Use of protein follandpe7 in reducing pathogenicity of fusarium oxysporum f. sp. cubense

By constructing and utilizing knockout and addition plasmids of FoUPE7, the causal agent of banana wilt, FoUPE7 mutants were screened, solving the problem of controlling banana wilt in existing technologies. This achieved the effects of reducing pathogenicity and maintaining the survival ability of the strain, providing new control targets and agents.

CN118085044BActive Publication Date: 2026-02-10SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410075167.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-18
Publication Date
2026-02-10
Estimated Expiration
2044-01-18

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control banana wilt disease, chemical control is not ideal, and there is a lack of targeted agents that target the pathogenicity of banana wilt fungus.

Method used

By constructing knockout and complement plasmids of the banana wilt pathogen gene FoUPE7, and using these plasmids to transform protoplasts, FoUPE7 knockout mutants and complement mutants were screened out. It was found that the protein FoUPE7 regulates pathogenicity, and pathogenicity can be reduced by inhibiting FoUPE7 expression or knocking out its gene.

Benefits of technology

It significantly reduces the pathogenicity of Fusarium wilt in bananas, maintains its antioxidant capacity and cell wall integrity, and provides new targets and a basis for formulation development for the prevention and control of Fusarium wilt in bananas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118085044B_ABST
    Figure CN118085044B_ABST
Patent Text Reader

Abstract

The application discloses application of protein FoUPE7 in reducing pathogenicity of banana fusarium wilt. The application constructs a knockout plasmid and a back complementation plasmid of a gene (FoUPE7) coding protein FoUPE7 of banana fusarium wilt, transforms corresponding protoplasts by using the knockout plasmid and the back complementation plasmid respectively, and selects FoUPE7 knockout mutants and back complementation mutants to find and analyze pathogenicity. It is found that knockout of the gene FoUPE7 can significantly reduce the pathogenicity of banana fusarium wilt, and the pathogenicity of banana fusarium wilt is restored and equivalent to that of the wild type after back complementation of the gene, which indicates that the protein FoUPE7 is a pathogenicity-related protein of banana fusarium wilt, regulates the pathogenicity of banana fusarium wilt, and can be used as a target for prevention and treatment of banana fusarium wilt. The application provides a new target for prevention and treatment of banana fusarium wilt, and is beneficial to development of a banana fusarium wilt prevention and treatment preparation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology. More specifically, it relates to the application of protein FoUPE7 in reducing the pathogenicity of banana wilt pathogen. Background Technology

[0002] Fusarium wilt, also known as Panama disease, is a devastating soil-borne disease caused by Fusarium oxysporum f.sp.cubense (Foc). Of the known Foc races, race 4 (Foc4) is the most damaging, infecting almost all cultivated banana varieties, including plantains, basil, and succulents, causing enormous economic losses to the banana industry.

[0003] Currently, conventional chemical control methods are not very effective against banana wilt. Therefore, researching the pathogenic mechanism of the wilt fungus and identifying proteins that regulate its pathogenicity, and then developing formulations targeting these proteins to control the disease, may be key to effectively controlling banana wilt. Summary of the Invention

[0004] This invention provides the application of protein FoUPE7 in regulating the pathogenicity of Fusarium wilt of banana, enriches the protein database related to the pathogenicity of Fusarium wilt of banana, and is beneficial to the development of control agents for Fusarium wilt of banana.

[0005] The first objective of this invention is to provide the application of protein FoUPE7 in reducing the pathogenicity of Fusarium wilt in bananas.

[0006] A second objective of this invention is to provide the application of protein FoUPE7 in maintaining the antioxidant capacity of Fusarium wilt in bananas.

[0007] A third objective of this invention is to provide the application of protein FoUPE7 in maintaining the cell wall integrity of Fusarium wilt of banana.

[0008] A fourth objective of this invention is to provide an agent for inhibiting the expression of the protein FoUPE7 or an agent for knocking out the gene encoding the protein FoUPE7 for the application of reducing the pathogenicity of Fusarium wilt in bananas.

[0009] A fifth object of the present invention is to provide the use of formulations that inhibit the expression of the protein FoUPE7 or for knocking out the gene encoding the protein FoUPE7 in the preparation of products that reduce the pathogenicity of Fusarium wilt of banana.

[0010] The sixth object of the present invention is to provide an application of a formulation for inhibiting the expression of the protein FoUPE7 or a formulation for knocking out the gene encoding the protein FoUPE7 in the prevention and control of banana wilt disease.

[0011] A seventh object of the present invention is to provide the use of formulations that inhibit the expression of the protein FoUPE7 or for knocking out the gene encoding the protein FoUPE7 in the preparation of products for the prevention and control of banana wilt disease.

