A KASP marker associated with vitamin C content in non-heading Chinese cabbage and its application

By developing KASP markers and primers at 527509bp on chromosome A03 of the non-heading Chinese cabbage genome, and combining them with PCR fluorescence detection, the problem of determining the vitamin C content of non-heading Chinese cabbage was solved, thus improving breeding efficiency and quality breeding results.

CN118064626BActive Publication Date: 2026-04-03JIANGSU ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-14
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

The lack of KASP markers related to vitamin C content in non-heading Chinese cabbage in existing technologies leads to low breeding efficiency and long breeding cycles for non-heading Chinese cabbage.

Method used

We developed a KASP molecular marker located at 527509 bp on chromosome A03 of the reference genome of non-heading Chinese cabbage, designed specific KASP primers for PCR detection, determined vitamin C content by combining fluorescence signals, and developed corresponding kits and identification methods.

Benefits of technology

This method enables a simple and low-cost determination of vitamin C content, improving the breeding efficiency of non-heading Chinese cabbage and shortening the breeding cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118064626B_ABST
    Figure CN118064626B_ABST
Patent Text Reader

Abstract

This invention discloses a KASP molecular marker associated with the vitamin C content of non-heading Chinese cabbage and its application. The molecular marker is located at position 527509 on chromosome A03 of the non-heading Chinese cabbage genome, with a C-to-T point mutation at position 527509. The KASP primer set used to amplify the molecular marker includes forward primer F1, forward primer F2, and reverse primer R. The nucleotide sequence of forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of reverse primer R is shown in SEQ ID NO:4. This KASP molecular marker can rapidly and efficiently identify whether a non-heading Chinese cabbage variety belongs to a high vitamin C content material or variety, significantly improving breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, and in particular relates to a KASP marker related to the VC content of non-heading Chinese cabbage and its application. Background Technology

[0002] Non-heading Chinese cabbage (Brassica rapa ssp. chinensis), also known as bok choy or baby bok choy, belongs to the Brassica genus of the Brassicaceae family. Originating in the middle and lower reaches of the Yangtze River in my country, it is characterized by its short growing season, rich nutrition, and strong adaptability. Due to its high multiple cropping index, non-heading Chinese cabbage is widely cultivated in my country, especially in cities along the middle and lower reaches of the Yangtze River, where it accounts for approximately 30% to 40% of total vegetable production, playing a vital role in year-round vegetable production and supply. With socio-economic development and improved living standards, people are increasingly emphasizing health and nutrition; therefore, quality traits have gradually become one of the important target traits in the breeding of new non-heading Chinese cabbage varieties. Vitamin C (VC), also known as ascorbic acid, is a water-soluble vitamin widely found in plants, participating in various biological processes such as photosynthesis, growth and development, disease resistance, and stress resistance. VC is also very important for human health, as it can scavenge reactive oxygen free radicals produced in the body, thus playing a role in preventing cancer, anti-aging, and cardiovascular disease. In addition, vitamin C can also treat scurvy. Current research indicates that because the human body lacks L-gulonic acid-1,4-lactone oxidase, it loses the ability to synthesize vitamin C, and humans can only obtain vitamin C from external foods such as fruits and vegetables. Therefore, increasing the vitamin C content of non-heading cabbage is of great significance.

[0003] Zhang Zengcui et al. (1999) analyzed the genetic patterns of vitamin C in two combinations of non-heading Chinese cabbage: *Wuta* × *Aijiaohuang* and *Xuekeqing* × *Aijiaohuang*. They found that the inheritance of vitamin C content conformed to a mixed genetic model of one major gene and multiple genes, with the heritability of the major gene ranging from 52.68% to 74.12%. Lin Tingting et al. (2014) used a six-generation population constructed from high-vitamin *Wuta* and low-vitamin *Erqing* as materials and employed a mixed genetic model of major gene + multiple genes to conduct genetic analysis on the vitamin C content in non-heading Chinese cabbage. They found that the vitamin C content in non-heading Chinese cabbage was controlled by one pair of additive major genes + additive-dominant multiple genes. Li Ying et al. (2008) developed a marker AW5 linked to the gene for high vitamin C content in non-heading Chinese cabbage. 561 And convert it to the SCAR tag SCAW5 532 .

[0004] KASP (Kompetitive Allele-Specific PCR) markers are SNP-based markers with advantages such as high accuracy, strong site adaptability, low cost, and suitability for high-throughput detection. Currently, there are no reports on KASP markers associated with VC content in non-heading Chinese cabbage. Summary of the Invention

[0005] To overcome the shortcomings and deficiencies of the prior art, the purpose of this invention is to provide a KASP marker related to the VC content of non-heading Chinese cabbage and its application.

