of recombinant expression vector

[0126] 1. Using the obtained TaHCT5B fragment as a template, a primer pair consisting of TaHCT5B-2300F and TaHCT5B-2300R was used for PCR amplification to obtain a PCR amplification product, and the PCR product was recovered by gel.

[0127] TaHCT5B-2300F:5'-ACGAACGATA TCTAGAATGGAGGTTAAGGTGTTGGG-3' (SEQ ID No. 4, the underline indicates the XbaI restriction enzyme recognition site);

[0128] TaHCT5B-2300R:5'-CAGGCGCGCC GGTACC CTACTCCATGGAATAGCAGC-3 (SEQ ID No. 5, the underline indicates the KpnI restriction enzyme recognition site).

[0129] 2. Use restriction endonucleases XbaI and Kpn1 to digest the vector pCAMBIA2300 and recover the vector backbone.

[0130] 3. Connect the PCR recovery product of step 1 and the vector backbone of step 2 using In-Fusion technology to obtain the recombinant plasmid pCAMBIA2300-TaHCT5B. After the company's sequencing is correct, extract the positive bacterial solution plasmid for standby use. The sequencing results show that the recombinant plasmid pCAMBIA2300-TaHCT5B is a recombinant plasmid obtained by replacing the fragment between the XbaI and Kpn1 restriction sites of the plasmid pCAMBIA2300 (a small fragment between the XbaI and Kpn1 restriction sites) with a DNA molecule having a nucleotide sequence of SEQ ID No.2, and keeping the other nucleotide sequences of the plasmid pCAMBIA2300 unchanged. The recombinant plasmid pCAMBIA2300-TaHCT5B contains the coding sequence (CDS) of the TaHCT5B gene and can encode the TaHCT5B protein with an amino acid sequence of SEQ ID No.1.

[0131] 2. Obtaining transgenic Arabidopsis

[0132] 1. Introduce the recombinant plasmid pCAMBIA2300-TaHCT5B into Agrobacterium GV3101 to obtain Agrobacterium GV3101 / pCAMBIA2300-TaHCT5B containing the recombinant plasmid.

[0133] (1) Agrobacterium GV3101 / pCAMBIA2300-TaHCT5B containing the recombinant plasmid was inoculated into YEP liquid culture medium and cultured at 28°C and 3000 rpm for about 18 hours to harvest the bacterial culture.

[0134] (2) The bacterial liquid obtained in step (1) was streaked on YEP solid medium (containing 50 μg / L streptomycin and 50 μg / L kanamycin) and cultured at 28° C. for about 2 days to harvest the plate bacteria.

[0135] The formula of YEP liquid culture medium: beef extract 5g / L, yeast extract 1g / L, peptone 5g / L, sucrose 5g / L, MgSO4·7H2O 0.4g / 100ml, the rest is water, pH 7.4.

[0136] YEP solid medium is based on the YEP liquid medium formula with 15g / L agar added.

[0137] 2. Inoculate the bacterial strains harvested from step 1(2) into LB liquid culture medium containing 50 mg / L kanamycin, shake and culture in a shaker at 200 rpm and 28°C until OD600 is higher than 2.0, centrifuge at 5000 rpm and room temperature for 5 min, discard the supernatant, collect the bacterial cells, resuspend them in infiltration culture medium to OD600 equal to 0.8, and harvest the bacterial liquid.

[0138] The formula of LB medium is: peptone 10g / L, NaCl 10g / L, yeast extract 5g / L, and the rest is water.

[0139] 3. Inoculate the bacterial solution harvested in step 2 into LB liquid medium containing 50 mg / L kanamycin resistance, shake and culture in a shaker at 200 rpm and 28°C until OD600 is higher than 2.0, centrifuge at 5000 rpm and room temperature for 5 min, discard the supernatant, collect the bacteria, and resuspend them in the infection medium until OD600 is equal to 0.8 to prepare the Agrobacterium infection solution. Add 500 mL of Agrobacterium infection solution to a glass culture dish, and soak the flower buds of Arabidopsis in the Agrobacterium infection solution for 2 min. After the infection, place the Arabidopsis in the dark and avoid light for 24 hours, and then continue to grow under normal culture conditions (light 16h, 23°C; dark 8h, 18°C) to maturity and harvest, and screen and identify the positive plants on the resistance MS plate.