[0012] The eighth object of the present invention is to provide a method for reducing the pathogenicity of banana wilt pathogen.

[0013] The ninth objective of this invention is to provide a method for preventing and controlling banana wilt disease.

[0014] The above-mentioned objective of this invention is achieved through the following technical solution:

[0015] The protein FoUPE7 described in this invention is an unknown protein, lacking known domains, and is only known to be highly conserved within the Fusarium genus. This invention constructs knockout and complement plasmids for the FoUPE7 gene of *Fusarium wilt*, transforms corresponding protoplasts using these plasmids, and screens for FoUPE7 knockout and complement mutants. Pathogenicity analysis reveals that knocking out FoUPE7 significantly reduces the pathogenicity of *Fusarium wilt*, while returning the gene restores its pathogenicity to levels comparable to the wild type. This indicates that FoUPE7 is a pathogenicity-related protein of *Fusarium wilt*, regulating its pathogenicity. Furthermore, knocking out FoUPE7 also affects the cell wall integrity and oxidative stress resistance of *Fusarium wilt*. Therefore, this invention seeks protection for the following applications:

[0016] This invention seeks to protect the use of protein FoUPE7 in reducing the pathogenicity of Fusarium wilt in bananas.

[0017] Specifically, the application is achieved by inhibiting the expression of the protein FoUPE7 or knocking out the gene encoding the protein FoUPE7.

[0018] The present invention also seeks protection for the use of the protein FoUPE7 in maintaining the antioxidant capacity of Fusarium wilt of banana.

[0019] The present invention also seeks protection for the use of the protein FoUPE7 in maintaining the cell wall integrity of Fusarium wilt of banana.

[0020] The present invention also claims protection for the use of preparations that inhibit the expression of the protein FoUPE7 or preparations for knocking out the gene encoding the protein FoUPE7 in reducing the pathogenicity of Fusarium wilt of banana.

[0021] The present invention also claims protection for the use of formulations that inhibit the expression of the protein FoUPE7 or for the use of formulations that knock out the gene encoding the protein FoUPE7 in the preparation of products that reduce the pathogenicity of Fusarium wilt of banana.

[0022] Since banana wilt is a disease caused by *Fusarium wiltii*, reducing its pathogenicity can prevent its occurrence and mitigate its damage. Knocking out or inhibiting the expression of the *Fusarium wiltii* gene FoUPE7 can affect the expression of the FoUPE7 protein, thereby reducing the pathogenicity of the fungus. Therefore, this invention also claims protection for the use of preparations that inhibit the expression of the FoUPE7 protein or preparations for knocking out the gene encoding the FoUPE7 protein in the control of banana wilt.

[0023] The present invention also claims protection for the use of formulations that inhibit the expression of the FoUPE7 protein or for the use of formulations that knock out the gene encoding the FoUPE7 protein in the preparation of products for the prevention and control of banana wilt disease.

[0024] Optionally, the reagent for inhibiting the expression of the FoUPE7 protein is siRNA targeting the FoUPE7 gene.

[0025] Specifically, the formulation for knocking out the gene encoding the protein FoUPE7 includes its knockout plasmid.

[0026] As one implementation method, the knockout plasmid is constructed based on the filamentous fungal expression vector pCT74.

[0027] The present invention also provides a method for reducing the pathogenicity of Fusarium wilt of bananas, wherein the method comprises: blocking or inhibiting the expression of the Fusarium wilt protein FoUPE7.

[0028] The present invention also provides a method for preventing and controlling banana wilt disease, wherein the method involves blocking or inhibiting the expression of the banana wilt pathogen protein FoUPE7.

[0029] Specifically, the amino acid sequence of the protein FoUPE7 described in this invention is shown in SEQ ID NO: 2.

[0030] Specifically, the nucleotide sequence of the gene encoding the protein FoUPE7 is shown in SEQ ID NO: 1.

[0031] Specifically, the banana wilt disease is caused by the fungus *Fusarium wiltum*. The disease is controlled by blocking or inhibiting the expression of the fungus protein FoUPE7, thereby reducing the pathogenicity of the fungus.

[0032] More specifically, the fungus causing banana wilt is race 4 of the fungus causing banana wilt.

[0033] The present invention has the following beneficial effects:

[0034] This invention constructs knockout and complement plasmids for the gene encoding FoUPE7, the protein of Fusarium wilt of banana. Using these plasmids, corresponding protoplasts are transformed, and FoUPE7 knockout and complement mutants are screened. Pathogenicity analysis reveals that knocking out FoUPE7 significantly reduces the pathogenicity of Fusarium wilt, while reintroducing the gene restores the pathogenicity to a level comparable to the wild type. This indicates that FoUPE7 is a pathogenicity-related protein of Fusarium wilt, regulating its pathogenicity, and can be used as a target for the control of Fusarium wilt in bananas. This invention provides a new target for the control of Fusarium wilt in bananas, which is beneficial for the development of control agents. Attached Figure Description

[0035] Figure 1 A schematic diagram illustrating the principle of knocking out the FoUPE7 gene of banana wilt pathogen.