[0006] This invention is achieved as follows: a KASP molecular marker associated with the VC content of non-heading Chinese cabbage, wherein the molecular marker is located at 527509 bp on chromosome A03 of the reference genome of non-heading Chinese cabbage, and a C-to-T point mutation occurs at 527509 bp. The position of the molecular marker and the nucleotide sequences of 150 bp upstream and downstream are shown in SEQ ID NO:1.

[0007] The present invention further discloses a KASP primer related to VC in non-heading Chinese cabbage, the KASP primer comprising forward primer F1, forward primer F2 and reverse primer R; wherein, the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:4.

[0008] The forward primer F1 is composed of KASP527509-F1 and its 5' end connected to a fluorescent adapter sequence. The nucleotide sequence of KASP527509-F1 is shown in SEQ ID NO:2, and the connected fluorescent adapter is a FAM fluorescent adapter. The nucleotide sequence of the FAM fluorescent adapter is shown in SEQ ID NO:5.

[0009] The forward primer F2 is composed of KASP527509-F2 and its 5' end connected to another fluorescent adapter sequence. The nucleotide sequence of KASP527509-F2 is shown in SEQ ID NO:3, and the connected fluorescent adapter is a HEX fluorescent adapter. The nucleotide sequence of the HEX fluorescent adapter is shown in SEQ ID NO:6.

[0010] The reverse primer R is KASP527509-R, and its nucleotide sequence is shown in SEQ ID NO:4.

[0011] The present invention further discloses a kit for identifying the vitamin C content of non-heading Chinese cabbage, the kit containing the above-mentioned KASP primers.

[0012] This invention further discloses the application of the above-mentioned KASP molecular markers, KASP primers or kits in identifying the VC content of non-heading Chinese cabbage, screening high VC materials, or in the breeding of non-heading Chinese cabbage.

[0013] This invention further discloses a method for genotyping using KASP molecular markers. The method includes the following steps: using the genomic DNA of a non-heading Chinese cabbage sample as a template, performing PCR with the KASP primers of the above-mentioned KASP molecular markers, performing fluorescence detection on the amplification products, and completing genotyping based on the fluorescence signal value.

[0014] This invention further discloses a method for identifying the vitamin C content of non-heading Chinese cabbage using KASP molecular markers. The method includes the following steps: using genomic DNA of the non-heading Chinese cabbage sample as a template, performing PCR with primers containing the aforementioned KASP molecular markers, and detecting the fluorescence of the amplification products. Specifically, if the amplification result shows a T base at 527509 bp, the non-heading Chinese cabbage sample is considered to have a high vitamin C content; if the amplification result shows a C base at 527509 bp, the non-heading Chinese cabbage sample is considered to have a low vitamin C content.

[0015] Compared to the shortcomings and deficiencies of existing technologies, this invention has the following beneficial effects: The KASP marker of this invention can determine the VC content of non-heading Chinese cabbage, and is characterized by its simple operation and low cost. It can efficiently predict the VC content of non-heading Chinese cabbage samples. This marker can be applied to the breeding of high-VC-content non-heading Chinese cabbage varieties, assisting in the quality breeding of non-heading Chinese cabbage, improving breeding efficiency, and shortening the breeding cycle, and has important application prospects. Attached Figure Description

[0016] Figure 1 This is a Manhattan plot of genome-wide association analysis of vitamin C content in non-heading Chinese cabbage in Example 1 of this invention;

[0017] Figure 2 This is a genotyping diagram of different non-heading Chinese cabbage germplasms using the molecular marker KASP527509 in Example 1 of the present invention; wherein, the small circle in ellipse 1 represents the non-heading Chinese cabbage germplasm with high VC content and genotype (T / T), the small circle in ellipse 3 represents the non-heading Chinese cabbage germplasm with low VC content and genotype (C / C), and the small circle in ellipse 2 represents the template-free control NTC. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0019] This invention utilizes genome-wide association analysis (GWAS) to identify a locus associated with vitamin C content in non-heading Chinese cabbage, and develops a KASP molecular marker associated with vitamin C content based on this locus.

[0020] Example 1: Screening to obtain SNP sites associated with VC content in non-heading Chinese cabbage

[0021] This invention uses 164 collected and preserved germplasm resources of non-heading Chinese cabbage as experimental materials, which were planted in the experimental base of Jiangsu Academy of Agricultural Sciences in Liuhe District, Nanjing City in the spring of 2022. At the commercial maturity stage of the non-heading Chinese cabbage, the vitamin C content of the leaves was determined by high-performance liquid chromatography (HPLC). The measurement results are shown in Table 1.