[0140] The steps of screening and identification of the resistant MS plate are as follows: the received T1 generation Arabidopsis seeds are disinfected with ethanol, spotted on 1 / 2MS medium (containing 20mg / L Kan) and grown for 7 days, and Arabidopsis seedlings with green leaves and resistance to kanamycin are selected and moved to the soil to continue growing until the T2 generation seeds are harvested. The harvested T2 generation seeds are disinfected, spotted on 1 / 2MS medium (containing 20mg / LPPT) and grown for 7 days, and resistant seedlings are selected for transplanting in a culture dish with a ratio of resistant to susceptible strains of 3:1, and cultured in the culture room for 4 to 6 weeks, and the T3 generation seeds are harvested.

[0141] Preparation of 1 / 2MS solid culture medium: weigh 1.1g MS powder, 5g sucrose, and 0.25g MES, dissolve them in distilled water and make up to 500mL, adjust the pH to 5.7 with KOH, and add 0.75g agar powder per 100mL.

[0142] The formula of the infection medium is: MgCl2 2g / L, MES 0.5g / L, sucrose 50g / L, Silwet L-77 0.1mL are added to the 1 / 2MS liquid medium. The only difference between the formula of the 1 / 2MS liquid medium and the 1 / 2MS solid medium is that agar powder is not added.

[0143] 4. Harvest Arabidopsis positive plant seeds and screen homozygous strains

[0144] RNA was extracted from positive Arabidopsis plants and reverse transcribed into cDNA. The transgenic positive plants (DNA molecules containing the coding sequence of the TaHCT5B gene: SEQ ID NO.2) were verified by PCR. The seeds of the transgenic positive plants and the plants obtained by planting the seeds were defined as the T0 generation. The T0 generation was self-pollinated until the T3 generation obtained the T3 generation homozygous strains stably transformed with the coding sequences of the three TaHCT5B genes, which were named #1, #2, and #3, respectively.

[0145] 3. Detection of the relative expression of TaHCT5B gene

[0146] Total RNA of the T3 generation Arabidopsis homozygous lines #1, #2, and #3 obtained in step 2 was extracted and reverse transcribed to obtain cDNA. The cDNA concentration of the samples was normalized using the constitutively expressed actin gene as an internal reference. Real-time fluorescence quantitative PCR (RT-qPCR) analysis was then performed using specific primers for the TaHCT5B gene. -△△CT Method (Livak KJ,SchmittgenTD.2001.Analysis of relative gene expression data using real-timequantitative PCR and the 2 -△△CT method.Methods.25:402-408) was used to analyze the relative expression level of TaHCT5B gene.

[0147] The primers used for qRT-PCR were as follows (5'-3'):

[0148] TaHCT5B-F: CTGCACCCCGACCTAGAGAC (SEQ ID No. 6);

[0149] TaHCT5B-R: TGGCTTGAAGAGGTCCTTGT (SEQ ID No. 7);

[0150] Actin-F: GCATGAAGATCAAGGTGGTTGCAC (SEQ ID No8);

[0151] Actin-R: ATGGACCTGACTCATCGTACTCACT (SEQ ID No. 9).

[0152] The results showed that compared with the wild type (Col-0), the expression level of TaHCT5B gene in transgenic Arabidopsis was significantly increased, indicating that the exogenous gene TaHCT5B gene has not only been successfully integrated into the Arabidopsis genome, but also can be transcribed and expressed normally in transgenic Arabidopsis.