[0036] Figure 2 This is a schematic diagram of the plasmid pCTZN-FoUPE7-com, which is used to replace the FoUPE7 gene of banana wilt pathogen.

[0037] Figure 3 The results of PCR verification analysis of the hph gene in some hygromycin-positive transformants are shown in the figure; M is Marker2000; lane 1 is Foc4 wild type; lane 2 is pCT74 plasmid; lane 3 is transformant ΔFoUPE7-2; lane 4 is ΔFoUPE7-5; lane 5 is ΔFoUPE7-7; lane 6 is ΔFoUPE7-8; lane 7 is ΔFoUPE7-12.

[0038] Figure 4 The results of PCR verification analysis of the FoUPE7 gene in some hygromycin-resistant transformants are shown in the figure; M is Marker2000; lane 1 is Foc4 wild type; lane 2 is pCT74 plasmid; lane 3 is transformant ΔFoUPE7-2; lane 4 is ΔFoUPE7-5; lane 5 is ΔFoUPE7-7; lane 6 is ΔFoUPE7-8; lane 7 is ΔFoUPE7-12.

[0039] Figure 5 The results of PCR verification analysis of the FoUPE7 gene in some bleomycin-positive transformants are shown in the figure; M is Marker2000; lane 1 is water; lane 2 is transformant ΔFoUPE7-7-com-1; lane 3 is transformant ΔFoUPE7-7-com-4; lane 4 is transformant ΔFoUPE7-7-com-5.

[0040] Figure 6 Colony morphology of FoUPE7 knockout mutant and its complement mutant on different culture media.

[0041] Figure 7 Figure A shows the stress resistance analysis results of FoUPE7 knockout mutant and its complement mutant; Figure A shows the growth of FoUPE7 knockout mutant and its complement mutant in PDA medium containing different stresses; Figure B shows the statistical analysis results of the growth of FoUPE7 knockout mutant and its complement mutant under different stress conditions.

[0042] Figure 8 The results of pathogenicity analysis of FoUPE7 knockout mutant and its complement mutant are shown; A in the figure represents the symptoms of Brazilian banana plants and bulbs; B in the figure represents the statistical analysis results of the disease index. Detailed Implementation

[0043] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0044] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0045] Example 1: Construction of knockout and complement mutants of the FoUPE7 gene, a fungus that causes banana wilt.

[0046] The nucleotide sequence of the banana wilt pathogen gene FoUPE7 described in this invention is shown in SEQ ID NO:1; the amino acid sequence of the protein it encodes is shown in SEQ ID NO:2.

[0047] 1. Experimental materials

[0048] (1) Test strains and plants

[0049] The strain of Fusarium wilt used in this invention is race 4 (Foc4) of Fusarium wilt of banana, and the test plant is Cavendish (AAA).

[0050] (2) Host bacteria and plasmid vector

[0051] The cloning vector used in this invention is pMD18-T, the gene knockout vector is pCT74, and the gene complementation vector is pCTZN. The complementation vector pCTZN is obtained by modifying the pCT74 vector by replacing the fluorescent protein gene (SGFP) and hygromycin phosphotransferase gene (hph) on pCT74 with the bleomycin gene.

[0052] 2. Experimental Methods

[0053] The schematic diagram illustrating the principle of knocking out the FoUPE7 gene of banana wilt pathogen in this invention is shown below. Figure 1 As shown. By Figure 1 As can be seen, this invention achieves FoUPE7 gene knockout by replacing the hygromycin phosphotransferase gene hph and the fluorescent protein gene SGFP with homologous recombination. The FoUPE7 gene knockout process is as follows:

[0054] (1) Amplification of upstream and downstream homologous fragments of gene FoUPE7

[0055] After comparison, the upstream and downstream sequences of the gene FoUPE7 were found in the NCBI database. Sequences of approximately 1000 bp in length were selected from both the upstream and downstream sequences as homologous fragments. The upstream homologous fragment was named homologous arm A, and the downstream homologous fragment was named homologous arm B. Primers designed to amplify the FoUPE7 homologous fragments are shown in Table 1. Appropriate restriction enzyme sites were incorporated during primer design to facilitate the subsequent construction of the gene knockout vector.