[0022] Table 1. Statistical Table of Germplasm Resources and Vitamin C Content of Non-heading Chinese Cabbage

[0023]

[0024]

[0025]

[0026] Method for determining vitamin C content: Non-heading Chinese cabbage leaves were placed in a mortar and 1.5 mL of 0.1% oxalic acid was added and ground thoroughly. The mixture was centrifuged at 12000g for 15 min at 4℃, and the supernatant was collected. The supernatant was then injected into a high-performance liquid chromatograph (HPLC) to determine the vitamin C content. The chromatographic mobile phase was 0.1% acetic acid, and the flow rate was 1 mL / min. -1 The column temperature was 30℃ and the detection wavelength was 245nm.

[0027] Genome resequencing: DNA was extracted from the leaves of the experimental materials in Table 1 using a kit method. After the sample DNA passed the test, it was fragmented by sonication. The fragmented DNA was then purified, end-repaired, 3'-end A-added, and sequencing adapters ligated. Fragment size selection was performed by agarose gel electrophoresis, followed by PCR amplification to form sequencing libraries. The constructed libraries underwent quality control, and those that passed were sequenced using the Illumina HiSeq platform. Filtered clean reads were compared with the reference genome of non-heading Chinese cabbage using bwa-mem2 software, and the results showed an average sequencing depth of 13.6×.

[0028] Genome-wide association analysis (GWAS): SNP calling was performed using GATK software. SNPs were filtered according to minor allele frequency (MAF) > 0.05 and locus integrity (INT) > 0.8, resulting in 2,091,473 highly congruent SNPs. Genome-wide association analysis (GWAS) was then performed using EMMAX software with a mixed linear model to analyze genotype and phenotypic traits. Simultaneously, -Log... 10 P≥5 is used as the significance threshold, when the SNP's -Log 10 A p-value ≥ 5 indicates a significantly associated locus. Nineteen loci significantly associated with VC content in non-heading Chinese cabbage were identified, mainly distributed on five chromosomes: A03, A04, A05, A08, and A09 (Table 2). Figure 1 ).

[0029] Table 2. SNP loci information related to VC content in non-heading Chinese cabbage.

[0030]

[0031] Example 2: Development of the KASP tag

[0032] A 301 bp sequence was obtained by selecting 150 bp sequences upstream and downstream of position 527509 bp on chromosome A03 of the non-heading Chinese cabbage genome, as shown in SEQ ID NO:1. The molecular marker located at position 527509 bp on chromosome A03 of the non-heading Chinese cabbage genome corresponds to position 151 of SEQ ID NO:1, where the nucleotide is C or T.

[0033] To address the SNP variation at this location, KASP primers were designed using the Poly Marker website according to KASP design principles. Two forward primers, KASP527509-F1 / KASP527509-F2, and one universal reverse primer, KASP527509-R, were designed, with the following nucleotide sequences:

[0034] KASP527509-F1: 5'-CAGAAAACAATGCTGGAGAGTC (SEQ ID NO: 2);

[0035] KASP527509-F2: 5'-CAGAAAACAATGCTGGAGAGTT (SEQ ID NO: 3);

[0036] KASP527509-R: 5'-CAAGACCATGAAGATATCCGAG (SEQ ID NO: 4).

[0037] The KASP primers were designed based on the genotypic variations of single plants with high and low VC content at position 527509 on chromosome A03, where the high VC genotype is T / T and the low VC genotype is C / C.

[0038] The 5' end of primer KASP527509-F1 is ligated to the FAM fluorescent adapter sequence, and the 5' end of primer KASP527509-F2 is ligated to the HEX fluorescent adapter sequence. The primer sequences after ligation with fluorescent adapters are as follows:

[0039] Forward primer F1: GAAGGTGACCAAGTTCATGCT CAGAAAACAATGCTGGAGAGTC (SEQ ID NO:7, where the underlined part is the FAM fluorescent tag sequence);

[0040] Forward primer F2: GAAGGTCGGAGTCAACGGATT CAGAAAACAATGCTGGAGAGTT (SEQ ID NO:8, where the underlined part is the HEX fluorescent tag sequence);

[0041] Reverse primer R: CAAGACCATGAAGATATCCGAG (SEQ ID NO:4).

[0042] Genomic DNA extraction from the sample to be tested:

[0043] Genomic DNA was extracted from leaves of non-heading Chinese cabbage using the CTAB (hexadecyl trimethyl ammonium bromide) method.

[0044] Example 3: Genotyping and VC Content Identification

[0045] The synthesized forward primers F1, F2, and R were dissolved in TE (pH 8.0) to a concentration of 10 μM, and then prepared as a primer mixture (KASP Primer Mix) at a volume ratio of F1:F2:R = 1:1:3. Using the genomic DNA of the non-heading Chinese cabbage germplasm resources obtained in step (1) as templates, PCR reactions were performed according to the following reaction system and procedure. The negative control used ddH2O instead of template DNA.