[0153] 4. Disease resistance identification of transgenic Arabidopsis thaliana with TaHCT5B gene

[0154] In the greenhouse, the resistance of homozygous TaHCT5B overexpressing transgenic lines #1, #2, and #3 to stem rot was identified by the flower staining method, and wild-type Arabidopsis (Col-0) was used as a control. 50 strains of lines #1, #2, #3 and wild-type Arabidopsis were planted respectively. The disease severity was counted 8 days after inoculation with Fp CS3096. The specific operation steps are as follows:

[0155] 1. Preparation of Fp CS3096 spore solution

[0156] Fp CS3096 was activated on a PDA plate medium. After the medium was covered with hyphae, 3-4 culture pieces were cut from the medium with a sterilized blue pipette tip and cultured in CMC medium at 25℃ and 220rpm for 5 days. When the bacterial solution was shaken to turbidity, it was filtered with 4 layers of gauze in a clean bench, and the filtrate was centrifuged at 5000rpm for 8 minutes. It was resuspended with sterile ddH2O and washed twice. The concentration of spores was observed under a microscope using a hemocytometer.

[0157] 2. Arabidopsis thaliana floral inoculation with Fp CS3096

[0158] Arabidopsis thaliana were grown to 2 weeks old for infection; the spore solution was diluted to 1x10 5 / mL, add 0.01% SilwetL-77 to prepare 50mL infection solution. Immerse the flower buds of Arabidopsis in the infection solution, wrap the whole plant with a moisturizing plastic bag and avoid light for 24 hours after inoculation to promote spore germination. The day of inoculation is recorded as day 0 (0 day). After 24 hours, continue to culture under normal conditions (light 16 hours, 23°C; dark 8 hours, 18°C), and start recording the growth status of mycelium from the second day (2 days). On the fifth day (5 days), count the incidence of different plants.

[0159] 3. Arabidopsis disease index identification method:

[0160] According to the identification method of Fusarium graminearum of ASANO (ASANO et al., 2017), the disease severity was statistically analyzed on the 5th day after inoculation of Fp CS3096, where level 1 was normal, level 2 was that aerial hyphae could be seen on the Arabidopsis flowers, level 3 represented that the flowers had begun to dry up, level 4 represented that the flowers and plant stems had shrunk, and level 5 represented that the flowers and plant stems were severely dried up and rotten tissue had appeared.

[0161] Disease index (DI disease index) = 100 × (∑ number of investigated plants × representative value of each plant) / (total number of investigated plants × highest representative value).

[0162] Anti-disease effect (%) = (control disease index - treatment disease index) / control disease index × 100%.

[0163] Table 2. Survey results of disease levels and conditions of transgenic Arabidopsis and wild-type Arabidopsis

[0164] Arabidopsis thaliana strains Average disease grade Disease index Disease resistance Significance of difference #1 2.5 50 17％ *** #2 2.25 45 25％ *** #3 2.3 46 23％ *** Col-0 3 60

[0165] *** indicates that there are extremely significant differences in the disease index of stem base rot between transgenic Arabidopsis lines #1, #2, and #3 and wild-type Arabidopsis Col-0 at the P<0.001 level.

[0166] The results are as follows Figure 1 As shown, Figure 1 The fungal infection of TaHCT5B overexpressing transgenic lines #1, #2, #3 and wild-type Arabidopsis thaliana (Col-0) infected with Fp CS3096 is shown in Figure 2. Figure 1 A in the middle shows the mycelial growth from day 0 to day 4 under the infection of wild-type Arabidopsis thaliana Fp CS3096; Figure 1 Middle C shows the disease status of transgenic Arabidopsis thaliana #1, #2, #3 and wild-type Arabidopsis thaliana (Col-0) on the 5th day after infection with Fp CS3096; Figure 1 Middle B is the statistics of the disease severity of transgenic Arabidopsis and WT under Fp CS3096 infection on the 5th day (1-5 represent different levels of infection, with increasing severity).

[0167] The experimental results of Arabidopsis thaliana overexpressing the TaHCT5B gene showed that TaHCT5B protein and its encoding gene TaHCT5B can regulate the disease resistance of plants. By increasing the content and / or activity of TaHCT5B protein in the target plant (such as overexpressing the TaHCT5B gene), the disease resistance of the target plant can be significantly improved.