[0056] Table 1 Primers used to amplify upstream and downstream homologous fragments of the FoUPE7 gene.

[0057]

[0058] Note: The underlined positions are enzyme cleavage sites.

[0059] Genomic DNA was extracted from Foc4 using the OMEGA Fungal DNA Kit. Using the extracted DNA as a template, the homologous arm sequences of the FoUPE7 gene were amplified using the primers shown in Table 1. Primers FoUPE7-AF and FoUPE7-AR were used to amplify homologous arm A, and primers FoUPE7-BF and FoUPE7-BR were used to amplify homologous arm B. The PCR reaction systems used for amplification are shown in Table 2.

[0060] Table 2. PCR reaction system used for amplifying homologous arms.

[0061]

[0062]

[0063] The PCR reaction conditions used were: 94℃ for 5 min; 98℃ for 10 s; 57℃ for 30 s; 72℃ for 1 min, for a total of 35 cycles; and 72℃ for 10 min.

[0064] After the PCR reaction was completed, the PCR amplification products were purified and recovered using the OMEGACycle Pure Kit.

[0065] (2) Construction of FoUPE7 knockout plasmid

[0066] Referring to the instructions of the pMD18-T Vector Cloning Kit (TakaRa), the amplified homologous arms FoUPE7-A and FoUPE7-B were ligated to the T vector to obtain recombinant plasmids pMD18T-FoUPE7-A and pMD18T-FoUPE7-B. The specific procedure is as follows: Take 1 μL of pMD18-T vector, add 4 μL of PCR recovered product (homologous arm A fragment or homologous arm B fragment) and 5 μL of solution I, and ligate overnight at 16℃; take 10 μL of ligation product and 100 μL of E. coli DH5α competent cells and gently mix, place on ice for 30 min; heat shock in a water bath at 42℃ for 90 s, cool on ice for 5 min; add 800 μL of LB liquid medium, and culture at 37℃ and 150 rpm for 45 min with shaking; centrifuge at 4000 rpm for 5 min, discard the supernatant, keep 100 μL of bacterial solution and mix with the precipitate by pipetting, spread on LB solid medium (containing 100 μg / mL ampicillin (Amp)), and culture at 37℃ for 8–12 h.

[0067] Positive transformants resistant to Amp were selected, and their recombinant plasmid DNA was extracted and sequenced. Recombinant plasmid DNA with correct sequencing results was selected to construct the FoUPE7 gene knockout vector. The specific procedure is as follows: The recombinant plasmid pMD18T-FoUPE7-A and the pCT74 vector were double-digested with Apa I and Xho I, respectively, and the homologous arm A fragment and the linearized pCT74 vector were recovered. The homologous arm A fragment was ligated to the linearized pCT74 using T4 DNA ligase and transformed into *E. coli* DH5α to obtain the recombinant plasmid pCT74-FoUPE7-A (the transformation process for *E. coli* was the same as above). Following the same procedure, recombinant plasmids pMD18T-FoUPE7-B and pCT74-FoUPE7-A were double-digested with Xma I and Spe I, respectively. The homologous arm B fragment and the linearized recombinant plasmid pCT74-FoUPE7-A were recovered. The homologous arm B fragment was ligated to pCT74-FoUPE7-A using T4 DNA ligase and transformed into E. coli DH5α. Positive transformants with Amp resistance were selected, and the recombinant plasmid DNA contained in them was extracted and identified by enzyme digestion to obtain the FoUPE7 gene knockout plasmid pCT74-FoUPE7-KO.

[0068] (3) Amplification of FoUPE7 complement fragment

[0069] The FoUPE7 complement fragment selected in this invention includes a 1500 bp promoter sequence upstream of FoUPE7 and a 500 bp terminator sequence downstream of it. Primers were designed for the selected complement fragment and appropriate restriction enzyme sites were introduced. The primers designed for amplifying the FoUPE7 complement fragment are shown in Table 3.

[0070] Table 3 Primers used for amplifying the FoUPE7 complement fragment

[0071] Primer name Primer sequence (5'-3') Enzyme cleavage sites FoUPE7-com-F <![CDATA[AA CTGCAG TGGTAAACCGTCCGGAAACG]]> Pst I FoUPE7-com-R <![CDATA[GC TCTAGA CAGACGGAACAACAGCCAAC]]> Xba I

[0072] Note: The underlined positions are enzyme cleavage sites.

[0073] Genomic DNA was extracted from Foc4 using the OMEGA Fungal DNA Kit. Using the extracted genomic DNA as a template, PCR amplification was performed with primers FoUPE7-com-F and FoUPE7-com-R to obtain the complement fragment of the FoUPE7 gene (FoUPE7-com). The PCR reaction system used is shown in Table 4.