[0046] The total volume of the PCR reaction system was 10 μL, including 5 μL of 2×KASP master mix, 2.5 μL of primer mix, and 2.5 μL of template DNA (30 ng / μL). The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s; annealing and extension at 61℃~56℃ for 60 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ in each cycle; the second cycle consisted of 94℃ denaturation for 20 s; annealing and extension at 55℃ for 60 s, for a total of 26 cycles.

[0047] When performing fluorescence detection on the amplification products, if the sample PCR product only detects the fluorescence signal corresponding to the forward primer F1 which is linked to the fluorescent adapter sequence, the genotype at the detection site is C / C, and it is determined to be a single plant with low VC content; if the sample PCR product only detects the fluorescence signal corresponding to the forward primer F2 which is linked to the fluorescent adapter sequence, the genotype at the detection site is T / T, and it is determined to be a single plant with high VC content.

[0048] Genotyping of 42 non-heading Chinese cabbage germplasm resources with different VC contents was performed using the marker KASP527509. The results are as follows: Figure 2 As shown in Table 3, among the nine non-heading Chinese cabbage samples with high VC content (VC content > 115 mg / 100 g (FW)), eight samples had the genotype T / T, with an accuracy rate of 88.88%.

[0049] Table 3. Vitamin C content and genotyping results of 42 non-heading Chinese cabbage samples.

[0050] serial number Vitamin C content (mg / 100g, fat-free) genotype serial number Vitamin C content (mg / 100g, fat-free) genotype BR1 145.08 T / T BR22 54.57 C / C BR2 140.19 T / T BR23 54.06 C / C BR3 134.79 T / T BR24 53.73 C / C BR4 134.03 T / T BR25 53.60 C / C BR5 125.11 C / C BR26 52.60 C / C BR6 123.41 T / T BR27 52.05 C / C BR7 119.38 T / T BR28 51.98 C / C BR8 118.09 T / T BR29 51.74 C / C BR9 115.09 T / T BR30 51.41 C / C BR10 58.37 C / C BR31 50.52 C / C BR11 58.25 C / C BR32 50.35 C / C BR12 58.02 C / C BR33 49.61 C / C BR13 57.51 C / C BR34 48.97 C / C BR14 57.03 C / C BR35 47.91 C / C BR15 57.00 C / C BR36 45.27 C / C BR16 56.92 C / C BR37 42.99 C / C BR17 56.79 C / C BR38 41.60 C / C BR18 56.54 C / C BR39 39.50 C / C BR19 55.83 C / C BR40 36.63 C / C BR20 55.39 C / C BR41 36.31 C / C BR21 54.77 C / C BR42 34.37 C / C

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A KASP primer associated with the vitamin C content of non-heading Chinese cabbage, characterized in that, The KASP primers include forward primer F1, forward primer F2, and reverse primer R; wherein the nucleotide sequence of forward primer F1 is shown in SEQ ID NO:7, the nucleotide sequence of forward primer F2 is shown in SEQ ID NO:8, and the nucleotide sequence of reverse primer R is shown in SEQ ID NO:

4.

2. A reagent kit for identifying the vitamin C content in non-heading Chinese cabbage, characterized in that, This kit contains the KASP primers as described in claim 1.

3. The application of the KASP primers of claim 1 or the kit of claim 2 in identifying the VC content of non-heading Chinese cabbage or screening non-heading Chinese cabbage with high VC content.

4. A method for genotyping using KASP molecular markers, characterized in that, The method includes the following steps: using the genomic DNA of the non-heading Chinese cabbage sample to be tested as a template, performing PCR with the KASP primers described in claim 1, detecting the fluorescence of the amplification products, and completing genotyping based on the fluorescence signal value.

5. A method for identifying the vitamin C content in non-heading Chinese cabbage using KASP molecular markers, characterized in that, The method includes the following steps: using the genomic DNA of the non-heading Chinese cabbage sample to be tested as a template, performing PCR with the KASP primers described in claim 1, and performing fluorescence detection on the amplification product. If the genotype of the detection site is T / T, it is determined that the VC content of the non-heading Chinese cabbage sample to be tested is high; if the genotype of the detection site is C / C, it is determined that the VC content of the non-heading Chinese cabbage sample to be tested is low.

Citation Information

Patent Citations

  • Process for marking high Vc content gene molecules of Chinese cabbage

    CN101338341A

  • Non-heading Chinese cabbage core SNP molecular marker set developed based on KASP technology and application of non-heading Chinese cabbage core SNP molecular marker set

    CN113403423A