[0168] Example 3: Verification of TaHCT5B gene disease resistance by wheat VIGS technology

[0169] BSMV is a single-stranded RNA virus consisting of three genes: α, β and γ RNA. The transcription sequence representing the gene fragment to be silenced is inserted into the downstream of the stop codon of the open reading frame encoding γ in the DNA plasmid, and the RNA is synthesized by the fragments encoding α, β and γ in the DNA plasmid. When the recipient plant is infected with these three RNA fragments, it will lead to the synthesis of viral dsRNA, thereby activating the antiviral RNA silencing pathway and silencing the target gene. In this embodiment, the BSMV-VIGS gene silencing vector is pCaBS-α, pCaBS-β, and pCaBS-γ, and the silencing steps are as follows:

[0170] 1. Construction of pCaBS-γ-target gene vector

[0171] The target fragment for silencing was designed on the SGN-VIGS (solgenomics.net) website, and NotI restriction sites were added at both ends. The nucleotide sequence of the silencing fragment is SEQ ID No.3. The DNA molecule shown in sequence 3 in the sequence list was constructed into the pCaBS-γ vector by the reverse insertion method, so that the DNA molecule that is reversely complementary to the DNA fragment shown in sequence 3 in the sequence list is driven by the T7 promoter of the γ vector, and the pCaBS-γ-target gene vector is obtained. The structure of the pCaBS-γ-target gene vector is: the DNA molecule with the nucleotide sequence of SEQ ID No.3 is reversely inserted between the NotI restriction sites of the pCaBS-γ vector, and the other sequences of the pCaBS-γ vector remain unchanged.

[0172] Table 3 DNA molecules of target sequences

[0173]

[0174] 2. Linearization of Silencing Vector

[0175] The pCaBS-α and pCaBS-γ vectors were cut with MluI (NEB / R3198S) restriction endonuclease to obtain the pCaBS-α linearized vector and pCaBS-γ linearized vector. The pCaBS-β vector was cut with SpeI (NEB / R3133S) restriction endonuclease to obtain the pCaBS-β linearized vector. The pCaBS-γ-targetgene vector was cut with BssHI (NEB / R0199S) restriction endonuclease to obtain the pCaBS-γ-target gene linearized vector.

[0176] 3. Electrophoresis detection

[0177] The four linearized vectors harvested in step 2 were detected by electrophoresis using Marker 8K. The gel system was 5μL (enzyme digestion product) + 5μL (6× Loading buffer), and the band was a single band at around 8K. The target band was recovered according to the gel recovery system process, and the purification of the target fragment was completed to obtain 4 purified linearized vectors.

[0178] 4. In vitro transcription of silencing vector

[0179] The purified linearized vectors harvested in step 3 were subjected to in vitro transcription according to the in vitro transcription systems in Table 4, and four types of RNA were harvested respectively. When the linearized plasmid in Table 4 is a pCaBS-α linearized vector, the transcription product is α, and when the linearized plasmid in Table 4 is a pCaBS-β linearized vector, the transcription product is β. When the linearized plasmid in Table 4 is a pCaBS-γ linearized vector, the transcription product is γ. When the linearized plasmid in Table 4 is a pCaBS-γ-target gene linearized vector, the transcription product is γ-target gene.

[0180] Table 4 In vitro transcription system of various vectors

[0181]

[0182] 5. BSMV virus inoculation

[0183] Preparation method of BSMV: TaHCT5B virus solution: Take 10 μl of each of the transcription products BSMV-α, BSMV-β and γ-target gene obtained in step 4 and mix them for a total of 30 μl, add 3 times the volume (90 μl) of DEPC H2O to make the total volume 120 μl, and then add one times the volume (120 μl) of GKP buffer to prepare 240 μl BSMV: TaHCT5B virus solution.

[0184] Preparation method of BSMV:γ virus solution: Take 10μl of each of the transcription products BSMV-α, BSMV-β and BSMV-γ transcripts obtained in step 4 and mix them for a total of 30μl, add 3 times the volume (90μl) of DEPC H2O to make the total volume 120μl, and then add one times the volume (120μl) of GKP buffer to prepare 240μl BSMV:γ virus solution.