[0074] Table 4. PCR reaction system used for amplifying and complementing fragments.

[0075] Template DNA 1.0μL FoUPE7-com-F (10 μmol / L) 1.0μL FoUPE7-com-R (10 μmol / L) 1.0μL <![CDATA[10×Ex Taq Buffer(Mg 2+ plus)]]> 5.0μL dNTPs (2.5 mmol / L) 4.0μL Ex Taq (5U / μL) 0.25μL <![CDATA[ddH2O]]> 37.75μL Total 50.0μL

[0076] The PCR reaction conditions used were: 94℃ for 5 min; 98℃ for 10 s; 57℃ for 30 s; 72℃ for 3 min, for a total of 35 cycles; and 72℃ for 10 min.

[0077] After the PCR reaction was completed, the PCR amplification products were purified and recovered using the OMEGACycle Pure Kit.

[0078] (4) Construction of FoUPE7 complement plasmid

[0079] The purified and recovered FoUPE7-com fragment and pCTZN vector were double-digested with Pst I and Xba I, respectively, to recover the FoUPE7-com fragment and the linearized pCTZN vector. The FoUPE7-com fragment was ligated to the linearized pCTZN vector using T4 DNA ligase and transformed into *E. coli* DH5α. Positive transformants resistant to Amp were selected, and the recombinant plasmid DNA contained within them was extracted and identified by enzyme digestion to obtain the complement vector pCTZN-FoUPE7-com containing the FoUPE7 gene. A schematic diagram of the FoUPE7 complement plasmid pCTZN-FoUPE7-com, representing the *Fusarium wilt* gene of banana, is shown below. Figure 2 As shown.

[0080] (5) Preparation of Foc4 protoplasts

[0081] Foc4 cells were inoculated into Czapek's medium (FeSO4·7H2O 0.018g, KCl 0.5g, K2HPO4·3H2O 1g, MgSO4·7H2O 0.5g, NaNO3 3g, sucrose 30g, and diluted to 1L with distilled water) and cultured at 28℃ with shaking at 150rpm for 3 days. The culture medium was filtered through a cell sieve, centrifuged at 4℃ and 5000rpm for 10min, and the supernatant was discarded. The precipitate was diluted to 800mL with CM liquid medium (tryptone 2g, yeast extract 1g, casein hydrolysate 1g, 20× nitrate 50mL, 1000× vitamin 1mL, 1000× trace element 1mL, pH 1000). 6.5; glucose 10g, adjusted to 200mL) resuspended and diluted to prepare a conidia suspension; the conidia suspension was inoculated into CM liquid medium and cultured at 28℃ and 120rpm for 11-13h with shaking; the mycelium was filtered through a cell sieve and washed 3-5 times with 0.8mol / L NaCl solution to obtain fresh mycelium; the mycelium was mixed with the enzymatic hydrolysate at a volume ratio of 10:1 and enzymatically hydrolyzed at 120rpm for 3h to obtain protoplast hydrolysate; the mycelium was centrifuged at 4℃ and 2000rpm for 10min, the supernatant was discarded, and the precipitate was resuspended in pre-cooled STC solution (containing 100mmol / L Tris-HCl pH 7.5, 1.2mol / L sorbitol, and 50mmol / L CaCl2); the precipitate was centrifuged again, the supernatant was discarded, and the precipitate was resuspended in pre-cooled STC solution to obtain Foc4 protoplast suspension.

[0082] The protoplasts of the banana wilt pathogen knockout mutant were prepared following the same steps as those for preparing the Foc4 protoplasts.

[0083] (6) Transformation of Foc4 protoplasts

[0084] The transformation of protoplasts using the FoUPE7 knockout plasmid of the banana wilt pathogen is illustrated using this example. The knockout plasmid pCT74-FoUPE7-KO was digested with Apa I and Spe I to obtain the A-hph-SGFP-B fragment, which was then recovered via gel electrophoresis. The A-hph-SGFP-B fragment was mixed with the protoplasts and incubated on ice for 20 min. Freshly prepared PTC transformation buffer (40% PEG4000, 1.2 mol / L sorbitol, 50 mmol / L CaCl2 and 10 mmol / L Tris-HCl, pH 7.5) was added, mixed, and incubated on ice for 7 min. Freshly prepared PTC solution was added again, mixed, and incubated on ice for 7 min. Pre-chilled STC was added, mixed, and incubated at room temperature for 7 min. The mixture was then centrifuged at 4000 rpm for 15 min at 4°C. 3 mL of the solution was added. The precipitate was resuspended in PDA liquid regeneration medium (containing 200.0 g potato, 273.6 g sucrose, and distilled water to a final volume of 1 L) and cultured at 28°C with shaking at 100 rpm for 13–16 h to regenerate the cell wall. The solution was then centrifuged at 4000 rpm for 15 min, the supernatant was discarded, and PDA solid regeneration medium (PDA liquid regeneration medium with 1.5% agar powder and 150 μg / mL hygromycin) was added. The mixture was poured onto a plate and incubated in the dark at 28°C for 2–3 days. Positive transformants with hygromycin resistance were picked and transferred to PDA medium containing 150 μg / mL hygromycin (containing 200.0 g potato, 20.0 g anhydrous glucose, 15.0 g agar, and distilled water to a final volume of 1 L). The medium was incubated in the dark at 28°C for 3–4 days, and single colonies were picked for identification.

[0085] The transformation of the FoUPE7 complement plasmid of Fusarium wilt of banana was the same as above. The difference was that the protoplasts used for transformation were protoplasts of the FoUPE7 knockout mutant of Fusarium wilt of banana, and the antibiotic used to screen for positive transformants was bleomycin at a concentration of 200 μg / mL.

[0086] (7) PCR validation analysis of FoUPE7 knockout mutant

[0087] Following the instructions of the OMEGA Fungal DNA Kit, genomic DNA was extracted from the screened positive transformants containing hygromycin for PCR verification analysis. First, the hph gene fragment was amplified by PCR using primers hph-F / hph-R, followed by the FoUPE7 fragment amplification using primers FoUPE7-F / FoUPE7-R. If the hph gene fragment was amplified but the FoUPE7 fragment was not, it indicates that the amplified positive transformant was a FoUPE7 knockout mutant. The nucleotide sequences of the primers used for the above amplification are shown below:

[0088] hph-F: 5′-TGCTGCTCCATACAAGCCAA-3′;

[0089] hph-R: 5′-GACATTGGGGAGTTCAGCGA-3′.

[0090] FoUPE7-F: 5′-AAGTTCAGGCCATCCTCCTC-3′;

[0091] FoUPE7-R: 5′-TTCAAGTTCCTTTCCGACAAACCA-3′.

[0092] The PCR reaction system used for PCR validation analysis of knockout mutants is shown in Table 5:

[0093] Table 5. PCR reaction system used for PCR validation analysis of knockout mutants.

[0094] Template DNA 1μL FoUPE7-F / hph-F (10 μmol / L) 1μL FoUPE7-R / hph-R (10 μmol / L) 1μL 2×T5 Super PCR Mix (Basic) 12.5μL <![CDATA[ddH2O]]> 9.5μL Total 25.0μL

[0095] The PCR reaction conditions used were: 98℃ for 3 min; 98℃ for 10 s, 64℃ for 10 s, 72℃ for 30 s, for a total of 30 cycles; and 72℃ for 5 min to obtain the amplification product.

[0096] This invention utilizes homologous recombination to transform gene knockout vectors into protoplasts of *Fusarium wilt* fungus, obtaining 14 hygromycin-positive transformants. Genomic DNA was extracted from these hygromycin-positive transformants, and PCR verification was performed using specific primers for the *hph* and *FoUPE7* genes. The PCR verification analysis results for the *hph* gene in some of the hygromycin-positive transformants are shown below. Figure 3 As shown; the PCR validation analysis results of the FoUPE7 gene in some hygromycin-resistant transformants are as follows. Figure 4 As shown. By Figure 3 and 4 The results show that the present invention has obtained the FoUPE7 knockout mutant (ΔFoUPE7-7).

[0097] (8) PCR validation analysis of FoUPE7 complemented mutant

[0098] Following the instructions of the OMEGA Fungal DNA Kit, genomic DNA was extracted from the screened bleomycin-resistant positive transformants and subjected to PCR verification analysis. The FoUPE7 gene was amplified by PCR using primers FoUPE7-F / FoUPE7-R. If the FoUPE7 gene was amplified, it indicated that the amplified positive transformant was a FoUPE7 complement mutant. The PCR reaction system used for the PCR verification analysis of the complement mutant is shown in Table 6.

[0099] Table 6. PCR reaction system used for PCR validation analysis of the complemented mutants.

[0100] Template DNA 1μL FoUPE7-F (10 μmol / L) 1μL FoUPE7-R (10 μmol / L) 1μL 2×T5 Super PCR Mix (Basic) 12.5μL <![CDATA[ddH2O]]> 9.5μL Total 25.0μL

[0101] The PCR reaction conditions used were: 98℃ for 3 min; 98℃ for 10 s, 64℃ for 10 s, 72℃ for 30 s, for a total of 30 cycles; and 72℃ for 5 min to obtain the amplification product.