[0185] The experiment was conducted in two groups: one group was the control group, which was inoculated with BSMV:γ virus liquid, and the virus-transformed wheat obtained was named BSMV:γ wheat; the other group was the experimental group, which was inoculated with BSMV:TaHCT5B virus liquid, and the virus-transformed wheat obtained was named BSMV:TaHCT5B wheat. Each group was inoculated with 20 wheat plants and planted in pots, 5 plants / pot.

[0186] The operation of the experimental group is as follows: When the wheat grows to the two-leaf one-heart stage in the greenhouse, it is time to prepare for inoculation. When inoculating with 10μL of SMV: TaHCT5B virus liquid, use newly opened gloves to dip the virus liquid and rub the second leaf of the wheat seedling at the two-leaf one-heart stage 2-3 times until the leaf turns dark green. Apply force evenly and try to keep the integrity of the leaf. After the inoculation is completed, spray the newly sterilized ddH2O, and record it as the 0th day after inoculation. After keeping it away from light and moisturizing for 48 hours, move it to a normal growth environment. Until the virus white spot appears ( Figure 2 B) Begin to quantitatively verify the expression of the gene. The control group was operated in accordance with the experimental group, with the only difference being that the virus inoculated was BSMV:γ virus solution.

[0187] The steps for expression verification are as follows:

[0188] (1) Refer to the operating procedures of KK Ultrafast Plant Total RNA Extraction Kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., product number ZP405K-2) to extract plant total RNA for reverse transcription.

[0189] Novazome IIQ RT Super Mix operation steps, the cDNA synthesis reaction system is as follows: RNase-free ddH2O 8μL, 4×gDNA wiper Mix 4μL, template RNA 4μL, after mixing the components of the reaction system, react at 42℃ for 2min to obtain the first step reaction solution. The RNA reverse transcription reaction system is as follows: 5×HiScript II q RT Super Mix 4μL, first step reaction solution 16μL, after mixing the components of the reaction system, react at 50℃ for 15min, and react at 85℃ for 5sec to obtain the reverse transcription product.

[0190] (2) RT-qPCR was performed using an ABI 7500 real-time fluorescence quantitative PCR instrument and Norwegian Taq Pro Universal SYBR qPCR Master Mix. The reaction system was as follows: 2× Taq Pro Universal SYBR q-PCR Master Mix 10.0 μL, forward primer (10 μM) 0.4 μL, reverse primer (10 μM) 0.4 μL, template DNA / cDNA 2 μL, and ddH2O to 20.0 μL.

[0191] The ABI 7500 program was set as follows: 94°C pre-denaturation for 30 seconds, 94°C denaturation for 15 seconds, and 60°C extension for 30 seconds. Steps 2-3 were reacted for 40 cycles, and the calculation formula was 2- △△ct .

[0192] The primer sequences are as follows (5' to 3'):

[0193] TaActin RT-F: GGAATCCATGAGACCACCTAC (SEQ ID No. 10);

[0194] TaActin RT-R: GACCCAGACAACTCGCAAC (SEQ ID No. 11);

[0195] TraesCS5B02G336300-F: CTGCACCCCGACCTAGAGAC (SEQ ID No. 6);

[0196] TraesCS5B02G336300-R: TGGCTTGAAGAGGTCCTTGT (SEQ ID No. 7).

[0197] The transcriptional expression of the BSMV coat protein CP gene was detected by semi-quantitative PCR, indicating that BSMV had been successfully transfected into wheat ( Figure 2 (middle B).

[0198] In order to detect the silencing of the TaHCT5B gene in wheat plants, we used the transformed wheat in the control group as a control, extracted RNA from the stem base of the transformed wheat in the experimental group, and used RT-qPCR to analyze the expression level of TaHCT5B in silenced wheat plants.