[0102] This invention utilizes a random insertion method to transform the complemented plasmid pCTZN-FoUPE7-com into protoplasts of *Fusarium wilt* ΔFoUPE7-7, obtaining nine bleomycin-positive transformants. Genomic DNA was extracted from these bleomycin-positive transformants, and PCR verification analysis was performed using FoUPE7 gene-specific primers. The PCR verification analysis results of the FoUPE7 gene in some of the bleomycin-positive transformants are shown below. Figure 5 As shown. By Figure 5 It is known that the present invention has obtained the FoUPE7 complement mutant (ΔFoUPE7-7-com).

[0103] Example 2: Phenotypic observation of FoUPE7 knockout mutant and complement mutant

[0104] 1. Colony morphology observation and growth rate determination

[0105] Wild-type Foc4, knockout mutants (ΔFoUPE7-2, ΔFoUPE7-5, and ΔFoUPE7-7), and complement mutant ΔFoUPE7-7-com-1 were inoculated into PDA (200g potato, 20g glucose, 15g agar, volume adjusted to 1L), CM (10g glucose, 1g hydrolyzed casein, 2g peptone, 1g yeast extract, 50mL 20× nitrate, 1mL 1000× vitamin, 1mL 1000× trace elements, 15g agar, volume adjusted to 1L, pH 6.5, with glucose prepared as a separate sterilized solution before being added and mixed), and MM (10g glucose, 50mL 20× nitrate, 1mL 1000× vitamin, 1mL 1000× trace elements, 15g agar, volume adjusted to 1L, pH 6.5), respectively. 6.5, where glucose was prepared as a solution and sterilized separately, and then added to the mixed medium and cultured at 28°C in the dark. On day 5, the colony diameter was measured and the colony morphology was observed.

[0106] Colony morphology of FoUPE7 knockout mutant and its complement mutant on different culture media, as shown in the figure. Figure 6 As shown, wild-type Foc4 is used as a control. (From...) Figure 6 It can be seen that, compared with the wild type, there is no significant difference in colony morphology and growth rate of ΔFoUPE7.

[0107] 2. Observation of conidial production and germination

[0108] Wild-type Foc4, knockout mutants (ΔFoUPE7-2, ΔFoUPE7-5, and ΔFoUPE7-7), and complement mutant ΔFoUPE7-7-com-1 were inoculated onto Czapek's medium and cultured at 28°C with shaking at 120 rpm for 3 days. Sporulation yield was then recorded and analyzed. The results showed that the sporulation yield of mutant ΔFoUPE7 was not different from that of the wild-type.

[0109] Example 3: Stress resistance analysis of FoUPE7 knockout mutants and complement mutants

[0110] 1. Analysis of high osmotic pressure stress

[0111] Wild-type Foc4, knockout mutants (ΔFoUPE7-5 and ΔFoUPE7-7), and complement mutant ΔFoUPE7-7-com-1 were inoculated onto PDA medium containing 1 mol / L NaCl and 1 mol / L sorbitol, respectively. After incubation at 28°C with the medium inverted for 5 days, colony growth was observed and colony diameter was measured.

[0112] 2. Oxidative stress analysis

[0113] Wild-type Foc4, knockout mutants (ΔFoUPE7-5 and ΔFoUPE7-7), and complement mutant ΔFoUPE7-7-com-1 were inoculated onto PDA medium containing 10 mmol / L H2O2 and incubated upside down at 28°C for 5 days. Colony growth was observed and colony diameter was measured.

[0114] 3. Cell wall integrity analysis

[0115] Wild-type Foc4, knockout mutants (ΔFoUPE7-5 and ΔFoUPE7-7), and complement mutant ΔFoUPE7-7-com-1 were inoculated onto PDA medium containing 200 μg / mL CR, 100 μg / mL CFW, and 0.05% SDS, respectively. After incubation at 28°C with the medium inverted for 5 days, colony growth was observed and colony diameter was measured.

[0116] The stress resistance analysis results of FoUPE7 knockout mutants and their complement mutants are as follows: Figure 7 As shown; Figure 7 In the figure, A represents the growth of FoUPE7 knockout mutant and its complement mutant in PDA medium containing different stresses; Figure 7 In the figure, B represents the statistical analysis results of the growth of FoUPE7 knockout mutants and their complement mutants under different stress conditions. Figure 7 It can be seen that: (1) In PDA medium containing 1 mol / L NaCl and 1 mol / L sorbitol, the growth of ΔFoUPE7 was not significantly different from that of the wild type, indicating that FoUPE7 had no effect on the ability of Foc4 to resist high osmotic pressure. (2) In PDA medium containing 200 μg / mL CR and 100 μg / mL CFW, the growth of ΔFoUPE7 was not significantly different from that of the wild type, but in PDA medium containing 0.05% SDS, compared with the wild type, the ΔFoUPE7 mutant showed increased sensitivity to 0.05% SDS stress, indicating that the absence of FoUPE7 affected the integrity of the Foc4 cell wall. (3) In PDA medium containing 10 mmol / L H2O2, compared with the wild type, the ΔFoUPE7 mutant showed decreased sensitivity to 10 mmol / L H2O2 stress, indicating that the absence of FoUPE7 affected the antioxidant capacity of Foc4.

[0117] Example 4: Pathogenicity analysis of FoUPE7 knockout mutants and complement mutants

[0118] Brazilian bananas with uniform growth at the 4-leaf stage were selected, and inoculated using the root-damage inoculation method. Conidia (1×10⁻⁶) from the Foc4 wild-type, knockout mutants (ΔFoUPE7-5 and ΔFoUPE7-7), and the replacement mutant ΔFoUPE7-7-com-1 were used respectively.5 The roots were treated with a suspension of (number of bananas / mL) for 40 min; after the root soaking treatment, the seedlings were transplanted into sterile nutrient soil and placed in a plant culture room at 25±1℃ for 12 h / 12 ​​h light and dark alternation culture. After 28 days, the disease incidence of banana seedling leaves and bulbs was observed and the disease index was calculated. The disease index was statistically analyzed. The disease grading standard was based on the method of Huang Yonghui (2016) (Table 7), and the water treatment group was used as the control.

[0119] Table 7 Grading Standards for Banana Fusarium Wilt Disease (Huang Yonghui, 2016)

[0120]

[0121] The disease index is calculated as follows: Disease Index = ∑(Disease Grade × Number of Plants with Disease at That Grade) / (Highest Grade × Total Number of Plants Surveyed) × 100

[0122] The pathogenicity analysis results of FoUPE7 knockout mutants and their complement mutants are as follows: Figure 8 As shown; Figure 8 In the diagram, A represents the symptoms of the Brazilian banana plant and its bulb; Figure 8 In the figure, B represents the statistical analysis result of the disease index. Figure 8 It was found that the Brazilian banana plants in the water control group did not show leaf yellowing, and the corms did not change color. After inoculation with the Foc4 wild-type, most Brazilian banana plants showed obvious yellowing on the upper and lower leaves, and more than 50% of the corm area showed browning. After inoculation with ΔFoUPE7, most Brazilian banana plants only showed yellowing on the lower leaves, and the discolored area of ​​the corm did not exceed 50%. After inoculation with the complement mutant ΔFoUPE7-7-com, most Brazilian banana plants also showed extensive yellowing on the upper and lower leaves, and more than 50% of the corm area showed browning. Figure 8 (A) This invention further statistically analyzed the disease index of Brazilian banana plants. The results showed that the disease index of the complemented mutant ΔFoUPE7-7-com-1 was similar to that of the wild-type Foc4, indicating that the pathogenicity of the complemented mutant was restored to the wild-type level. Meanwhile, the disease index of ΔFoUPE7 was significantly lower than that of the wild-type and the complemented mutant (A). Figure 8 (B in the text). The above results indicate that knocking out the FoUPE7 gene significantly reduces the pathogenicity of Fusarium wilt of banana.

[0123] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of protein FoUPE7 in reducing the pathogenicity of Fusarium wilt in bananas, characterized in that, The application is achieved by knocking out the gene encoding the protein FoUPE7; the amino acid sequence of the protein is shown in SEQ ID NO:

2.

2. The application of an agent for knocking out the gene encoding the protein FoUPE7 in reducing the pathogenicity of Fusarium wilt in bananas, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The application of a formulation for knocking out the gene encoding the protein FoUPE7 in the preparation of products that reduce the pathogenicity of Fusarium wilt in bananas, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. The application of an agent for knocking out the gene encoding the protein FoUPE7 in the control of banana wilt disease, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO:

2.

5. The application of a formulation for knocking out the gene encoding the FoUPE7 protein in the preparation of products for controlling banana wilt disease, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO:

2.

6. A method for reducing the pathogenicity of Fusarium wilt in bananas, characterized in that, The method is achieved by knocking out the gene encoding the protein FoUPE7; the amino acid sequence of the protein is shown in SEQ ID NO.

2.

7. A method for controlling banana wilt disease, characterized in that, The method is achieved by knocking out the gene encoding the protein FoUPE7; the amino acid sequence of the protein is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of protein FoUPE1 in regulation and control of pathogenicity of banana fusarium wilt

    CN113201054A

  • Application of gene FoUPE3 in prevention and control of banana wilt

    CN113956337A