[0199] The primer sequences for RT-qPCR are as follows (5'-3'):

[0200] TraesCS5B02G336300-F: CTGCACCCCGACCTAGAGAC (SEQ ID No. 6);

[0201] TraesCS5B02G336300-R: TGGCTTGAAGAGGTCCTTGT (SEQ ID No. 7);

[0202] BSMV-CP-F: TGACTGCTAAGGGTGGAGGA (SEQ ID No. 12);

[0203] BSMV-CP-R: CGGTTGAACATCACGAAGAGT (SEQ ID No. 13).

[0204] The results are as follows Figure 2 As shown in A, it can be seen from the results that the expression level of TaHCT5B in silenced plants was significantly reduced, indicating that TaHCT5B was successfully silenced in wheat plants with a silencing efficiency of 30%-50%.

[0205] 6. Wheat grain method for inoculation of Fusarium graminearum

[0206] The experiment was divided into two groups, in which the control group was the control group wheat (BSMV: γ) prepared in step 5, and the experimental group was the experimental group wheat (BSMV: TaHCT5B) prepared in step 5. On the 10th day after the wheat was transfected with BSMV virus in step 5, Fp CS3096 was inoculated by the wheat grain method. The disease index of the successfully transfected silent plants was identified. Twenty wheat plants were set in each experimental group.

[0207] The Fp CS3096 strain was inoculated on potato dextrose agar (PDA) and cultured in a 25°C incubator for 3-5 days. After the hyphae were fully covered, it was stored in a 4°C refrigerator for later use.

[0208] Preparation of diseased wheat grain culture medium: Soak the wheat grains in ddH2O overnight and sterilize at 120℃ for 20min. Inoculate the pathogen with 4g of PDA culture medium covered with hyphae per 100g of wheat grains. When the hyphae cover the wheat grains, they can be used for inoculation.

[0209] Inoculation method: Weigh 5 g and place it at the base of the wheat stem obtained in step 5 for disease identification of individual plants. The day of inoculation is recorded as inoculation day 0.

[0210] 6.1. Disease Index Statistics

[0211] Scoring of wheat lesions was performed on the 10th day after inoculation, and statistics were made according to the severity of the disease.

[0212] Level 0 means no obvious symptoms on the outer leaf sheath, level 1 means the browning of the first leaf sheath is less than 1 / 4 of the length of the leaf sheath, level 2 means the browning of the first leaf sheath accounts for 1 / 4-1 / 2 of the length of the leaf sheath, level 3 means the browning of the first leaf sheath accounts for 1 / 2-3 / 4 of the length of the leaf sheath, level 4 means the first leaf sheath completely falls off and rots, and the second leaf sheath has obvious browning, and level 5 means the third leaf sheath has obvious browning or the whole plant is dead.

[0213] Disease index (DI disease index) = 100 × (∑ number of investigated plants × representative value of each plant) / (total number of investigated plants × highest representative value).

[0214] Table 5. Survey results of wheat stem rot grade and disease status of BSMV:TaHCT5B and BSMV:γ wheat lines

[0215]

[0216] Note: *** indicates that there is a very significant difference in the disease index of wheat base stem rot between BSMV:TaHCT5B and BSMV:γ at the P<0.001 level.

[0217] The results showed that lesions appeared on all the silent plants 5 days after inoculation; and 10 days after inoculation, severe lesions of stem base rot appeared at the stem base of BSMV:TaHCT5B wheat, which were more severe than those of BSMV:γ wheat ( Figure 3 ) The infection types (i.e., the levels of disease progression) of BSMV:γ and BSMV:TaHCT5B transfected are shown in the figure ( Figure 3 A and B).

[0218] 6.2. WGA staining identification.

[0219] WGA can specifically bind to chitin in the fungal cell wall. The specific steps for WGA staining of the base of wheat stems are as follows:

[0220] Take 2-3cm of wheat stem after inoculation, put it into a 10mL centrifuge tube with decolorizing solution B, and place it in a 37℃ water bath for 16-24h. After it becomes transparent, wash it 3 times with Tris-HCl (50mM, pH=7.5), and let it stand for 10min for the last time. Spread the leaves in a culture dish and add WGA staining solution for staining (just cover the leaves), wrap the culture dish with tin foil, put it in a 4℃ refrigerator to avoid light for 24h, and recover the WGA staining solution after staining, observe it under the green fluorescence channel using a fluorescence microscope or put it in 20-40% glycerol for low temperature storage. The preparation method of WGA staining solution is as follows: 2mg of WGA is dissolved in 400μL of 50mM Tris-HCl (pH=7.5), and each 20μL is divided into a tube, stored at -20℃ in the dark, and diluted to 5mL per 20μL when used, which can be recycled. The preparation method of decolorizing solution B is as follows: 14 μL of surfactant Silwet L-77 is added to every 10 mL of KOH solution (1 mol / L, 5.6 g in 100 mL of water).

[0221] The results of WGA staining at the base of wheat stems showed that ( Figure 3 Middle C), BSMV:TaHCT5B wheat has more Fusarium graminearum hyphae in the stem base tissue than BSMV:γ wheat, and the cell structure of some wheat tissues is incomplete, indicating that TaHCT5B silencing plants promote the extension of hyphae at the base of wheat stems. The experimental results show that silencing TaHCT5B weakens the ability of wheat to resist stem base rot.

[0222] The experimental results of TaHCT5B-silenced wheat all show that the TaHCT5B protein of the present invention and its encoding gene TaHCT5B can regulate the plant's disease resistance to Fusarium graminearum, and the disease resistance of the target plant can be significantly reduced by reducing the content and / or activity of the TaHCT5B protein in the target plant (such as silencing the TaHCT5B gene and reducing its expression level).

[0223] The results of TaHCT5B overexpression in Arabidopsis and TaHCT5B gene silencing in wheat both showed that TaHCT5B protein and its encoding gene TaHCT5B can regulate plant resistance to Fusarium graminearum.

[0224] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of biomaterials, characterized by: The biological material is a substance that improves the expression of the gene encoding the TaHCT5B protein; The application is any one of the following: A1), use of the biological material in improving plant resistance to stem base rot caused by Fusarium graminearum; A2), use of the biological material in the preparation of a product for improving plant resistance to stem base rot caused by Fusarium graminearum; The TaHCT5B protein is any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID No.1; a2), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1); The substance is any of the following: B1), a nucleic acid molecule encoding the TaHCT5B protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); The plant is wheat or Arabidopsis thaliana.

2. The use according to claim 1, characterized in that: The TaHCT5B protein is derived from wheat.

3. The use according to claim 1 or 2, characterized in that: B1) The nucleic acid molecule is a DNA molecule whose coding sequence of the coding strand is SEQ ID No.

2.

4. Application of biomaterials, characterized by: The biological material is a VIGS vector carrying the DNA fragment shown in SEQ ID No. 3; The application is any one of the following: A1), use of the biological material in reducing wheat resistance to stem base rot caused by Fusarium graminearum; A2) Use of the biological material in preparing a product for reducing wheat resistance to stem base rot caused by Fusarium graminearum.

5. A method for improving plant resistance to stem base rot caused by Pseudomonas graminearum, characterized in that: The method comprises introducing a gene encoding TaHCT5B protein into a recipient plant to increase the activity or content of TaHCT5B protein in the recipient plant, thereby increasing the resistance of the recipient plant to stem base rot caused by Pseudomonas graminearum; The TaHCT5B protein is any of the following proteins: a1), the amino acid sequence is the protein shown in SEQ ID No.1; a2), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1); The plant is wheat or Arabidopsis thaliana.

6. A method for cultivating wheat with improved resistance to stem rot caused by Pseudomonas graminearum, characterized in that: The method comprises increasing the content and / or activity of the TaHCT5B protein of claim 1 or 2 in a target plant, thereby obtaining a disease-resistant plant having higher resistance to stem base rot caused by Fusarium graminearum than the target plant; The increasing of the content and / or activity of the TaHCT5B protein in the target plant is achieved by introducing the gene encoding the TaHCT5B protein into the target plant; The plant is wheat.

Images